Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc

Size: px
Start display at page:

Download "Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc"

Transcription

1 Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector pdtpi-gfp Supplemental Figure 1. pdtpi protein localizes to the chloroplast. () lignment of pdtpi amino acid sequence with proteins from rabidopsis (t cytotpi), Petunia (gi602589), Solanum chacoense (gi ), Coptis japonica (gi340520), Oryza sativa (gi169820; gi ), Triticum aestivum (gi ), Glycine max (gi ), Phaseolus vulgaris (gi ), Secale cereale (gi407524), Hordeum, vulgare (gi ), Pteris vittata (gi ). () Subcellular localization of the pdtpi:gfp fusion protein in leaf cells. Transgenic rabidopsis leaf protein expressing pdtpi- GFP was fractionated and detected by immunoblotting. Plastid PDH α-subunit was used to determine plastid enrichment; antibody to the mitochondrial PDH α-subunit was used to assay mitochondria enrichment. (C) Leaves from the transgenic pdtpi-gfp lines were observed by confocal microscopy. Transgenic lines transformed with vector only were used as a control.

2 Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc t2g Root Stem Leaf Flower Silique 28 cycles t2g t2g cycles t2g UQ 33 cycles Supplemental Figure 2. Expression of alternatively spliced pdtpi transcripts. Tissues were harvested from wild-type. RT-PCR was applied to detect transcript abundance. Primers S21170F and S21170R were used to amplify 122 bp and 95 bp fragments from splice variant 1 and splice variant 2, respectively. UQ was used as loading control.

3 Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc Salk Salk TG cytotpi Salk Salk cytotpi T UQ C Salk Salk Supplemental Figure 3. CytoTPI mutant identification. () Schematic representation of T-DN insertion positions in t3g55440 gene., T-DN left border. () cytotpi gene expression was not affected in Salk and Salk T-DN insertion lines. (C) Salk and Salk appeared similar to wild type when grown for 7 weeks under long-day conditions.

4 Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc Salk (pdtpi) Salk CS P1 TG P2 P3 TG Salk P1/P3 C Salk CS Salk pdtpi a1/p3 UQ Supplemental Figure 4. Characterization of pdtpi mutant. () Schematic representation of T-DN insertion positions in t2g21170 gene., T-DN left border. The primer locations and directions were indicated here. () T-DN insertion in Salk was verified by PCR by combining T-DN primer and plant gene-specific primers. (C) RT-PCR results indicated that T-DN insertion in Salk line reduced gene expression. pdtpi gene expression in Salk and CS829061, however, was not affected. UQ was used as a control.

5 Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc MS sucrose glucose F1,6-P DHP GP PG WT pdtpi WT pdtpi WT pdtpi WT pdtpi WT pdtpi WT pdtpi WT pdtpi MS MS sucrose glucose F1,6-P DHP GP PG WT pdtpi Dark WT pdtpi WT pdtpi WT pdtpi WT pdtpi WT pdtpi WT pdtpi WT pdtpi Dark to light Supplemental Figure 5. Metabolite augmentation does not rescue the pdtpi mutant phenotype. () Plants germinated on MS agar plates with the addition of 1 mm of sucrose, glucose, fructose-1, 6- bisphosphate (F-1,6-P), dihydrohyacetone phosphate (DHP), DL-glyceraldehyde 3-phosphate (GP) and D(-)3-phosphoglyceric acid (PG) for 5 d. () Plants were first germinated on regular MS plates under darkness for 5 d, and then were transferred onto MS plates enriched with glycolytic intermediates and grown for an additional 2 d under continuous white light.

6 Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc M bp 250 bp P2/P3 500 bp 250 bp a1/p3 WT Line 3 Line 4 Line 6 Supplemental Figure 6. Complementation of pdtpi mutant by transgenic expression of pdtpi cdn. () PCR genotyping of individual transgenic T1 lines. () Wild type and complementation lines grew under long-day condition for 20 days; the T2 generation of rescued lines 3, line 4 and line 6 are shown here.

7 Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc Control 25uM 25mM 125mM pdtpi Supplemental Figure 7. pdtpi mutant can not be rescued by the application of myo-inositiol. Wild type and pdtpi mutant were germinated on myo-inositol enriched MS plates for 5 d under continuous white light.

8 Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc KDa pdtpi L S ng 10 ng 1 ng 500 pg 250 pg 125 pg 62.5 pg 100 ng 10 ng 1 ng 500 pg 250 pg 125 pg 62.5 pg cytotpi ΔpdTPI Supplemental Figure 8. Rubisco large subunit is down-regulated in the pdtpi mutant. () Total protein from 5-d old seedlings was isolated and separated by SDS-PGE. L: Rubisco large subunit, S: Rubisco small subunit. nti-cytotpi polyclonal antibody cross-reacts with pdtpi protein. () Different amounts of purified, recombinant cytotpi and ΔpdTPI protein were separated by SDS-PGE, transferred to nitrocellulose membrane and probed with anti-cytotpi antibody.

Supplemental Data. Perrella et al. (2013). Plant Cell /tpc

Supplemental Data. Perrella et al. (2013). Plant Cell /tpc Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1121356/dc1 Supporting Online Material for Polar PIN Localization Directs Auxin Flow in Plants Justyna Wiśniewska, Jian Xu, Daniela Seifertová, Philip B. Brewer, Kamil

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/452/ra106/dc1 Supplementary Materials for Stem-piped light activates phytochrome B to trigger light responses in Arabidopsis thaliana roots Hyo-Jun Lee, Jun-Ho

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,

More information

** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.

** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation. Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *

More information

Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated

Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin

More information

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions. Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods

More information

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and

More information

Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.

Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny

More information

EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA

EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA Item Type text; Electronic Thesis Authors Bergstrand, Lauren Janel Publisher The University of Arizona. Rights Copyright is held by the author. Digital

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative

More information

GFP GAL bp 3964 bp

GFP GAL bp 3964 bp Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive

More information

Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering

Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering by Valverde et. Al Published in Science 2004 Presented by Boyana Grigorova CBMG 688R Feb. 12, 2007 Circadian Rhythms: The Clock Within

More information

Supplemental Data. Wang et al. (2014). Plant Cell /tpc

Supplemental Data. Wang et al. (2014). Plant Cell /tpc Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and

More information

Arabidopsis PPR40 connects abiotic stress responses to mitochondrial electron transport

Arabidopsis PPR40 connects abiotic stress responses to mitochondrial electron transport Ph.D. thesis Arabidopsis PPR40 connects abiotic stress responses to mitochondrial electron transport Zsigmond Laura Supervisor: Dr. Szabados László Arabidopsis Molecular Genetic Group Institute of Plant

More information

Table S1 List of primers used for genotyping and qrt-pcr.

Table S1 List of primers used for genotyping and qrt-pcr. Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!

More information

Supp- Figure 2 Confocal micrograph of N. benthamiana tissues transiently expressing 35S:YFP-PDCB1. PDCB1 was targeted to plasmodesmata (twin punctate

Supp- Figure 2 Confocal micrograph of N. benthamiana tissues transiently expressing 35S:YFP-PDCB1. PDCB1 was targeted to plasmodesmata (twin punctate Supplemental Data. Simpson et al. (009). n rabidopsis GPI-anchor plasmodesmal neck protein with callosebinding activity and potential to regulate cell-to-cell trafficking. 5 0 stack Supp- Figure Confocal

More information

Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed

Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed using the Geneious software. Accession numbers of the

More information

The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively as positive regulators of salt stress tolerance in rice

The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively as positive regulators of salt stress tolerance in rice Lou et al. BMC Plant Biology (2018) 18:203 https://doi.org/10.1186/s12870-018-1408-0 RESEARCH ARTICLE Open Access The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively

More information

Lipid transfer proteins confer resistance to trichothecenes

Lipid transfer proteins confer resistance to trichothecenes Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance

More information

respect to the wild type in the later stages of growth. Photograph showing representative plants after 5 and 10 weeks growth.

respect to the wild type in the later stages of growth. Photograph showing representative plants after 5 and 10 weeks growth. A Supplemental Data. Araújo et al. (211). Plant Cell 1.115/tpc.11.81224 C B.5 Supplemental Figure 1. Characterization and expression of tomato SDH2-2. (A) Dendogram of iron sulphur subunit of SDH. SDH2

More information

23-. Shoot and root development depend on ratio of IAA/CK

23-. Shoot and root development depend on ratio of IAA/CK Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal

More information

Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2

Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2 Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2 IRT1, FRO2 and FIT expression levels in roots of the wild-type, nas4x- 1 and nas4x-2, showing that in both nas mutants

More information

JMJ14-HA. Col. Col. jmj14-1. jmj14-1 JMJ14ΔFYR-HA. Methylene Blue. Methylene Blue

JMJ14-HA. Col. Col. jmj14-1. jmj14-1 JMJ14ΔFYR-HA. Methylene Blue. Methylene Blue Fig. S1 JMJ14 JMJ14 JMJ14ΔFYR Methylene Blue Col jmj14-1 JMJ14-HA Methylene Blue Col jmj14-1 JMJ14ΔFYR-HA Fig. S1. The expression level of JMJ14 and truncated JMJ14 with FYR (FYRN + FYRC) domain deletion

More information

Lecture 13: PROTEIN SYNTHESIS II- TRANSLATION

Lecture 13: PROTEIN SYNTHESIS II- TRANSLATION http://smtom.lecture.ub.ac.id/ Password: https://syukur16tom.wordpress.com/ Password: Lecture 13: PROTEIN SYNTHESIS II- TRANSLATION http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/translation2.gif

More information

Supplemental Data. Yamamoto et al. (2016). Plant Cell /tpc WT + HCO 3. slac1-4/δnc #5 + HCO 3 WT + ABA. slac1-4/δnc #5 + ABA

Supplemental Data. Yamamoto et al. (2016). Plant Cell /tpc WT + HCO 3. slac1-4/δnc #5 + HCO 3 WT + ABA. slac1-4/δnc #5 + ABA I (pa) I (pa) A WT + HCO 3 B 2 V (mv) 15 1 5 5 2 slac14/δnc #5 + HCO 3 4 6 WT (n = 6) 8 WT + HCO 3 (n = 7) slac14/δnc #5 (n = 6) slac14/δnc #5 + HCO 3 (n = 1) C WT + ABA D 2 V (mv) 15 1 5 5 2 slac14/δnc

More information

Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao

Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao New Phytologist Supporting Information Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bhlh transcription factor MtTT8 Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang

More information

Supplemental material

Supplemental material Supplemental material THE JOURNAL OF CELL BIOLOGY Mourier et al., http://www.jcb.org/cgi/content/full/jcb.201411100/dc1 Figure S1. Size and mitochondrial content in Mfn1 and Mfn2 knockout hearts. (A) Body

More information

Supplemental Figures. Supplemental Data. Sugliani et al. Plant Cell (2016) /tpc Clades RSH1. Rsh1[HS] RSH2 RSH3. Rsh4[HS] HYD TGS ACT

Supplemental Figures. Supplemental Data. Sugliani et al. Plant Cell (2016) /tpc Clades RSH1. Rsh1[HS] RSH2 RSH3. Rsh4[HS] HYD TGS ACT Supplemental Figures Clades RSH1 TP - HYD TGS ACT Rsh1[HS] RSH2 TP HYD SYN TGS Rsh2[HS] RSH3 TP HYD SYN TGS CRSH TP - SYN EFh Rsh4[HS] Supplemental Figure 1. Arabidopsis RSH domain structure. Schematic

More information

Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day

Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day conditions. Photo was taken when the wild type plant started to bolt. Scale bar represents 1 cm. Supplemental Figure 2. Flowering

More information

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation

More information

Ch. 10 Photosynthesis: The Calvin Cycle Life from Air

Ch. 10 Photosynthesis: The Calvin Cycle Life from Air Ch. 10 Photosynthesis: The Calvin Cycle Life from Air 2007-2008 Whoops! Wrong Calvin The Calvin Cycle 1950s 1961 Remember what it means to be a plant Need to produce all organic molecules necessary for

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplemental Methods Isolation and mapping of SPCH An EMS-mutagenized population of tmm-1 (Col);E1728 (an enhancer trap GFP marking guard cells) was created. M2 seeds were collected from M1 s planted in

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature12791 Supplementary Figure 1 (1/3) WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 1 (2/3) 2 WWW.NATURE.COM/NATURE SUPPLEMENTARY

More information

Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type

Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type A B 2 3 3 2 1 1 Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type (A) and d27 (B) seedlings at the four

More information

Vital metabolism for survival of life in the earth. Prof Adinpunya Mitra Agricultural & Food Engineering Department

Vital metabolism for survival of life in the earth. Prof Adinpunya Mitra Agricultural & Food Engineering Department Vital metabolism for survival of life in the earth Prof Adinpunya Mitra Agricultural & Food Engineering Department THE SUN: MAIN SOURCE OF ENERGY FOR LIFE ON EARTH THE BASICS OF PHOTOSYNTHESIS Almost all

More information

Importance of Protein sorting. A clue from plastid development

Importance of Protein sorting. A clue from plastid development Importance of Protein sorting Cell organization depend on sorting proteins to their right destination. Cell functions depend on sorting proteins to their right destination. Examples: A. Energy production

More information

4) Please cite Dagda et al J Biol Chem 284: , for any publications or presentations resulting from use or modification of the macro.

4) Please cite Dagda et al J Biol Chem 284: , for any publications or presentations resulting from use or modification of the macro. Supplement Figure S1. Algorithmic quantification of mitochondrial morphology in SH- SY5Y cells treated with known fission/fusion mediators. Parental SH-SY5Y cells were transiently transfected with an empty

More information

Ethylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis

Ethylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis Ethylene is critical to the maintenance of primary root growth and Fe homeostasis under Fe stress in Arabidopsis Guangjie Li, Weifeng Xu, Herbert J. Kronzucker, Weiming Shi * Supplementary Data Supplementary

More information

Photosynthesis: Life from Light and Air

Photosynthesis: Life from Light and Air Photosynthesis: Life from Light and Air 2007-2008 Energy needs of life All life needs a constant input of energy consumers producers Heterotrophs (Animals) get their energy from eating others eat food

More information

Oxidative Phosphorylation versus. Photophosphorylation

Oxidative Phosphorylation versus. Photophosphorylation Photosynthesis Oxidative Phosphorylation versus Photophosphorylation Oxidative Phosphorylation Electrons from the reduced cofactors NADH and FADH 2 are passed to proteins in the respiratory chain. In eukaryotes,

More information

Supplemental Data. Hou et al. (2016). Plant Cell /tpc

Supplemental Data. Hou et al. (2016). Plant Cell /tpc Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc.16.295 A Distance to 1 st nt of start codon Distance to 1 st nt of stop codon B Normalized PARE abundance 8 14 nt 17 nt Frame1 Arabidopsis inflorescence

More information

Biological Roles of Cytokinins

Biological Roles of Cytokinins Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators

More information

Photosynthesis: The Calvin Cycle

Photosynthesis: The Calvin Cycle Whoops! Wrong Calvin 1950s 1961 Photosynthesis: The Calvin Cycle Remember what it means to be a plant Need to produce all organic molecules necessary for growth carbohydrates, lipids, proteins, nucleic

More information

Supplementary Table 1. Primers used in this study.

Supplementary Table 1. Primers used in this study. Supplementary Tale 1. Primers used in this study. Name Primer sequence (5'-3') Primers of PCR-ased molecular markers developed in this study M1 F M1 R M2 F M2 R M3 F M3 R M4 F M4 R M5 F M5 R M6 F M6 R

More information

Supplemental Table 1. Primers used for cloning and PCR amplification in this study

Supplemental Table 1. Primers used for cloning and PCR amplification in this study Supplemental Table 1. Primers used for cloning and PCR amplification in this study Target Gene Primer sequence NATA1 (At2g393) forward GGG GAC AAG TTT GTA CAA AAA AGC AGG CTT CAT GGC GCC TCC AAC CGC AGC

More information

** LCA LCN PCA

** LCA LCN PCA % of wild type value % of wild type value a 12 1 8 2 b 12 1 8 2 LCA LCN PCA Col- sod3-1 Supplementary Figure 1 sod3-1 influences cell proliferation. (a) Fifth leaf cell area (LCA) and leaf cell number

More information

Last time: Obtaining information from a cloned gene

Last time: Obtaining information from a cloned gene Last time: Obtaining information from a cloned gene Objectives: 1. What is the biochemical role of the gene? 2. Where and when is the gene expressed (transcribed)? 3. Where and when is the protein made?

More information

Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach

Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach ABSTRACT SUBMITTED TO JAMIA MILLIA ISLAMIA NEW DELHI IN PARTIAL FULFILMENT OF

More information

Mechanism of CO 2 Fixation: Rubisco Step 1

Mechanism of CO 2 Fixation: Rubisco Step 1 dark means light-indendent! The Dark Reaction: Carbon Fixation Requires Rubisco: Ribulose-1,5-bisphosphate carboxylase RuBPi + C 6 x 3PG MW = 550, 000 g/mol Subunits eight small (14,000 g/mol) eight large

More information

EST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7.

EST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7. hest1a / SMG6 EST1 Homology Domain 100 aa 853 695 761 780 1206 hest1 / SMG5 -like? -like 109 145 214 237 497 165 239 1016 114 207 212 381 583 hest1c / SMG7 a helical 1091 Sc 57 185 267 284 699 Figure S1:

More information

BCH Graduate Survey of Biochemistry

BCH Graduate Survey of Biochemistry BCH 5045 Graduate Survey of Biochemistry Instructor: Charles Guy Producer: Ron Thomas Director: Marsha Durosier Lecture 55 Slide sets available at: http://hort.ifas.ufl.edu/teach/guyweb/bch5045/index.html

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature10534 Supplementary Fig. 1. Diagrammatic representation of the N-end rule pathway of targeted proteolysis (after Graciet and Wellmer 2010 9 ). Tertiary, secondary

More information

LECTURE 4: PHOTOTROPISM

LECTURE 4: PHOTOTROPISM http://smtom.lecture.ub.ac.id/ Password: https://syukur16tom.wordpress.com/ LECTURE 4: PHOTOTROPISM LECTURE FLOW 1. 2. 3. 4. 5. INTRODUCTION DEFINITION INITIAL STUDY PHOTROPISM MECHANISM PHOTORECEPTORS

More information

C-4 PATHWAY USMAN SUMO FRIEND TAMBUNAN ARLI ADITYA PARIKESIT EVI KRISTIN WULANDARI

C-4 PATHWAY USMAN SUMO FRIEND TAMBUNAN ARLI ADITYA PARIKESIT EVI KRISTIN WULANDARI C-4 PATHWAY USMAN SUMO FRIEND TAMBUNAN ARLI ADITYA PARIKESIT EVI KRISTIN WULANDARI BIOINFORMATICS GROUP DEPARTMENT OF CHEMISTRY FACULTY OF MATHEMATICS AND SCIENCE UNIVERSITY OF INDONESIA C-4 Plants The

More information

Plant mitochondrial dynamics

Plant mitochondrial dynamics Plant mitochondrial dynamics Peroxisome Chloroplast Nucleus Mitochondria from Alberts et al. 1994 Living Arabidopsis leaf 10 µm Logan & Leaver (2000) Journal of Experimental Botany, 51: 865-871 5 µm S.

More information

37 Modelling and experimental evidence for two separate steady states in the photosynthetic Calvin cycle

37 Modelling and experimental evidence for two separate steady states in the photosynthetic Calvin cycle 37 Modelling and experimental evidence for two separate steady states in the photosynthetic Calvin cycle M.G. Poolman and D.A. Fell School of Biology and Molecular Science, Oxford Brookes University, Headington,

More information

By Jonathan I. Watkinson. Virginia Polytechnic Institute and State University. Doctor of Philosophy Horticulture

By Jonathan I. Watkinson. Virginia Polytechnic Institute and State University. Doctor of Philosophy Horticulture Characterization of two genes, trehalose-6-phosphate synthase/phosphatase and nucleotide binding protein, shown to be differentially regulated in roots of Cypripedium parviflorum var. pubescens grown with

More information

The Role of Inorganic Carbon Transport and Accumulation in the CO 2 -Concentrating Mechanism and CO 2 Assimilation in Chlamydomonas

The Role of Inorganic Carbon Transport and Accumulation in the CO 2 -Concentrating Mechanism and CO 2 Assimilation in Chlamydomonas The Role of Inorganic Carbon Transport and Accumulation in the CO 2 -Concentrating Mechanism and CO 2 Assimilation in Chlamydomonas Is there a Role for the CCM in Increasing Biological CO 2 Capture? Generalized

More information

GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL

GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,

More information

Development 143: doi: /dev : Supplementary information

Development 143: doi: /dev : Supplementary information Supplementary Materials and Methods Plant materials The mutants and transgenic plants used in the present study were as follows: E361 (from Alex Webb s laboratory); tmm-1, ptmm::tmm-gfp and flp-1 (from

More information

Degradation of Rubulose-1, 5-Bisphosphate Carboxylase/Oxygenase in Wheat Leaves During Dark-induced Senescence

Degradation of Rubulose-1, 5-Bisphosphate Carboxylase/Oxygenase in Wheat Leaves During Dark-induced Senescence Acta Botanica Sinica 2004, 46 (2): 137 141 Rapid Communication http://www.chineseplantscience.com Degradation of Rubulose-1, 5-Bisphosphate Carboxylase/Oxygenase in Wheat Leaves During Dark-induced Senescence

More information

Genetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity

Genetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity Genetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity Shih-Heng Su, Maria Cristina Suarez-Rodriguez, Patrick Krysan

More information

Effect of Acetosyringone on Agrobacterium-mediated Transformation of Eustoma grandiflorum Leaf Disks

Effect of Acetosyringone on Agrobacterium-mediated Transformation of Eustoma grandiflorum Leaf Disks JARQ 51 (4), 351-355 (2017) https://www.jircas.go.jp Improvement in Agrobacterium-mediated Transformation of Eustoma grandiflorum by Acetosyringone Effect of Acetosyringone on Agrobacterium-mediated Transformation

More information

Genome-wide multilevel spatial interactome model of rice

Genome-wide multilevel spatial interactome model of rice Sino-German Workshop on Multiscale Spatial Computational Systems Biology, Beijing, Oct 8-12, 2015 Genome-wide multilevel spatial interactome model of rice Ming CHEN ( 陈铭 ) mchen@zju.edu.cn College of Life

More information

Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids

Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Plant growth conditions The soil was a 1:1 v/v mixture of loamy soil and organic compost. Initial soil water content was determined

More information

Supplemental material

Supplemental material Supplemental material Table 1- Segregation analysis of sgt1a sgt1b double mutant plants Parental genotype No. of lines Normal seeds Phenotype Abnormal seeds Ratio of abnormal seeds (%) WT 3 171 2 1.16

More information

(A) Calvin cycle (B) Cyclic electron transfer (C) Non-cyclic electron transfer (D) Photorespiration (E) Cellular respiration

(A) Calvin cycle (B) Cyclic electron transfer (C) Non-cyclic electron transfer (D) Photorespiration (E) Cellular respiration AP Biology - Problem Drill 08: Photosynthesis No. 1 of 10 #01 1. What term does the statement below refer to? In a photosynthesis process, an electron is excited from P700 and delivered to its receptor,

More information

PHOTOSYNTHESIS: A BRIEF STORY!!!!!

PHOTOSYNTHESIS: A BRIEF STORY!!!!! PHOTOSYNTHESIS: A BRIEF STORY!!!!! This is one of the most important biochemical processes in plants and is amongst the most expensive biochemical processes in plant in terms of investment. Photosynthesis

More information

Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles

Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN

More information

2015 AP Biology PRETEST Unit 3: Cellular Energetics Week of October

2015 AP Biology PRETEST Unit 3: Cellular Energetics Week of October Name: Class: _ Date: _ 2015 AP Biology PRETEST Unit 3: Cellular Energetics Week of 19-23 October Multiple Choice Identify the choice that best completes the statement or answers the question. 1) Which

More information

Characters related to higher starch accumulation in cassava storage roots

Characters related to higher starch accumulation in cassava storage roots Characters related to higher starch accumulation in cassava storage roots You-Zhi Li **1, Jian-Yu Zhao *1, San-Min Wu 1, Xian-Wei Fan 1, Xing-Lu Luo 1 & Bao-Shan Chen **1 1 State Key Laboratory for Conservation

More information

1 (a) Fig. 1.1 is a diagram representing a three-dimensional view of a chloroplast. space B. Fig (i) Name parts A to C in Fig A... B...

1 (a) Fig. 1.1 is a diagram representing a three-dimensional view of a chloroplast. space B. Fig (i) Name parts A to C in Fig A... B... 1 (a) Fig. 1.1 is a diagram representing a three-dimensional view of a chloroplast. A space B C Fig. 1.1 (i) Name parts A to C in Fig. 1.1. A... B... C... [3] (ii) Describe two ways in which the structure

More information

Liu, Yang (2012) The characterization of a novel abscission-related gene in Arabidopsis thaliana. PhD thesis, University of Nottingham.

Liu, Yang (2012) The characterization of a novel abscission-related gene in Arabidopsis thaliana. PhD thesis, University of Nottingham. Liu, Yang (2012) The characterization of a novel abscission-related gene in Arabidopsis thaliana. PhD thesis, University of Nottingham. Access from the University of Nottingham repository: http://eprints.nottingham.ac.uk/12529/3/thesis_part_2_final.pdf

More information

Maria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner

Maria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner ABA represses the transcription of chloroplast genes Maria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner Supplementary data Supplementary tables Table

More information

LIGHT DEPENDENT & INDEPENDENT REACTIONS

LIGHT DEPENDENT & INDEPENDENT REACTIONS LIGHT DEPENDENT & INDEPENDENT REACTIONS Photosynthesis is a two stage process Light dependent reactions o requires DIRECT light energy omakes energy carrier molecules that are used in the dark reaction

More information

Significance. 1 To whom correspondence should be addressed.

Significance. 1 To whom correspondence should be addressed. REDUCED CHLOROPLAST COVERAGE genes from Arabidopsis thaliana help to establish the size of the chloroplast compartment Robert M. Larkin a,b,c,1, Giovanni Stefano b, Michael E. Ruckle b,c,2, Andrea K. Stavoe

More information

SOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent Seed Germination Downstream of PIL5 W

SOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent Seed Germination Downstream of PIL5 W The Plant Cell, Vol. 20: 1260 1277, May 2008, www.plantcell.org ª 2008 American Society of Plant Biologists SOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent

More information

Photosynthesis Definition and Superficial Overview

Photosynthesis Definition and Superficial Overview Photosynthesis Photosynthesis Definition and Superficial Overview Photosynthesis is the process used by plants to convert light energy from the sun into chemical energy that can be later released to fuel

More information

Chapter 10: PHOTOSYNTHESIS

Chapter 10: PHOTOSYNTHESIS Chapter 10: PHOTOSYNTHESIS 1. Overview of Photosynthesis 2. Light Absorption 3. The Light Reactions 4. The Calvin Cycle 1. Overview of Photosynthesis Chapter Reading pp. 185-190, 206-207 What is Photosynthesis?

More information

Located in the thylakoid membranes. Chlorophyll have Mg + in the center. Chlorophyll pigments harvest energy (photons) by absorbing certain

Located in the thylakoid membranes. Chlorophyll have Mg + in the center. Chlorophyll pigments harvest energy (photons) by absorbing certain a review Located in the thylakoid membranes. Chlorophyll have Mg + in the center. Chlorophyll pigments harvest energy (photons) by absorbing certain wavelengths (blue-420 nm and red-660 nm are most important).

More information

Photosynthesis. I. Photosynthesis overview A. Purpose B. Location. The light vs. the dark reaction Chloroplasts pigments A. Light absorption B.

Photosynthesis. I. Photosynthesis overview A. Purpose B. Location. The light vs. the dark reaction Chloroplasts pigments A. Light absorption B. Photosynthesis I. Photosynthesis overview A. Purpose B. Location II. III. The light vs. the dark reaction Chloroplasts pigments A. Light absorption B. Types IV. Light reactions A. Photosystems B. Photophosphorylation

More information

NOTES: CH 10, part 3 Calvin Cycle (10.3) & Alternative Mechanisms of C-Fixation (10.4)

NOTES: CH 10, part 3 Calvin Cycle (10.3) & Alternative Mechanisms of C-Fixation (10.4) NOTES: CH 10, part 3 Calvin Cycle (10.3) & Alternative Mechanisms of C-Fixation (10.4) 10.3 - The Calvin cycle uses ATP and NADPH to convert CO 2 to sugar The Calvin cycle, like the citric acid cycle,

More information

Chapter 8 PHOTOSYNTHESIS Chapter # Chapter Title PowerPoint Image Slideshow

Chapter 8 PHOTOSYNTHESIS Chapter # Chapter Title PowerPoint Image Slideshow COLLEGE BIOLOGY PHYSICS Chapter 8 PHOTOSYNTHESIS Chapter # Chapter Title PowerPoint Image Slideshow Figure 8.0 Photosynthesis Figure 8.1 Earth s distribution of photosynthesis as seen via chlorophyll a

More information

Questions for Biology IIB (SS 2006) Wilhelm Gruissem

Questions for Biology IIB (SS 2006) Wilhelm Gruissem Questions for Biology IIB (SS 2006) Plant biology Wilhelm Gruissem The questions for my part of Biology IIB, Plant Biology, are provided for self-study and as material for the exam. Please note that the

More information

DOI: 10.1038/ncb2819 Gαi3 / Actin / Acetylated Tubulin Gαi3 / Actin / Acetylated Tubulin a a Gαi3 a Actin Gαi3 WT Gαi3 WT Gαi3 WT b b Gαi3 b Actin Gαi3 KO Gαi3 KO Gαi3 KO # # Figure S1 Loss of protein

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Microarray analysis Grains of 7 DAP of the wild-type and gif1 were harvested for RNA preparation. Microarray analysis was performed with the Affymetrix (Santa Clara, CA) GeneChip

More information

Supplemental Data. Yang et al. (2012). Plant Cell /tpc

Supplemental Data. Yang et al. (2012). Plant Cell /tpc Supplemental Figure 1. Mature flowers of P. heterotricha. (A) An inflorescence of P. heterotricha showing the front view of a zygomorphic flower characterized by two small dorsal petals and only two fertile

More information

Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells

Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells By: Patrick Rutledge 1 Dr. Jennifer Lorang 2,3, Dr. Marc Curtis 2,3, Dr. Thomas Wolpert 2,3 BioResource Research 1, Botany and

More information

CHAPTER XI PHOTOSYNTHESIS. DMA: Chapter 11 Hartmann's 1

CHAPTER XI PHOTOSYNTHESIS. DMA: Chapter 11 Hartmann's 1 CHAPTER XI PHOTOSYNTHESIS DMA: Chapter 11 Hartmann's 1 The nature of light The sun's energy travels through space to the earth as electromagnetic radiation waves at the speed of light, about 300,000 Km/s.

More information

ydci GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC

ydci GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC Table S1. DNA primers used in this study. Name ydci P1ydcIkd3 Sequence GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC Kd3ydcIp2 lacz fusion YdcIendP1 YdcItrgP2 GAC AGC

More information

Genetics 275 Notes Week 7

Genetics 275 Notes Week 7 Cytoplasmic Inheritance Genetics 275 Notes Week 7 Criteriafor recognition of cytoplasmic inheritance: 1. Reciprocal crosses give different results -mainly due to the fact that the female parent contributes

More information

GFP WxTP-GFP WxTP-GFP. stromules. DsRed WxTP-DsRed WxTP-DsRed. stromules

GFP WxTP-GFP WxTP-GFP. stromules. DsRed WxTP-DsRed WxTP-DsRed. stromules Supplemental Data. Kitajima et al. (2009). The rice -amylase glycoprotein is targeted from the Golgi apparatus through the secretory pathway to the plastids. A GFP WxTP-GFP WxTP-GFP stromules stromules

More information

Cell Respiration: Energy for Plant Metabolism

Cell Respiration: Energy for Plant Metabolism Cell Respiration: Energy for Plant Metabolism Glucose is the originating molecule for respiration Production and consumption of ATP Coupled reactions: Endergonic reactions are coupled to exergonic ones

More information

Photosynthesis: Carbon Reactions. Dr. Obaidur Rahman

Photosynthesis: Carbon Reactions. Dr. Obaidur Rahman Photosynthesis: Carbon Reactions Dr. Obaidur Rahman Topics: Part I THE CALVIN CYCLE The Calvin Cycle Has Three Stages: Carboxylation, Reduction, and Regeneration The Carboxylation of Ribulose Bisphosphate

More information

Genetic Characterization and Functional Analysis of the GID1 Gibberellin Receptors in Arabidopsis W

Genetic Characterization and Functional Analysis of the GID1 Gibberellin Receptors in Arabidopsis W The Plant Cell, Vol. 18, 3399 3414, December 2006, www.plantcell.org ª 2006 American Society of Plant Biologists Genetic Characterization and Functional Analysis of the GID1 Gibberellin Receptors in Arabidopsis

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature13082 Supplementary Table 1. Examination of nectar production in wild-type and atsweet9 flowers. No. of flowers with detectable nectar out of the total observed

More information

1. Photosynthesis is the process of making a simple organic molecule from inorganic compounds (molecules) utilizing light energy.

1. Photosynthesis is the process of making a simple organic molecule from inorganic compounds (molecules) utilizing light energy. PHOTOSYNTHESIS A. INTRODUCTION 1. Photosynthesis is the process of making a simple organic molecule from inorganic compounds (molecules) utilizing light energy. a. It takes energy input for synthesis.

More information

for pollen viability in Arabidopsis thaliana

for pollen viability in Arabidopsis thaliana The Plant Journal (2006) 48, 193 205 doi: 10.1111/j.1365-313X.2006.02863.x The protein kinase genes MAP3Ke1 and MAP3Ke2 are required for pollen viability in Arabidopsis thaliana Suraphon Chaiwongsar 1,

More information

m1 m2 m3 m4 m5 m6 m7 m8 wt m m m m m m m m8 - + wt +

m1 m2 m3 m4 m5 m6 m7 m8 wt m m m m m m m m8 - + wt + otherwise, you couldn't grow them!) You perform pairwise infections with each of your mutant bacteriophage strains and get the following results: (+) = pair of phages lysed host cells, (-) = pair of phages

More information