Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc

Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and

Supplemental Data. Perrella et al. (2013). Plant Cell /tpc

Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization

** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.

Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10534 Supplementary Fig. 1. Diagrammatic representation of the N-end rule pathway of targeted proteolysis (after Graciet and Wellmer 2010 9 ). Tertiary, secondary

Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed

Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed using the Geneious software. Accession numbers of the

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.

Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,

Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day

Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day conditions. Photo was taken when the wild type plant started to bolt. Scale bar represents 1 cm. Supplemental Figure 2. Flowering

Supplementary Figure 1. Phenotype of the HI strain.

Supplementary Figure 1. Phenotype of the HI strain. (A) Phenotype of the HI and wild type plant after flowering (~1month). Wild type plant is tall with well elongated inflorescence. All four HI plants

SUPPLEMENTARY INFORMATION

reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative

Ethylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis

Ethylene is critical to the maintenance of primary root growth and Fe homeostasis under Fe stress in Arabidopsis Guangjie Li, Weifeng Xu, Herbert J. Kronzucker, Weiming Shi * Supplementary Data Supplementary

Supplemental Table 1. Primers used for cloning and PCR amplification in this study

Supplemental Table 1. Primers used for cloning and PCR amplification in this study Target Gene Primer sequence NATA1 (At2g393) forward GGG GAC AAG TTT GTA CAA AAA AGC AGG CTT CAT GGC GCC TCC AAC CGC AGC

Supplemental Data. Gao et al. (2012). Plant Cell /tpc

Supplemental Figure 1. Plant EMP Proteins. (A) The Accession numbers of the 12 EMP members from Arabidopsis. (B) Phylogenetic analysis of EMP proteins from Arabidopsis, human and yeast using the Mac Vector

Table S1 List of primers used for genotyping and qrt-pcr.

Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!

** LCA LCN PCA

% of wild type value % of wild type value a 12 1 8 2 b 12 1 8 2 LCA LCN PCA Col- sod3-1 Supplementary Figure 1 sod3-1 influences cell proliferation. (a) Fifth leaf cell area (LCA) and leaf cell number

GFP GAL bp 3964 bp

Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive

Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc

Supplemental Data. Chen and Thelen (2010). Plant Cell 10.1105/tpc.109.071837 1 C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector

Supplemental Data. Wang et al. (2014). Plant Cell /tpc

Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and

Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao

New Phytologist Supporting Information Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bhlh transcription factor MtTT8 Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang

Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated

Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin

Supporting Online Material for

www.sciencemag.org/cgi/content/full/1121356/dc1 Supporting Online Material for Polar PIN Localization Directs Auxin Flow in Plants Justyna Wiśniewska, Jian Xu, Daniela Seifertová, Philip B. Brewer, Kamil

Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.

Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/9/452/ra106/dc1 Supplementary Materials for Stem-piped light activates phytochrome B to trigger light responses in Arabidopsis thaliana roots Hyo-Jun Lee, Jun-Ho

Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.

Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on

Supplemental Data. Hou et al. (2016). Plant Cell /tpc

Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc.16.295 A Distance to 1 st nt of start codon Distance to 1 st nt of stop codon B Normalized PARE abundance 8 14 nt 17 nt Frame1 Arabidopsis inflorescence

Supplemental Data. Yang et al. (2012). Plant Cell /tpc

Supplemental Figure 1. Mature flowers of P. heterotricha. (A) An inflorescence of P. heterotricha showing the front view of a zygomorphic flower characterized by two small dorsal petals and only two fertile

EST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7.

hest1a / SMG6 EST1 Homology Domain 100 aa 853 695 761 780 1206 hest1 / SMG5 -like? -like 109 145 214 237 497 165 239 1016 114 207 212 381 583 hest1c / SMG7 a helical 1091 Sc 57 185 267 284 699 Figure S1:

Ron et al SUPPLEMENTAL DATA

Ron et al SUPPLEMENTAL DATA Hairy root transformation using Agrobacterium rhizogenes as a tool for exploring cell type-specific gene expression and function using tomato as a model Mily Ron, Kaisa Kajala,

23-. Shoot and root development depend on ratio of IAA/CK

Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal

SUPPLEMENTARY INFORMATION

PRC2 represses dedifferentiation of mature somatic cells in Arabidopsis Momoko Ikeuchi 1 *, Akira Iwase 1 *, Bart Rymen 1, Hirofumi Harashima 1, Michitaro Shibata 1, Mariko Ohnuma 1, Christian Breuer 1,

SUPPLEMENTARY INFORMATION

doi:10.1038/nature09606 Chen Li-Qing et al. A novel class of sugar transporters. Supplementary Figure 1. Confocal imaging of FRET sensor localization in HEK293T cells. The subcellular localization of the

Development 143: doi: /dev : Supplementary information

Supplementary Materials and Methods Plant materials The mutants and transgenic plants used in the present study were as follows: E361 (from Alex Webb s laboratory); tmm-1, ptmm::tmm-gfp and flp-1 (from

Supplemental Data. Yamamoto et al. (2016). Plant Cell /tpc WT + HCO 3. slac1-4/δnc #5 + HCO 3 WT + ABA. slac1-4/δnc #5 + ABA

I (pa) I (pa) A WT + HCO 3 B 2 V (mv) 15 1 5 5 2 slac14/δnc #5 + HCO 3 4 6 WT (n = 6) 8 WT + HCO 3 (n = 7) slac14/δnc #5 (n = 6) slac14/δnc #5 + HCO 3 (n = 1) C WT + ABA D 2 V (mv) 15 1 5 5 2 slac14/δnc

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12791 Supplementary Figure 1 (1/3) WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 1 (2/3) 2 WWW.NATURE.COM/NATURE SUPPLEMENTARY

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb3267 Supplementary Figure 1 A group of genes required for formation or orientation of annular F-actin bundles and aecm ridges: RNAi phenotypes and their validation by standard mutations.

PYR1 PYL1 PYL2 PYL3 PYL4 PYL5 PYL6 PYL7 PYL8 PYL9 PYL10 PYL11/12

Supplemental Data. Gonzalez-Guzman et al. Plant Cell. (212). 1.115/tpc.112.98574 Supplemental Figure 1. Gene expression levels of the PYR/PYL/RCAR ABA receptors in the Arabidopsis transcriptome genomic

SUPPLEMENTARY INFORMATION

Supplemental Methods Isolation and mapping of SPCH An EMS-mutagenized population of tmm-1 (Col);E1728 (an enhancer trap GFP marking guard cells) was created. M2 seeds were collected from M1 s planted in

Supplemental material

Supplemental material Table 1- Segregation analysis of sgt1a sgt1b double mutant plants Parental genotype No. of lines Normal seeds Phenotype Abnormal seeds Ratio of abnormal seeds (%) WT 3 171 2 1.16

cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work

SUPPLEMENTARY INFORMATION Table S1. List of strains Strains Genotype Source B. subtilis PY79 Prototrophic derivative of B. subtilis 168 (60) RL1070 spovid::kan (12) HS176 cotz phs2 (cotz-gfp spc) (22)

EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA

EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA Item Type text; Electronic Thesis Authors Bergstrand, Lauren Janel Publisher The University of Arizona. Rights Copyright is held by the author. Digital

JMJ14-HA. Col. Col. jmj14-1. jmj14-1 JMJ14ΔFYR-HA. Methylene Blue. Methylene Blue

Fig. S1 JMJ14 JMJ14 JMJ14ΔFYR Methylene Blue Col jmj14-1 JMJ14-HA Methylene Blue Col jmj14-1 JMJ14ΔFYR-HA Fig. S1. The expression level of JMJ14 and truncated JMJ14 with FYR (FYRN + FYRC) domain deletion

Supplementary Figure 1. Nature Genetics: doi: /ng.3848

Supplementary Figure 1 Phenotypes and epigenetic properties of Fab2L flies. A- Phenotypic classification based on eye pigment levels in Fab2L male (orange bars) and female (yellow bars) flies (n>150).

GFP WxTP-GFP WxTP-GFP. stromules. DsRed WxTP-DsRed WxTP-DsRed. stromules

Supplemental Data. Kitajima et al. (2009). The rice -amylase glycoprotein is targeted from the Golgi apparatus through the secretory pathway to the plastids. A GFP WxTP-GFP WxTP-GFP stromules stromules

Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids

Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Plant growth conditions The soil was a 1:1 v/v mixture of loamy soil and organic compost. Initial soil water content was determined

Supplementary Figure 1. Real time in vivo imaging of SG secretion. (a) SGs from Drosophila third instar larvae that express Sgs3-GFP (green) and

Supplementary Figure 1. Real time in vivo imaging of SG secretion. (a) SGs from Drosophila third instar larvae that express Sgs3-GFP (green) and Lifeact-Ruby (red) were imaged in vivo to visualize secretion

Lipid transfer proteins confer resistance to trichothecenes

Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance

Supplemental Data. Lermontova et al. (2013). Plant Cell /tpc

Supplemental Figure 1. Multiple alignment of the N-terminal parts of plant KNL2 orthologs. Multiple sequence alignment was performed by the MUSCLE method and visualized by the JalView program. Highly conserved

Supplemental Data. Tameling et al. (2010). Plant Cell 10.1105/tpc.110.077461 Supplemental Table 1. Primers used in plasmid construction Primer Code Sequence eo1 5 -GCCATGGCTCATGCAAGTGTGGCTTCTC-3 eo2 5

. Supplementary Information

. Supplementary Information Supplementary Figure S1. Mature embryo sac observations. Supplementary Figure S2. STT observations. Supplementary Figure S3. Comparison of the PTB1 cdna with that of the mutant.

Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering

Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering by Valverde et. Al Published in Science 2004 Presented by Boyana Grigorova CBMG 688R Feb. 12, 2007 Circadian Rhythms: The Clock Within

Life in an unusual intracellular niche a bacterial symbiont infecting the nucleus of amoebae

Life in an unusual intracellular niche a bacterial symbiont infecting the nucleus of amoebae Frederik Schulz, Ilias Lagkouvardos, Florian Wascher, Karin Aistleitner, Rok Kostanjšek, Matthias Horn Supplementary

Nature Genetics: doi: /ng Supplementary Figure 1. The FIN and FAB genes act separately from the meristem maturation pathway.

Supplementary Figure 1 The FIN and FAB genes act separately from the meristem maturation pathway. (a) Representative inflorescence from the compound inflorescence (s, defective in the homolog of Arabidopsis

Supp- Figure 2 Confocal micrograph of N. benthamiana tissues transiently expressing 35S:YFP-PDCB1. PDCB1 was targeted to plasmodesmata (twin punctate

Supplemental Data. Simpson et al. (009). n rabidopsis GPI-anchor plasmodesmal neck protein with callosebinding activity and potential to regulate cell-to-cell trafficking. 5 0 stack Supp- Figure Confocal

Supporting Online Material

1 Stomatal Patterning and Differentiation by Synergistic Interactions of Receptor Kinases Elena D. Shpak, Jessica Messmer McAbee, Lynn Jo Pillitteri, and Keiko U. Torii Supporting Online Material Material

Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type

A B 2 3 3 2 1 1 Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type (A) and d27 (B) seedlings at the four

SUPPLEMENTAL MATERIAL

SUPPLEMENTAL MATERIAL Figure S1. Mitochondrial morphology in Fis1-null, Mff-null and Fis1/Mff-null MEF cells. (A) Western blotting of lysates from Fis1-null, Mff-null and Fis1/Mff-null cells. Lysates were

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

SUPPLEMENTARY INFORMATION

doi:1.138/nature111 cytosol Model: PILS function in cellular auxin homeostasis ER nucleus IAA degradation? sequestration? conjugation? storage? signalling? PILS IAA ER cytosol Supplemental Figure 1 Model

Arabidopsis COMPASS-Like Complexes Mediate Histone H3 Lysine-4 Trimethylation to Control Floral Transition and Plant Development

Arabidopsis COMPASS-Like Complexes Mediate Histone H3 Lysine-4 Trimethylation to Control Floral Transition and Plant Development Danhua Jiang 1,2, Nicholas C. Kong 1,2, Xiaofeng Gu 2, Zicong Li 1, Yuehui

Supplementary Figure 1. Nature Biotechnology: doi: /nbt.4067

Supplementary Figure 1 Phylogenetic tree of GAUT Protein Family and gene model, RNAi construct, and relative transcript abundance of GAUT4 in switchgrass, rice and poplar knockdown (KD) lines. Phylogenetic

Supplemental material

Supplemental material THE JOURNAL OF CELL BIOLOGY Mourier et al., http://www.jcb.org/cgi/content/full/jcb.201411100/dc1 Figure S1. Size and mitochondrial content in Mfn1 and Mfn2 knockout hearts. (A) Body

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved

concentration ( mol l -1 )

concentration ( mol l -1 ) 8 10 0 20 40 60 80 100 120 140 160 180 methane sulfide ammonium oxygen sulfate (/10) b depth (m) 12 14 Supplementary Figure 1. Water column parameters from August 2011. Chemical

SUPPLEMENTARY INFORMATION

Supplementary Figure 1 Sns and Duf co-localise in embryonic nephrocytes a-c, Wild-type stage 11 (a),14 (b) and 16 (c) embryos stained with anti-duf (green) and anti-sns (red). Higher magnification images

Supplementary Information for. Single-cell dynamics of the chromosome replication and cell division cycles in mycobacteria

Supplementary Information for Single-cell dynamics of the chromosome replication and cell division cycles in mycobacteria Isabella Santi 1 *, Neeraj Dhar 1, Djenet Bousbaine 1, Yuichi Wakamoto, John D.

Maria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner

ABA represses the transcription of chloroplast genes Maria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner Supplementary data Supplementary tables Table

Genetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity

Genetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity Shih-Heng Su, Maria Cristina Suarez-Rodriguez, Patrick Krysan

Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles

Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN

Postdoc Fellowships for non-eu researchers. Final Report

Postdoc Fellowships for non-eu researchers Final Report Name Andrés Ritter Selection 2011 Host institution Gent University Supervisor Professor Dirk Inzé and Professor Alain Goossens Period covered by

DIA-Umpire: comprehensive computational framework for data independent acquisition proteomics

DIA-Umpire: comprehensive computational framework for data independent acquisition proteomics Chih-Chiang Tsou 1,2, Dmitry Avtonomov 2, Brett Larsen 3, Monika Tucholska 3, Hyungwon Choi 4 Anne-Claude Gingras

SUPPLEMENTARY INFORMATION

doi:10.1038/nature11589 Supplementary Figure 1 Ciona intestinalis and Petromyzon marinus neural crest expression domain comparison. Cartoon shows dorsal views of Ciona mid gastrula (left) and Petromyzon

Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach

Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach ABSTRACT SUBMITTED TO JAMIA MILLIA ISLAMIA NEW DELHI IN PARTIAL FULFILMENT OF

Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA

Himber et al. Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA silencing SUPPLEMENTAL MATERIAL Supplemental material 1. Short-range movement of GFP silencing affects a nearly

Supporting Information

Supporting Information Cao et al. 10.1073/pnas.1306220110 Gram - bacteria Hemolymph Cytoplasm PGRP-LC TAK1 signalosome Imd dfadd Dredd Dnr1 Ikk signalosome P Relish Nucleus AMP and effector genes Fig.

Figure S1. Programmed cell death in the AB lineage occurs in temporally distinct

SUPPLEMENTAL FIGURE LEGENDS Figure S1. Programmed cell death in the AB lineage occurs in temporally distinct waves. (A) A representative sub-lineage (ABala) of the C. elegans lineage tree (adapted from

Genomics and bioinformatics summary. Finding genes -- computer searches

Genomics and bioinformatics summary 1. Gene finding: computer searches, cdnas, ESTs, 2. Microarrays 3. Use BLAST to find homologous sequences 4. Multiple sequence alignments (MSAs) 5. Trees quantify sequence

Model plants and their Role in genetic manipulation. Mitesh Shrestha

Model plants and their Role in genetic manipulation Mitesh Shrestha Definition of Model Organism Specific species or organism Extensively studied in research laboratories Advance our understanding of Cellular

Biological Roles of Cytokinins

Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators

TCP Transcription Factors Link the Regulation of Genes Encoding Mitochondrial Proteins with the Circadian Clock in Arabidopsis thaliana W OA

This article is a Plant Cell Advance Online Publication. The date of its first appearance online is the official date of publication. The article has been edited and the authors have corrected proofs,

Supporting Information

Supporting Information Mullins et al. 10.1073/pnas.0906781106 SI Text Detection of Calcium Binding by 45 Ca 2 Overlay. The 45 CaCl 2 (1 mci, 37 MBq) was obtained from NEN. The general method of 45 Ca 2

Measuring TF-DNA interactions

Measuring TF-DNA interactions How is Biological Complexity Achieved? Mediated by Transcription Factors (TFs) 2 Regulation of Gene Expression by Transcription Factors TF trans-acting factors TF TF TF TF

School of Life Sciences, Tsinghua University, Beijing , China b. College of Animal Sciences, Zhejiang University, Hangzhou , China

The Plant Cell, Vol. 23: 1000 1013, March 2011, www.plantcell.org ã 2011 American Society of Plant Biologists The Jasmonate-ZIM Domain Proteins Interact with the R2R3-MYB Transcription Factors MYB21 and

By Jonathan I. Watkinson. Virginia Polytechnic Institute and State University. Doctor of Philosophy Horticulture

Characterization of two genes, trehalose-6-phosphate synthase/phosphatase and nucleotide binding protein, shown to be differentially regulated in roots of Cypripedium parviflorum var. pubescens grown with

GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL

GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,

Heterozygous BMN lines

Optical density at 80 hours 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 a YPD b YPD + 1µM nystatin c YPD + 2µM nystatin d YPD + 4µM nystatin 1 3 5 6 9 13 16 20 21 22 23 25 28 29 30

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb2647 Figure S1 Other Rab GTPases do not co-localize with the ER. a, Cos-7 cells cotransfected with an ER luminal marker (either KDEL-venus or mch-kdel) and mch-tagged human Rab5 (mch-rab5,

BLAST. Varieties of BLAST

BLAST Basic Local Alignment Search Tool (1990) Altschul, Gish, Miller, Myers, & Lipman Uses short-cuts or heuristics to improve search speed Like speed-reading, does not examine every nucleotide of database

Supplementary Information

Supplementary Information Rice APC/C TE controls tillering through mediating the degradation of MONOCULM 1 Qibing Lin 1*, Dan Wang 1*, Hui Dong 2*, Suhai Gu 1, Zhijun Cheng 1, Jie Gong 2, Ruizhen Qin 1,

Supporting online material

Supporting online material Materials and Methods Target proteins All predicted ORFs in the E. coli genome (1) were downloaded from the Colibri data base (2) (http://genolist.pasteur.fr/colibri/). 737 proteins

HRS1 Acts as a Negative Regulator of Abscisic Acid Signaling to Promote Timely Germination of Arabidopsis Seeds

HRS1 Acts as a Negative Regulator of Abscisic Acid Signaling to Promote Timely Germination of Arabidopsis Seeds Chongming Wu 1,2., Juanjuan Feng 1,2., Ran Wang 1,2, Hong Liu 1,2, Huixia Yang 1,2, Pedro

SUPPLEMENTARY INFORMATION

med!1,2 Wild-type (N2) end!3 elt!2 5 1 15 Time (minutes) 5 1 15 Time (minutes) med!1,2 end!3 5 1 15 Time (minutes) elt!2 5 1 15 Time (minutes) Supplementary Figure 1: Number of med-1,2, end-3, end-1 and

Supplementary Figure 3

Supplementary Figure 3 7.0 Col Kas-1 Line FTH1A 8.4 F3PII3 8.9 F26H11 ATQ1 T9I22 PLS8 F26B6-B 9.6 F27L4 9.81 F27D4 9.92 9.96 10.12 10.14 10.2 11.1 0.5 Mb T1D16 Col % RGR 83.3 101 227 93.5 75.9 132 90 375

Supplementary Methods

Supplementary Methods Microarray analysis Grains of 7 DAP of the wild-type and gif1 were harvested for RNA preparation. Microarray analysis was performed with the Affymetrix (Santa Clara, CA) GeneChip

Supplemental Figures. Supplemental Data. Sugliani et al. Plant Cell (2016) /tpc Clades RSH1. Rsh1[HS] RSH2 RSH3. Rsh4[HS] HYD TGS ACT

Supplemental Figures Clades RSH1 TP - HYD TGS ACT Rsh1[HS] RSH2 TP HYD SYN TGS Rsh2[HS] RSH3 TP HYD SYN TGS CRSH TP - SYN EFh Rsh4[HS] Supplemental Figure 1. Arabidopsis RSH domain structure. Schematic

Regulation of the anthocyanin biosynthetic pathway by the TTG1/bHLH/Myb transcriptional complex in Arabidopsis seedlings

The Plant Journal (2008) 53, 814 827 doi: 10.1111/j.1365-313X.2007.03373.x Regulation of the anthocyanin biosynthetic pathway by the TTG1/bHLH/Myb transcriptional complex in Arabidopsis seedlings Antonio

Supplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1

Supplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1 F/F ;mir-17~92 F/F (Pkd1-miR-17~92KO) mice. (A) Q-PCR

Evolution, Expression Differentiation and Interaction Specificity of Heterotrimeric G-Protein Subunit Gene Family in the Mesohexaploid Brassica rapa

Evolution, Expression Differentiation and Interaction Specificity of Heterotrimeric G-Protein Subunit Gene Family in the Mesohexaploid Brassica rapa Gulab C. Arya, Roshan Kumar, Naveen C. Bisht* National

Supplementary Materials for

advances.sciencemag.org/cgi/content/full/4/5/eaar2740/dc1 Supplementary Materials for The fission yeast Stn1-Ten1 complex limits telomerase activity via its SUMO-interacting motif and promotes telomeres

Comparative Protein Modeling of Superoxide Dismutase Isoforms in Maize.

Comparative Protein Modeling of Superoxide Dismutase Isoforms in Maize. Kaliyugam Shiriga 1, 2, Rinku Sharma 1, Krishan Kumar 2, Firoz Hossain 1 and NepoleanThirunavukkarasu 1* Division of Genetics, Indian

Three Myosins Contribute Uniquely to the Assembly and Constriction of the Fission Yeast Cytokinetic Contractile Ring

Current Biology Supplemental Information Three Myosins Contribute Uniquely to the Assembly and Constriction of the Fission Yeast Cytokinetic Contractile Ring Caroline Laplante, Julien Berro, Erdem Karatekin,