Supplementary Methods
|
|
|
- Ashlie Walters
- 5 years ago
- Views:
Transcription
1 Supplementary Methods Microarray analysis Grains of 7 DAP of the wild-type and gif1 were harvested for RNA preparation. Microarray analysis was performed with the Affymetrix (Santa Clara, CA) GeneChip Rice Genome Array representing 51,279 transcripts with three biological replicates. Raw data were analyzed with Affymetrix GeneChip Operating Software (GCOS, Version 1.4) using Affymetrix default analysis settings and global scaling as normalization method. The trimmed mean target intensity of each array was arbitrarily set to 500. Data were compared between sample chips from the same biological replicate and the effective expressed probe sets were defined on at least once P (Present) of scaling detection on gif1 or wild-type sample. Reproducibly differentially expressed probe sets were selected from the total normalized data, based on a Signal Log 2 Ratio (SLR) of at least 1.0, a gene expression change call of I (increase), and P-value <0.002; or a SLR of at least -1.0, a gene expression change call of D (decrease), and P-value >0.998 for all three biological replicates of either wide-type and gif1 samples using a stringent selection criteria (Zhang et al. 2007). Probe sets that meet these rigorous selection criteria were further analyzed. The rice data file (rice[1].all.mapman.txt at with blastx best matches tabular file in MapMan format was downloaded from GeneBins (Goffard and Weiller 2007) ( MapMan version (Goffard and Weiller 2006) was used for functional classification of the regulated genes using the average SLRs for three biological replicates. References for the Supplementary Methods Zhang, Z., Li, Q., Li, Z., Staswick, P.E., Wang, M., Zhu, Y. & He, Z. Dual regulation role of GH3.5 in salicylic acid and auxin signaling during Arabidopsis-Pseudomonas syringae interaction. Plant Physiol. 145, (2007). Goffard, N. & Weiller, G. GeneBins: a database for classifying gene expression data, with application to plant genome arrays. BMC Bioinformatics 8, 87 (2007). Goffard, N. & Weiller, G. Extending MapMan: application to legume genome arrays. Bioinformatics 22, (2006).
2 Supplementary Figure 1. Grain development of the wild-type and gif1. Rice plants were grown under the paddy field conditions, grains were observed and measured during the grain filling stage. a, b, Grains of the wild-type (a) and gif1 (b) at 5 DAP. c, d, Grains of the wild-type (c) and gif1 (d) at 12 DAP. The fertilized gif1 grains were discolored probably due to slower filling. e, f, Grains at 25 DAP. The wild-type grains (e) were nearly matured with complete filling, whereas the gif1 grains (f) were incompletely filled.
3 Supplementary Figure 2. Amylase and amylospectin contents of mature grains of the wild-type and gif1. Values are means ±SE (n = 3).
4 Supplementary Figure 3. Map-based cloning of GIF1. The GIF1 locus was mapped using the F2 population derived from the cross of gif1 and Zhenshan 97 (indica). a, The GIF1 locus was initially mapped on the long arm of chromosome 4 between the SSR markers RM5749 and RM5635. The GIF1 locus was narrowed down to a 32-kb interval between the markers CAPS-4 and CAPS-8, and co-segregated with the marker CAPS-7. Numbers represent recombination events. The GIF1 candidate gene contains one nucleotide deletion at the fourth exon that generates a premature stop codon TAA. b, The GIF1 transcript levels detected by RT-PCR in the wild-type and gif1 grains. Prolonged PCR could detect the transcript in gif1. Ubi-1 was used as a control. The analysis was repeated three times with similar results.
5 Supplementary Figure 4. Sequence alignments of GIF1 with homologous proteins from other plants. The BLAST search program ( was used to look for invertase sequences homologous to GIF1. The highest homologous invertase sequences were aligned with GIF1 using a MEGA version 3.1 software. The aligned invertases include the functionally known Mn1 (maize) and LIN5 (tomato), and functionally unknown invertases AJ (barley), X69321 (carrot), ATCWINV2 (Arabidopsis) and AF (wheat). The β-fructosidase motif, the Cys catalysis site and the conserved glycosylation motif are indicated.
6 Supplementary Figure 5. Complementation test. a, Grain weight of five T1 lines compared with the gif1 mutant and the wild-type. b, Grain weight of twenty-three T2 progenies of H5 complement line. Note that some T2 progenies were segregated with the mutant phenotype. c, The GIF1 transcript levels detected by RT-PCR revealing the transgene segregation in the T2 progenies of line H5 (b) with grain weight indicated. Ubi-1 was used as a control.
7 Supplementary Figure 6. Cell wall invertase activity. Cell wall invertase activity was measured in insoluble extraction of developing grains at 7 DAP. a, Cell wall invertase activity in the wild-type and gif1. b, Cell wall invertase activity in leaves of the transgenic control with empty vector and four GIF1 overexpression transgenic lines with the 35S promoter (GIF1-OE).
8 Supplementary Figure 7. Grains and GIF1 expression of GIF1-OE plants. a, Matured grains of the wild-type and two representative GIF1-OE lines, indicating the severely shrunken GIF1-OE grains that hardly germinate. b, The GIF1 transcript levels in leaves detected by RT-PCR showing GIF1 overexpression in GIF1-OE lines. The analysis was repeated twice with similar results. Ubi-1, the loading control.
9 Supplementary Figure 8. Expression of GIF1 in the root, leaf, uppermost internode and flowering panicle. Ubi-1 was used as a RT-PCR control. The analysis was repeated twice with similar results.
10 Supplementary Figure 9. Grain weight of different genotypes in the introgression backcross population (BC4F2). GIF1(0R)/GIF1(0R), homozygous plants with the wild rice (O. rufipogon) GIF1 allele; GIF1/GIF1, homozygous plants with the cultivated rice allele; GIF1/GIF1(0R), heterozygous plants. For each genotype, 1000-brown grain weight of more than 6 individuals was statistically analyzed. Asterisk indicates significance at P<0.05.
11 Supplementary Figure 10. Fine mapping of the wild rice locus decreasing grain weight. Phenotyping and genotyping of fixed recombinant plants in the mapping population (BC4F3) narrowed the wild rice locus corresponding to decreased grain weight to the region flanked by the markers SSLP-1 and CAPS-8 and centered by GIF1 (OR) brown grain weight of recombinants, SW19 and control Teqing was shown. Regions for wild rice, Teqing and heterozygotes were indicated in balck, empty and gray, respectively.
12 Supplementary Figure 11. Grain weight of different subspecies introgression plants. Grain weight of the introgression lines Katy (japonica), Suyunnuo (SYN, japonica), Chenglong-shuijingmi (CLSJ, indica) and the recurrent parent control (Huajingxian74, indica).
13 Supplementary Figure 12. Grain sizes and GIF1 expression of transgenic rice overexpressing GIF1 under its native promoter. a-c, Grain thickness, width and length in the transgenic lines G-2 and G-8, the vector and wild-type controls. d, The GIF1 transcript levels detected by RT-PCR in grains of the controls and lines G-2 and G-8, showing that GIF1 expression was increased in the transgenic lines. Ubi-1, the loading control. The analysis was repeated twice with similar results.
14 Supplementary Table 1. Yield components of gif1 and wild-type Zhonghua11. ZH11 gif1 gif1/zh11 P-Value Panicles / plant (2.30) 9.96 (2.73) <P<0.1 Seeds / panicle (33.71) (30.70) 1.02 P>0.1 Seeds / plant (372.12) (239.05) 0.95 P>0.1 unfilled seeds / panicle (10.83) (15.68) 0.97 P>0.1 Seed weight / panicle (g) 2.90 (0.73) 2.45 (0.63) 0.84 P<0.01 Seed weight / plant (g) (8.60) (4.44) 0.78 P< grain weight (g) (0.01) (0.01) 0.82 P< kernel weight (g) (0.1) (0.15) 0.76 P<0.01 Values are means with SE in parentheses
15 Supplementary Table 2 (Microsoft Excel file). Summary of 341 reproducibly differentially regulated genes of the gif1 mutant versus wild-type Zhonghua11 at 7 DAF.
16 Supplementary Table 3 (Microsoft Excel file). Summary of 44 carbohydrate metabolism-related genes reproducibly differentially regulated in the gif1 mutant versus wild-type Zhonghua11 at 7 DAF.
17 Supplementary Table 4. Rice germplasm used in domestication analysis. Rice germplasm Name/Accession no. Origin O. sativa spp. japonica Nipponbare Japan O. sativa spp. japonica Shiokari Japan O. sativa spp. japonica Murasaki-daikoku Japan O. sativa spp. japonica Kimazi Japan O. sativa spp. japonica Dongjing Japan O. sativa spp. japonica Maratelli France O. sativa spp. japonica NW 2 Yunnan, China O. sativa spp. japonica NW 1 Yunnan, China O. sativa spp. japonica Zhonghua11 Beijing, China O. sativa spp. japonica Zhejing 27 Zhejiang, China O. sativa spp. japonica Hangtian 18 Zhejiang, China O. sativa spp. japonica Zheyou10 Zhejiang, China O. sativa spp. japonica Zhenuo205 Zhejiang, China O. sativa spp. japonica Taichung 65 Taiwan, China O. sativa spp. japonica Taipei309 Taiwan, China O. sativa spp. japonica Zhenuo 4 Jiansu, China O. sativa spp. japonica Xiushsui 63 Jiaxing, China O. sativa spp. japonica Xiushui110 Jiaxing, China O. sativa spp. japonica Zhejing 22 Zhejiang, China O. sativa spp. japonica Zhenuo 5 Jiansu, China O. sativa spp. japonica R5100 Ningxia, China O. sativa spp. japonica NW 3 Yunnan, China O. sativa spp. indica Pi 9 American O. sativa spp. indica pb17 Zhejiang, China O. sativa spp. indica pb24 Hunan, China O. sativa spp. indica pb32 Hubei, China O. sativa spp. indica pb33 Zhejiang, China O. sativa spp. indica pb77 Hainan, China O. sativa spp. indica pb103 Human, Chian O. sativa spp. indica pb114 Beijing, China O. sativa spp. indica Zhenshan 97 Zhejiang, China O. sativa spp. indica Longtepu Fujian, China O. sativa spp. indica R9719 Ningxia, China O. sativa spp. indica pb15 Sichuan, Chian O. sativa spp. indica Gumei4 Sichuan, China O. sativa spp. indica 9311 Jiangsu, China O. rufipogon Taiwan, China O. rufipogon Guangxi, China O. rufipogon Hainan 1 Hainan, China O. rufipogon Dongxiang 1 Shansi, China O. rufipogon Bangladeshi
18 O. rufipogon India O. rufipogon Burma O. rufipogon Indonesia O. rufipogon Cambodia
19 Supplementary Table 5 (Microsoft Excel file). Analysis of recombinant plants in fine-mapping of the IL locus.
20 Supplementary Table 6. Primers used in this study. Primer name Primer sequence Enzyme Purpose Caps-1-F CGAACCCGACCAAACATAAATC EcoR1 Mapping Caps-1-R GACTAACTAATACACGCATACAC Mapping Caps-4-F CGCAACACGCAAGCACAAGTATCC Xba1 Mapping Caps-4-R CACGCCCTCATTTCGCACAAGTCT Mapping Caps-7-F GCGCAATTTCTTTCACGGCTTAT Xba1 Mapping Caps-7-R GGCTGGGCGCGACGAGGTT Mapping Caps-8-F CATCGCTTATATTGGTGCTGTGCT SpeI Mapping Caps-8-R GAATTCCCGTTGTCCTCTTGTAGTC Mapping SSR-1-F GAGAGGGGAATCAACATACAC Mapping SSR-1-R GACATACCTAGCTCTGAACGAATT Mapping GFP-CIN-F ATCGATACTTCTCGCTCTCACTTCT Clone GFP-CIN-R GGTACCGTTTTGGCTCCATTCATCAT Clone GUS-CIN-F TATAAGCTTGATCGGCCATACTCC Clone GUS-CIN-R TAGGATCCCTTTGCTCTCACACTTG Clone Wax-F GCCAAGCTTATTACAGCCGTGG Clone Wax-R CAATCGATGGTGGTTGTCTAGCTGTTG Clone Real-GIF1-F CATCGCGCAACCCGAACATG Real-time PCR Real-GIF1-R TGTCGATCAGGCTCCTCAGAG Real-time PCR GIF1-RT-F CCCGCCGGCGACGAGCACCACAT RT-PCR GIF1-RT-R CCGCCGGCCTGAACACCCTGAAGA RT-PCR Dom-P-F CATCGTTTGGCTTATTCGTG Sequencing Dom-P-R TACTGTGTGGACGACCTAAC Sequencing Dom-2-F AGCGCCGATGTACTACAAG Sequencing Dom-2-R CAGGACGTGCGGTTAATTAC Sequencing Dom-5-F TTGTGCAGATCGACAGGTC Sequencing Dom-5-R AAGTCGTTATCCAGAAAGA Sequencing
Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.
Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods
. Supplementary Information
. Supplementary Information Supplementary Figure S1. Mature embryo sac observations. Supplementary Figure S2. STT observations. Supplementary Figure S3. Comparison of the PTB1 cdna with that of the mutant.
Biological Roles of Cytokinins
Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators
Table S1 List of primers used for genotyping and qrt-pcr.
Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!
Duplication of an upstream silencer of FZP increases grain yield in rice
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41477-017-0042-4 In the format provided by the authors and unedited. Duplication of an upstream silencer of FZP increases grain yield in rice
Title. Authors. Characterization of a major QTL for manganese accumulation in rice grain
Title Characterization of a major QTL for manganese accumulation in rice grain Authors Chaolei Liu, Guang Chen, Yuanyuan Li, Youlin Peng, Anpeng Zhang, Kai Hong, Hongzhen Jiang, Banpu Ruan, Bin Zhang,
Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.
Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on
Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication
SUPPORTING ONLINE MATERIALS Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication Bin Cong, Luz Barrero, & Steven Tanksley 1 SUPPORTING
Principles of QTL Mapping. M.Imtiaz
Principles of QTL Mapping M.Imtiaz Introduction Definitions of terminology Reasons for QTL mapping Principles of QTL mapping Requirements For QTL Mapping Demonstration with experimental data Merit of QTL
Exam 1 PBG430/
1 Exam 1 PBG430/530 2014 1. You read that the genome size of maize is 2,300 Mb and that in this species 2n = 20. This means that there are 2,300 Mb of DNA in a cell that is a. n (e.g. gamete) b. 2n (e.g.
Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed
Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed using the Geneious software. Accession numbers of the
Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc
Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and
Classical Selection, Balancing Selection, and Neutral Mutations
Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection Perspective of the Fate of Mutations All mutations are EITHER beneficial or deleterious o Beneficial mutations are selected
Chapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype.
Chapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype. please read pages 38-47; 49-55;57-63. Slide 1 of Chapter 2 1 Extension sot Mendelian Behavior of Genes Single gene inheritance
Supplementary Table 1. Primers used in this study.
Supplementary Tale 1. Primers used in this study. Name Primer sequence (5'-3') Primers of PCR-ased molecular markers developed in this study M1 F M1 R M2 F M2 R M3 F M3 R M4 F M4 R M5 F M5 R M6 F M6 R
Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.
Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny
Genetic diversity and population structure in rice. S. Kresovich 1,2 and T. Tai 3,5. Plant Breeding Dept, Cornell University, Ithaca, NY
Genetic diversity and population structure in rice S. McCouch 1, A. Garris 1,2, J. Edwards 1, H. Lu 1,3 M Redus 4, J. Coburn 1, N. Rutger 4, S. Kresovich 1,2 and T. Tai 3,5 1 Plant Breeding Dept, Cornell
Regulation of Phosphate Homeostasis by microrna in Plants
Regulation of Phosphate Homeostasis by microrna in Plants Tzyy-Jen Chiou 1 *, Kyaw Aung 1,2, Shu-I Lin 1,3, Chia-Chune Wu 1, Su-Fen Chiang 1, and Chun-Lin Su 1 Abstract Upon phosphate (Pi) starvation,
Increasing Processing Tomato Fruit Soluble Solids
Increasing Processing Tomato Fruit Soluble Solids Diane M Beckles Department of Plant Sciences dmbeckles@ucdavis.edu Processing Tomato Conference @ UC Davis December 13 th 2018 Soil Micronutrients Cultivar
EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA
EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA Item Type text; Electronic Thesis Authors Bergstrand, Lauren Janel Publisher The University of Arizona. Rights Copyright is held by the author. Digital
Life Cycles, Meiosis and Genetic Variability24/02/2015 2:26 PM
Life Cycles, Meiosis and Genetic Variability iclicker: 1. A chromosome just before mitosis contains two double stranded DNA molecules. 2. This replicated chromosome contains DNA from only one of your parents
Research Notes: G. B. Pant University of Agriculture and Technology
Volume 1 Article 6 4-1-1974 Research Notes: G. B. Pant University of Agriculture and Technology G. B. Pant University of Agriculture and Technology G. B. Pant University of Agriculture and Technology G.
Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc
Supplemental Data. Chen and Thelen (2010). Plant Cell 10.1105/tpc.109.071837 1 C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector
The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype.
Series 2: Cross Diagrams - Complementation There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice Supplementary Figure 2.
Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice. Percentage of marginal zone B cells in the spleen of wild-type mice (+/+), mice homozygous for cpm or pri
Awide range of natural variation for flowering time
Copyright Ó 2006 by the Genetics Society of America DOI: 10.1534/genetics.105.050500 Substitution Mapping of dth1.1, a Flowering-Time Quantitative Trait Locus (QTL) Associated With Transgressive Variation
Managing segregating populations
Managing segregating populations Aim of the module At the end of the module, we should be able to: Apply the general principles of managing segregating populations generated from parental crossing; Describe
Nature Genetics: doi: /ng Supplementary Figure 1. The FIN and FAB genes act separately from the meristem maturation pathway.
Supplementary Figure 1 The FIN and FAB genes act separately from the meristem maturation pathway. (a) Representative inflorescence from the compound inflorescence (s, defective in the homolog of Arabidopsis
Eiji Yamamoto 1,2, Hiroyoshi Iwata 3, Takanari Tanabata 4, Ritsuko Mizobuchi 1, Jun-ichi Yonemaru 1,ToshioYamamoto 1* and Masahiro Yano 5,6
Yamamoto et al. BMC Genetics 2014, 15:50 METHODOLOGY ARTICLE Open Access Effect of advanced intercrossing on genome structure and on the power to detect linked quantitative trait loci in a multi-parent
Genetic and physiological approach to elucidation of Cd absorption mechanism by rice plants
Genetic and physiological approach to elucidation of Cd absorption mechanism by rice plants Satoru Ishikawa National Institute for Agro-Environmental Sciences, 3-1-3, Kannondai, Tsukuba, Ibaraki, 305-8604,
Jie Chen 1), De-Run Huang 1), Lei Wang 1), Guang-Jie Liu 1,2) and Jie-Yun Zhuang* 1) Introduction
Breeding Science 60: 153 159 (2010) Identification of quantitative trait loci for resistance to whitebacked planthopper, Sogatella furcifera, from an interspecific cross Oryza sativa O. rufipogon Jie Chen
CSS 350 Midterm #2, 4/2/01
6. In corn three unlinked dominant genes are necessary for aleurone color. The genotypes B-D-B- are colored. If any of these loci is homozygous recessive the aleurone will be colorless. What is the expected
Segregation distortion in F 2 and doubled haploid populations of temperate japonica rice
c Indian Academy of Sciences RESEARCH NOTE Segregation distortion in F 2 and doubled haploid populations of temperate japonica rice MASUMI YAMAGISHI 1,2,6, YOSHINOBU TAKEUCHI 3,7, ISAO TANAKA 4, IZUMI
Quantitative trait loci mapping of the stigma exertion rate and spikelet number per panicle in rice (Oryza sativa L.)
Quantitative trait loci mapping of the stigma exertion rate and spikelet number per panicle in rice (Oryza sativa L.) M.H. Rahman, P. Yu, Y.X. Zhang, L.P. Sun, W.X. Wu, X.H. Shen, X.D. Zhan, D.B. Chen,
Natural variation at the DEP1 locus enhances grain yield in rice
LETTERS Natural variation at the DEP1 locus enhances grain yield in rice Xianzhong Huang 1,6, Qian Qian 2,6, Zhengbin Liu 1, Hongying Sun 1, Shuyuan He 1,DaLuo 3, Guangmin Xia 4, Chengcai Chu 5, Jiayang
MOE Key Lab of Tropic Biological Resources, College of Agriculture Science, Hainan University, Haikou, China
Genome-wide multilocus analysis of intraspecific differentiation in Oryza rufipogon Griff. from China and the influence of introgression from O. sativa L. Y.B. Dong 1, F. Li 1, X.W. Pei 1, F. Wang 2, Q.H.
Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2017-2018 GENETICS BIO-5009A Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section
23-. Shoot and root development depend on ratio of IAA/CK
Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal
Supplemental Data. Wang et al. (2014). Plant Cell /tpc
Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and
Genetic controls of apple fruit-specific auxin metabolism. PI: Yanmin Zhu Co-PI(2): James Mattheis
FINAL PROJECT REPORT Project Title: Genetic controls of apple fruit-specific auxin metabolism PI: Yanmin Zhu Co-PI(2): James Mattheis Organization: TFRL-ARS-USDA Organization: TFRL-ARS-USDA Telephone:
Genetics 275 Notes Week 7
Cytoplasmic Inheritance Genetics 275 Notes Week 7 Criteriafor recognition of cytoplasmic inheritance: 1. Reciprocal crosses give different results -mainly due to the fact that the female parent contributes
Lipid transfer proteins confer resistance to trichothecenes
Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance
GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL
GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,
Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids
Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Plant growth conditions The soil was a 1:1 v/v mixture of loamy soil and organic compost. Initial soil water content was determined
You are encouraged to answer/comment on other people s questions. Domestication conversion of plants or animals to domestic uses
The final exam: Tuesday, May 8 at 4:05-6:05pm in Ruttan Hall B35. 75 multiple choice questions for 150 points 50 questions from Lecture 20 27 25 questions directly from the first two exams. Key for exam
Development 143: doi: /dev : Supplementary information
Supplementary Materials and Methods Plant materials The mutants and transgenic plants used in the present study were as follows: E361 (from Alex Webb s laboratory); tmm-1, ptmm::tmm-gfp and flp-1 (from
When one gene is wild type and the other mutant:
Series 2: Cross Diagrams Linkage Analysis There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:
4/26/18. Domesticated plants vs. their wild relatives. Lettuce leaf size/shape, fewer secondary compounds
The final exam: Tuesday, May 8 at 4:05-6:05pm in Ruttan Hall B35. 75 multiple choice questions for 150 points 50 questions from Lecture 20 27 25 questions directly from the first two exams. Key for exam
CHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection
CHAPTER 23 THE EVOLUTIONS OF POPULATIONS Section C: Genetic Variation, the Substrate for Natural Selection 1. Genetic variation occurs within and between populations 2. Mutation and sexual recombination
Maternal control of seed development mediated by the flavonoid biosynthesis pathway
P- END1 Maternal control of seed development mediated by the flavonoid biosynthesis pathway Maha Aljabri, James Doughty, and Rod Scott University of Bath, UK Many plants exhibit post-zygotic barriers to
SUPPLEMENTARY INFORMATION
reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative
Name: Period: EOC Review Part F Outline
Name: Period: EOC Review Part F Outline Mitosis and Meiosis SC.912.L.16.17 Compare and contrast mitosis and meiosis and relate to the processes of sexual and asexual reproduction and their consequences
RFLP facilitated analysis of tiller and leaf angles in rice (Oryza sativa L.)
Euphytica 109: 79 84, 1999. 1999 Kluwer Academic Publishers. Printed in the Netherlands. 79 RFLP facilitated analysis of tiller and leaf angles in rice (Oryza sativa L.) Zhikang Li 1,2,3, Andrew H. Paterson
TASK 6.3 Modelling and data analysis support
Wheat and barley Legacy for Breeding Improvement TASK 6.3 Modelling and data analysis support FP7 European Project Task 6.3: How can statistical models contribute to pre-breeding? Daniela Bustos-Korts
SUPPLEMENTARY INFORMATION
Figure S1. Haploid plant produced by centromere-mediated genome elimination Chromosomes containing altered CENH3 in their centromeres (green dots) are eliminated after fertilization in a cross to wild
Small RNA in rice genome
Vol. 45 No. 5 SCIENCE IN CHINA (Series C) October 2002 Small RNA in rice genome WANG Kai ( 1, ZHU Xiaopeng ( 2, ZHONG Lan ( 1,3 & CHEN Runsheng ( 1,2 1. Beijing Genomics Institute/Center of Genomics and
ACTA AGRONOMICA SINICA SSR. Classification for Some Sterile Lines and Their Restorers of Hybrid Rice with SSR Markers
32 2 2006 2 169 175 ACTA AGRONOMICA SINICA Vol132, No12 pp1 169-175 Feb1, 2006 SSR 1 1,2, # 1 1 1 1, 3 2 2 Ξ ( 1, 330045 ; 2,,100094) : ( Oryza sativa L. ) 12 36 SSR(simple sequence repeats), 5 7 54 300,
Running head: OsNPR1 Inhibits Rice Growth via Auxin Signaling
Plant Physiology Preview. Published on July 4, 2016, as DOI:10.1104/pp.16.00129 1 Running head: OsNPR1 Inhibits Rice Growth via Auxin Signaling 2 3 4 5 6 Corresponding author: Zuhua He, Institute of Plant
Germplasm. Introduction to Plant Breeding. Germplasm 2/12/2013. Master Gardener Training. Start with a seed
Introduction to Plant Breeding Master Gardener Training Start with a seed Germplasm Germplasm The greatest service which can be rendered to any country is to add a useful plant to its culture -Thomas Jefferson
Introduction to Plant Breeding. Master Gardener Training
Introduction to Plant Breeding Master Gardener Training Start with a seed Germplasm Germplasm The greatest service which can be rendered to any country is to add a useful plant to its culture -Thomas Jefferson
Solutions to Problem Set 4
Question 1 Solutions to 7.014 Problem Set 4 Because you have not read much scientific literature, you decide to study the genetics of garden peas. You have two pure breeding pea strains. One that is tall
Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type
A B 2 3 3 2 1 1 Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type (A) and d27 (B) seedlings at the four
Texas Biology Standards Review. Houghton Mifflin Harcourt Publishing Company 26 A T
2.B.6. 1 Which of the following statements best describes the structure of DN? wo strands of proteins are held together by sugar molecules, nitrogen bases, and phosphate groups. B wo strands composed of
Full file at CHAPTER 2 Genetics
CHAPTER 2 Genetics MULTIPLE CHOICE 1. Chromosomes are a. small linear bodies. b. contained in cells. c. replicated during cell division. 2. A cross between true-breeding plants bearing yellow seeds produces
Cell Division and Genetics
Name Date Cell Division and Genetics 1. Black fur is dominant over brown fur in a particular population of guinea pig. The genetic information that gives a guinea pig brown fur is described as having A.
Biology I Level - 2nd Semester Final Review
Biology I Level - 2nd Semester Final Review The 2 nd Semester Final encompasses all material that was discussed during second semester. It s important that you review ALL notes and worksheets from the
Development and Identification of Introgression Lines from Cross of Oryza sativa and Oryza minuta
Rice Science, 2013, 20(2): 95 102 Copyright 2013, China National Rice Research Institute Published by Elsevier BV. All rights reserved DOI: 10.1016/S1672-6308(13)60111-0 Development and Identification
Quiz Section 4 Molecular analysis of inheritance: An amphibian puzzle
Genome 371, Autumn 2018 Quiz Section 4 Molecular analysis of inheritance: An amphibian puzzle Goals: To illustrate how molecular tools can be used to track inheritance. In this particular example, we will
DNA Structure and Function
DNA Structure and Function Nucleotide Structure 1. 5-C sugar RNA ribose DNA deoxyribose 2. Nitrogenous Base N attaches to 1 C of sugar Double or single ring Four Bases Adenine, Guanine, Thymine, Cytosine
Review of Plant Cytogenetics
Review of Plant Cytogenetics Updated 2/13/06 Reading: Richards, A.J. and R.K. Dawe. 1998. Plant centromeres: structure and control. Current Op. Plant Biol. 1: 130-135. R.K. Dawe. 2005. Centromere renewal
Ch 11.Introduction to Genetics.Biology.Landis
Nom Section 11 1 The Work of Gregor Mendel (pages 263 266) This section describes how Gregor Mendel studied the inheritance of traits in garden peas and what his conclusions were. Introduction (page 263)
Meiosis and Mendel. Chapter 6
Meiosis and Mendel Chapter 6 6.1 CHROMOSOMES AND MEIOSIS Key Concept Gametes have half the number of chromosomes that body cells have. Body Cells vs. Gametes You have body cells and gametes body cells
Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles
Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN
Cell Division: the process of copying and dividing entire cells The cell grows, prepares for division, and then divides to form new daughter cells.
Mitosis & Meiosis SC.912.L.16.17 Compare and contrast mitosis and meiosis and relate to the processes of sexual and asexual reproduction and their consequences for genetic variation. 1. Students will describe
Supporting Online Material for
www.sciencemag.org/cgi/content/full/331/6019/876/dc1 Supporting Online Material for Synthetic Clonal Reproduction Through Seeds Mohan P. A. Marimuthu, Sylvie Jolivet, Maruthachalam Ravi, Lucie Pereira,
SUPPLEMENTARY INFORMATION
Supplemental Methods Isolation and mapping of SPCH An EMS-mutagenized population of tmm-1 (Col);E1728 (an enhancer trap GFP marking guard cells) was created. M2 seeds were collected from M1 s planted in
Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated
Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin
Supplementary Figure 1. Nature Genetics: doi: /ng.3848
Supplementary Figure 1 Phenotypes and epigenetic properties of Fab2L flies. A- Phenotypic classification based on eye pigment levels in Fab2L male (orange bars) and female (yellow bars) flies (n>150).
Supplemental Data. Hou et al. (2016). Plant Cell /tpc
Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc.16.295 A Distance to 1 st nt of start codon Distance to 1 st nt of stop codon B Normalized PARE abundance 8 14 nt 17 nt Frame1 Arabidopsis inflorescence
allosteric cis-acting DNA element coding strand dominant constitutive mutation coordinate regulation of genes denatured
A B C D E F G H I J K L M N O P Q R S T U V W X Y Z AA BB CC DD EE FF GG HH II JJ KK LL MM NN OO PP QQ RR SS TT UU VV allosteric cis-acting DNA element coding strand codominant constitutive mutation coordinate
Family resemblance can be striking!
Family resemblance can be striking! 1 Chapter 14. Mendel & Genetics 2 Gregor Mendel! Modern genetics began in mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in peas
The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype.
Series 1: Cross Diagrams There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome: When both
Supplemental Table 1. Primers used for cloning and PCR amplification in this study
Supplemental Table 1. Primers used for cloning and PCR amplification in this study Target Gene Primer sequence NATA1 (At2g393) forward GGG GAC AAG TTT GTA CAA AAA AGC AGG CTT CAT GGC GCC TCC AAC CGC AGC
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/301/ra98/dc1 Supplementary Materials for Regulation of Epithelial Morphogenesis by the G Protein Coupled Receptor Mist and Its Ligand Fog Alyssa J. Manning,
** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.
Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *
AP Biology Unit 6 Practice Test 1. A group of cells is assayed for DNA content immediately following mitosis and is found to have an average of 8
AP Biology Unit 6 Practice Test Name: 1. A group of cells is assayed for DNA content immediately following mitosis and is found to have an average of 8 picograms of DNA per nucleus. How many picograms
Combining Ability and Heterosis in Rice (Oryza sativa L.) Cultivars
J. Agr. Sci. Tech. (2010) Vol. 12: 223-231 Combining Ability and Heterosis in Rice (Oryza sativa L.) Cultivars M. Rahimi 1, B. Rabiei 1*, H. Samizadeh 1, and A. Kafi Ghasemi 1 ABSTRACT Quantitative valuations
DROUGHT is one of the major abiotic stresses
Copyright Ó 2006 by the Genetics Society of America DOI: 10.1534/genetics.105.045062 Genetic Basis of Drought Resistance at Reproductive Stage in Rice: Separation of Drought Tolerance From Drought Avoidance
Supplemental Data. Yang et al. (2012). Plant Cell /tpc
Supplemental Figure 1. Mature flowers of P. heterotricha. (A) An inflorescence of P. heterotricha showing the front view of a zygomorphic flower characterized by two small dorsal petals and only two fertile
2. Der Dissertation zugrunde liegende Publikationen und Manuskripte. 2.1 Fine scale mapping in the sex locus region of the honey bee (Apis mellifera)
2. Der Dissertation zugrunde liegende Publikationen und Manuskripte 2.1 Fine scale mapping in the sex locus region of the honey bee (Apis mellifera) M. Hasselmann 1, M. K. Fondrk², R. E. Page Jr.² und
Supplemental Data. Perrella et al. (2013). Plant Cell /tpc
Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization
Relationship Between Coleoptile Length and Drought Resistance and Their QTL Mapping in Rice
Rice Science, 2007, 14(1): 13-20 Copyright 2007, China National Rice Research Institute. Published by Elsevier BV. All rights reserved Relationship Between Coleoptile Length and Drought Resistance and
THE GENETICS OF CERTAIN COMMON VARIATIONS IN COLEUS 1
THE GENETICS OF CERTAIN COMMON VARIATIONS IN COLEUS DAVID C. RIFE, The Ohio State University, Columbus, Ohio Coleus are characterized by great variations in leaf color, and to a lesser degree by variations
Model plants and their Role in genetic manipulation. Mitesh Shrestha
Model plants and their Role in genetic manipulation Mitesh Shrestha Definition of Model Organism Specific species or organism Extensively studied in research laboratories Advance our understanding of Cellular
Identification of Trait-Improving Quantitative Trait Loci Alleles From a Wild Rice Relative, Oryza rufipogon
Copyright 1998 by the Genetics Society of America Identification of Trait-Improving Quantitative Trait Loci Alleles From a Wild Rice Relative, Oryza rufipogon Jinhua Xiao,*,1 Jiming Li,*, Silvana Grandillo,*
Genetic Analysis of Heading Date of Japonica Rice Cultivars in Southwest China
Rice Science, 2011, 18(4): 287 296 Copyright 2011, China National Rice Research Institute Published by Elsevier BV. All rights reserved Genetic Analysis of Heading Date of Japonica Rice Cultivars in Southwest
BREEDING AND GENETICS
The Journal of Cotton Science 6:97-103 (2002) http://journal.cotton.org, The Cotton Foundation 2002 97 BREEDING AND GENETICS Assessment of Day-Neutral Backcross Populations of Cotton Using AFLP Markers
From basic research to crop improvement. Dirk Inze VIB-UGent Center for Plant Systems Biology
From basic research to crop improvement Dirk Inze VIB-UGent Center for Plant Systems Biology Oct 2017 The Great Challenge By 2050 70% more food on the same land area Growing world population Climate change
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Overexpression of YFP::GPR-1 in the germline.
Supplementary Figure 1 Overexpression of YFP::GPR-1 in the germline. The pie-1 promoter and 3 utr were used to express yfp::gpr-1 in the germline. Expression levels from the yfp::gpr-1(cai 1.0)-expressing