Duplication of an upstream silencer of FZP increases grain yield in rice

Size: px
Start display at page:

Download "Duplication of an upstream silencer of FZP increases grain yield in rice"

Transcription

1 SUPPLEMENTARY INFORMATION Articles In the format provided by the authors and unedited. Duplication of an upstream silencer of FZP increases grain yield in rice Xufeng Bai 1,2, Yong Huang 1, Yong Hu 1, Haiyang Liu 1, Bo Zhang 1, Cezary Smaczniak 3, Gang Hu 1, Zhongmin Han 1 and Yongzhong Xing 1 * 1 National Key Laboratory of Crop Genetic Improvement and National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan , China. 2 Hubei Collaborative Innovation Center for Grain Industry, Yangtze University, Jingzhou , China. 3 Plant Cell and Molecular Biology Institute for Biology Humboldt-Universität zu Berlin, Berlin 10115, Germany. * yzxing@mail.hzau.edu.cn Nature Plants Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

2 Supplementary Table 1 The recombinants from the large NIL-F 2 population selfing by RI76 for SGDP7 fine mapping Plant No. RM6389 RM22115 SNP2 SNP4 SNP3 SNP8 SNP1 InDel76 InDel710 InDel711 Progeny Test 360 C H H H H H H H H H segregated 551 C C C C C C C H H H Small grain & more SPP 747 C C C C C C C H H H Small grain& more SPP 112 C C C C C C C N N N Small grain& more SPP 688 H C C C C C C C C C Small grain& more SPP 79 H C C C C C C C C C Small grain& more SPP 1812 H H C C C C C C C C Small grain& more SPP 4881 H H H C C C C C C C Small grain& more SPP 6810 H H H H H H C C C C segregated

3 Supplementary Table 2 The phenotypes of the complementary transgenic plants in NIL-CC background (T 0 ) Lines PL (cm) NPB NSB SPP GL (mm) Empty Vector 26.0 ± ± ± ± ± 0.1 C ± ± ± ± ± 0.08 C ± ± ± ± ± 0.04 C ± ± ± 2.9** 138 ± 5** 7.2 ± 0.06** C ± ± ± 4.5** 124 ± 12** 7.4 ± 0.07** C ± ± ± 0.7** 137 ± 3** 7.2 ± 0.02** C ± ± ± 4.0** 137 ± 22** 7.3 ± 0.02** C ± ± ± 5.1** 151 ± 26** 7.1 ± 0.02** C ± ± ± 1.6** 122 ± 6** 7.3 ± 0.1** PL, panicle length; NPB, number of primary branches; NSB, number of secondary branches; SPP, spikelets per panicle; GL, grain length; C0, the positive transgenic plant of the vector with the fragment DF1 containing the whole gene LOC_Os07g47340; C4, the positive transgenic plant of the vector with the fragment DF2 containing the polymorphism sites (SNP4 and InDel712); the others (C1-C3 and C5-C7) were the different positive transgenic plants with the fragment DF3 of 8232bp containing the CDS and the 5.3-kb upstream sequence of FZP. All data are presented as mean±sd. **, P < P value was calculated using the Student s t-test (n = 5 panicles).

4 Supplementary Table 3 The phenotypes of the complementary transgenic plants in NIL-CC background (T 1 ) Lines Genotype NPB NSB NSB/NPB SPP GL TGW C1-T 1 (-) 8.2± ± ± ± ± ±0.7 (+) 9.3± ± ± ± ± ±0.9 P value 3.0E E E E E E-06 C2-T 1 (-) 8.3± ± ± ± ± ±0.7 (+) 9.5± ± ± ± ± ±0.9 P value 2.9E E E E E E-06 C4-T 1 (-) 8.0± ± ± ± ± ±0.8 (+) 7.9± ± ± ± ± ±0.5 P value C7-T 1 (-) 8.9± ± ± ± ± ±0.4 (+) 8.6± ± ± ± ± ±0.9 P value E E E E E-04 NPB, number of primary branches; NSB, number of secondary branches; NSB/NPB, the ratio of NSB to NPB; SPP, spikelets per panicle; GL, grain length; TGW, 1000-grain weight; C1-T 1, C2-T 1, C4-T 1 and C7-T 1 were respectively the T 1 generation of the corresponding T 0 lines (C1, C2, C4 and C7) in Supplementary Table 2. - and + were the transgenic negative plants and positive plants, respectively. All data are presented as mean ± SD. P value were calculated using the Student s t-test (n = 10 plants).

5 Supplementary Table 4 The phenotypes of the NILs in Chuan 7 genetic backgrounds Traits Chuan7-NN Chuan7-CC P value PN 8.9± ± NPB 11.0± ± NSB 28.3± ± E-13 NSB/NPB 2.6± ± E-07 SPP 125.5± ± E-09 GL (mm) 6.9± ± E-15 TGW (g) 14.2± ± E-17 YD (g) 14.1± ± E-03 PN, panicle number per plant; NPB, number of primary branches; NSB, number of secondary branches; NSB/NPB, the ratio of NSB to NPB; SPP, spikelets per panicle; GL, grain length; TGW, 1000-grain weight; YD, grain yield per plant; All data are presented as mean ± SD. P value were calculated using the Student s t-test (n = 20 plants).

6 Supplementary Table 5 The phenotypes of the heterozygous inbred family (HIF) derived from the cross between Haoboka and Chuan 7 Trait HIF-Haoboka HIF-Chuan7 P value PN 9.4± ± NPB 8.1± ± NSB 20.6± ± E-14 NSB/NPB 2.5± ± E-15 SPP 119± ± E-13 GL (mm) 6.8± ± E-11 TWG (g) 20.6± ± E-10 YD (g) 15.0± ± E-03 PN, panicle number per plant; NPB, number of primary branches; NSB, number of secondary branches; NSB/NPB, the ratio of NSB to NPB; SPP, spikelets per panicle; GL, grain length; TGW, 1000-grain weight; YD, yield; All data are presented as mean ±SD. P value was calculated using the Student s t-test (n = 12 plants).

7 Supplementary Table 6 The phenotypes of grain quality in the near isogenic lines with the genetic background of RI76 Alkali Rice length Rice width Ratio length Chalkiness Chalkiness Amylose Gel consistency Genotype spreading (mm) (mm) to width Ratio (%) degree (%) content (%) (mm) value NIL-NN 4.3±0.04** 2.2± ±0.01** 54.9±2.7** 18.9±0.8** 26.8± ±4.5** 1.0±0.1 NIL-CC 4.2± ± ± ± ± ± ± ±0.2 All data are presented as mean ± SD. **, P < 0.01 (n = 10 plants, Student s t-test).

8 Supplementary Table 7 The phenotypes of RNAi-3 and negative plants (T 3 ) in NIL- NN genetic background Trait Negative (25) RNAi-FZP (63) P value PN 8.8± ± NPB 7.7± ± NSB 20.0± ± E-16 NSB/NPB 2.6± ± E-15 SPP 105±10 165± E-09 GL (mm) 8.0± ± E-23 TWG (g) 19.8± ± E-25 YD (g) 14.4± ± PN, panicle number per plant; NPB, number of primary branches; NSB, number of secondary branches; NSB/NPB, the ratio of NSB to NPB; SPP, spikelets per panicle; GL, grain length; TGW, 1000-grain weight; YD, yield; All data are presented as mean ±SD. P value was calculated using the Student s t-test (n 25 plants).

9 Supplementary Table 8 The information of the 60 wild rice accessions used for examining the CNV-18bp No. of wild rice IRGC accession Species Name Source Country W O. glaberrima TANZANIA W O. rufipogon INDIA W O. rufipogon INDIA W O. rufipogon INDIA W O. rufipogon PAPUA NEW GUINEA W O. rufipogon MYANMAR W O. rufipogon INDIA W O. nivara NEPAL W O. rufipogon NEPAL W O. rufipogon NEPAL W O. alta SURINAME W O. nivara INDIA W O. rufipogon CHINA W O. rufipogon SRI LANKA W O. rufipogon THAILAND W O. rufipogon INDIA W O. nivara CHINA W O. rufipogon INDIA W O. rufipogon INDIA W O. rufipogon THAILAND W O. rufipogon THAILAND W O. nivara SRI LANKA W O. nivara INDIA W O. nivara INDIA W O. rufipogon THAILAND W O. rufipogon THAILAND W O. rufipogon MALAYSIA W O. rufipogon INDONESIA W29 O. rufipogon W O. rufipogon VIETNAM W31 O. punctata W32 GUANGDONG, CHINA W33 HAINAN, CHINA W O.rufipogon KAMPUCHEA W35 O.rufipogon W36 O. rufipogon W37 GUANGDONG, CHINA W38 O.rufipogon W O.rufipogon INDIA W O.rufipogon LAOS W O. punctata KENYA

10 W42 O.rufipogon W43 O.rufipogon W44 O.rufipogon W45 O. rufipogon GUANGDONG, CHINA W46 O. rufipogon GUANGDONG, CHINA W47 O. rufipogon GUANGDONG, CHINA W48 O. rufipogon GUANGDONG, CHINA W49 O. rufipogon GUANGDONG, CHINA W O. nivara CHINA W O. longistaminata TANZANIA W O.rufipogon CHINA W O. nivara INDIA W O. nivara THAILAND W O. nivara SRI LANKA W O. nivara SRI LANKA W57 O. rufipogon HUNAN, CHINA W58 O. rufipogon HUNAN, CHINA W59 O. rufipogon HUNAN, CHINA W60 O. rufipogon CHINA

11 Supplementary Table 9 The primers were used for mapping, vector construction and qrt-pcrs Markers Primers Forward(5'-3') Reverse(5'-3') InDel712 GCTTCCAGCGCCTACTGC TGCTCTGTTCTCCTCCGTTT InDel711 GCACATGCATGCTAGGACAT AGCCGGTAAATTTCTTGCAC InDel710 CATGTTATCGTGTGGGCTTT TCTGTTGCTGCAGCTGAACT InDel76 CACCGAAGACTGATCAGCAA TCACATTCGAGTGGAGCAA SNP1/SNP8 GGTTATTTCACATTGCCAAGC CGCTCAAAAGACAAGCTCCT SNP2 GCCTTAAGCTTGCATGGAGT GGTGGCCGGTGAAAAGTAGT SNP3 AGCTTTCCCCACAAGTGACA GTTGCCGAGTTACCATGTGA SNP4 CGAGCTTTGCCTACAAGGAT CGGGGAACAATGTAACACGA SNP5 GCATCCCAGAATCGTTCATC GGAATGCATGTATTGCGTGT SNP6 CAATGGGCGCAAACATAAAT ATGCAAAGTTCAGCCTGCTT SNP7 CAGCAACGGAAGAAGTGTCA CGGGTTAGCTGATTTGGTTT X4 CACCAGAACTTGAACCATCG GTCCAAGAGCCCAACTGAAC X3 GCATTAGCTGGTGGACAAAA AACGCAGGGGAATAACAATG U1 GTATCTCGGCAGCGTACCTC CGAAGGAAAGCAAAGCCATA U3 GCCGGTGTTAGGTTCAAATG CTTGTGTGCTGTGCTCGTTT U4 TGATGACCTTGACTTCCCCTA CAGTTGCGTAATTGCTTGTCA U5 CCTTAACAATTGTCAGTGCTTGC ACTACCGAACGGGGCTTTAT U7 AAGGGCAACGAGAGATGGT ATGCTCAGTTGGCCGATAAT U8 GACTTGTACACCGGCTACGG TATCCTTCTACCCCCGTTCC U9 GAGCGAGTGAAAGGCATGA TTTCCCGAGGAGTCAACATT RiFZP GGACTAGTGGTACCGTACCTG- CGCGAGCTCGGATCCCAATG- AGCAGCGTGGTG GGAGAGGAAGCTGAA FZP-In Situ ATGAACACTCGAGGCAGC CTCGCTCATCGGCGACGA FZP-qRT CAGGGCTCCGACTCCTACTCT CAATGCCCGGTGCAACTC OsBZR1-qRT CTGCCTCCTCCCGTTCCT GCCGTCCCTTCTATCTCCAT CDC20-qRT TCGAATCACCTGTTTGTTGGC TGGAGACAATCCAACGCAAAG

12 CDKA-2-qRT CGAGATTTGAAGCCCCAGAA TCCGCGAGCTTCAATGAGTT CYCA2-1-qRT AGGTTGTCAAGATGGAGAGCGA CGCTTTTTGTCTTCCTGGCA CYCD3-qRT CCTTCCACACTGACGGTACAGTT TGCCGCTGCCAAATAGACA CYCT1-qRT GCATTTGTTGCAGCTCAAG TCACCACTTCGCTGACTTATTG E2Fa-qRT TGTTGGTGGCTGCCGATAT CGCCAGGTGCACCCTTT H1-qRT GCAAGGCACCTGCAGCTT AGGCAGCCTTTGTACAGATCCT MAD2-qRT GAGCCATGCATATTCGACGTG GGTGTCGAAGGAATGCAGCTT MCM3-qRT TTCATGCGTCACTAAATGCGAG TGAATCTGGAAGCCCAATGTTC Ubiquitin-qRT AACCAGCTGAGGCCCAAGA ACGATTGATTTAACCAGTCCATGA OsBZR1-1 AACTGCAGATGACGTCCGGG CGGAATTCTCATTTCGCGCC CC-Bait-probe GCGCGTGCGCGTCCGTGCGTGCGTGCG- GTCACGCACGCACGCACGGACGCGCACG- CGTCCGTGCGTGCGTGCGTGAC CACGCACGGACGCGCACGCGC CC-Bait-Mtprobe GCGCGGTCGCGTCCGGACGCTCGATCG- CGTCCGGTCGGACGCTCGATAC GTATCGAGCGTCCGACCGGACGCGATCGA- GCGTCCGGACGCGACCGCGC NN-Bait-probe GCGCGTGCGCGTCCGTGCGTGCGTGCGTGAC GTCACGCACGCACGCACGGACGCGCACGCGC NN-Bait-Mtprobe GCGCGGTCGCGTCCGGACGCTCGATCGATAC GTATCGATCGAGCGTCCGGACGCGACCGCGC ChIP-qRT- OsBZR1 TACTATAGCGCGCGCTCTG AACGATCGATCGATCGGC

13 Supplementary Fig. 1 The panicle architecture and grain shape of Nanyangzhan and Chuan 7 Panicle architecture of Nanyangzhan (left) and Chuan 7 (right) ; (b) and (c) grains of Nanyangzhan and Chuan 7, respectively. Scale bar, 4 cm for a, 1 cm for b & c.

14 Supplementary Fig. 2 The genome constitution of the HIF (RI76) NYZ, Nanyangzhan; C7, Chuan 7; H, heterozygous.

15 Supplementary Fig. 3 The panicle of the transgenetic plants (T 0 ) of the genetic complementary of SGDP7 in NIL-CC background Vector, represents the empty of pcambia1301; C4, the positive transgenic plant of the vector with a fragment (DF2) only containing the polymorphism sites (SNP4 and InDel712); the others (C1-C3 and C5-C7) were the different positive transgenic plants with a whole fragment (DF3) of 8232bp containing the CDS and the 5.3-kb upstream sequence. Scale bar = 4 cm.

16 Supplementary Fig. 4 Comparison of yield related traits between the NILs of SGDP7 All data are presented as mean ± SD. P value were calculated using the Student s t- test (n = 20 plants).

17 Supplementary Fig. 5 The genome constitution of the HIF derived from the cross between Haoboka and Chuan 7 HBK, Haoboka; C7, Chuan 7; H, heterozygous.

18 Supplementary Fig. 6 The panicle architecture and grain shape of the heterozygous inbred line derived from the cross between Haoboka and Chuan 7 (a) panicle architecture, Haoboka (left) and Chuan 7 (right) ; (b) grains of haoboka (up) and Chuan 7 (down). (c), (d) and (e) were panicle architecture, primary branch and secondary branch of HIF-Haoboka (left) and HIF-Chuan7 (right), respectively; (f) and (e) were grains and brown rice of HIF-Haoboka (up) and HIF-Chuan7 (down). Scale bar, 4 cm for a & c, 1 cm for b & d-g.

19 Supplementary Fig. 7 The grains of the near isogenic lines of SGDP7 in Chuan 7 genetic backgrounds (a) the grains and (b) brown rice of Chuan7-NN (right) and Chuan7-CC (left). Scale bar, 2.5 mm for a & b.

20 Supplementary Fig. 8 Characterization of grain filling and transverse section of the grain in NIL-NN and NIL-CC (a) Time-course of the increase in endosperm fresh weight. (b) Time-course of the increase in endosperm dry weight. The data are presented as the means ± SD (n = 12 plants) in a and b. (c) Loose starch granule in a cross section of NIL-NN. (d) The starch grains were compactly arranged with no gap in a cross section of NIL-CC. Scale bars, 20 μm for c & d.

21 Supplementary Fig. 9 The observation of young panicles and the expression of floral identity genes in young panicles The observation of the young panicle by scanning electron microscopy; (a) NIL-NN and (b) NIL-CC, in the secondary branching stage; (c) NIL-NN and (d) NIL-CC in the floral meristem stage; (e) the expression pattern of the floral identity genes in the 2- mm-long and 5-mm-long young panicle from the data of RNA-Seq for NIL-NN and NIL-CC; BM, branch meristem; SM, spikelet meristem; FM, floral meristem; FM (F), the former stage of FM; FM (L), the later stage of FM; Scale bar, 100 μm for a-d.

22 Supplementary Fig. 10 The panicle length in different developmental stage (n = 10 plants)

23 Supplementary Fig. 11 Expression of FZP in the 2-mm-long young panicle (a) The relative expression levels of FZP of NILs. Ubiquitin served as the control. The bars indicate standard deviations. ** P < 0.01 (n = 3, Student s t-test). (b) RNA in situ hybridization analysis of FZP. The Spikelet meristems (SM) and floral meristem (FM) marked with black arrows; blue arrows indicate areas of expression in FM, sense probe control is also showed. Scale bar = 100 μm.

24 Supplementary Fig. 12 Comparison grain length between CK and RNAi of FZP Primary branch (PB); Secondary branch (SB); The bars indicate standard deviations. ** P < 0.01 (n = 10 plants, Student s t-test).

25 Supplementary Fig. 13 The relative expression of 9 cell cycle related genes (n = 3).

26 Supplementary Fig. 14 Interaction analysis of OsBZR1 and CNV-18bp by electrophoretic mobility shift assay

27 Supplementary Fig. 15 The electrophoresis gel map of the maker InDel712 (a) the polymorphism of InDel712 was displayed in polyacrylamide gel (4%), blue arrows indicated the bind of the aus varieties with a 18-bp insertion; (b) the polymorphism of InDel712 was displayed in agarose gel (3%); (c) and (d) the genotypes of the 60 wild rice at InDel712. NYZ, Nanyangzhan; C7, Chuan 7; H, Heterozygote.

Supplementary Methods

Supplementary Methods Supplementary Methods Microarray analysis Grains of 7 DAP of the wild-type and gif1 were harvested for RNA preparation. Microarray analysis was performed with the Affymetrix (Santa Clara, CA) GeneChip

More information

Title. Authors. Characterization of a major QTL for manganese accumulation in rice grain

Title. Authors. Characterization of a major QTL for manganese accumulation in rice grain Title Characterization of a major QTL for manganese accumulation in rice grain Authors Chaolei Liu, Guang Chen, Yuanyuan Li, Youlin Peng, Anpeng Zhang, Kai Hong, Hongzhen Jiang, Banpu Ruan, Bin Zhang,

More information

Supplementary Table 1. Primers used in this study.

Supplementary Table 1. Primers used in this study. Supplementary Tale 1. Primers used in this study. Name Primer sequence (5'-3') Primers of PCR-ased molecular markers developed in this study M1 F M1 R M2 F M2 R M3 F M3 R M4 F M4 R M5 F M5 R M6 F M6 R

More information

Table S1 List of primers used for genotyping and qrt-pcr.

Table S1 List of primers used for genotyping and qrt-pcr. Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!

More information

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions. Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods

More information

Genetic diversity and population structure in rice. S. Kresovich 1,2 and T. Tai 3,5. Plant Breeding Dept, Cornell University, Ithaca, NY

Genetic diversity and population structure in rice. S. Kresovich 1,2 and T. Tai 3,5. Plant Breeding Dept, Cornell University, Ithaca, NY Genetic diversity and population structure in rice S. McCouch 1, A. Garris 1,2, J. Edwards 1, H. Lu 1,3 M Redus 4, J. Coburn 1, N. Rutger 4, S. Kresovich 1,2 and T. Tai 3,5 1 Plant Breeding Dept, Cornell

More information

Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.

Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background. Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on

More information

MARKER ASSISTED SELECTION (MAS) FOR DROUGHT TOLERANCE IN WHEAT USING MARKERS ASSOCIATED WITH MEMBRANE STABILITY

MARKER ASSISTED SELECTION (MAS) FOR DROUGHT TOLERANCE IN WHEAT USING MARKERS ASSOCIATED WITH MEMBRANE STABILITY AN. I.N.C.D.A. FUNDULEA, VOL. LXXVII, 2009 GENETICA ŞI AMELIORAREA PLANTELOR MARKER ASSISTED SELECTION (MAS) FOR DROUGHT TOLERANCE IN WHEAT USING MARKERS ASSOCIATED WITH MEMBRANE STABILITY SELECŢIA ASISTATĂ

More information

Biological Roles of Cytokinins

Biological Roles of Cytokinins Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators

More information

Supplemental Data. Wang et al. (2014). Plant Cell /tpc

Supplemental Data. Wang et al. (2014). Plant Cell /tpc Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and

More information

2. Der Dissertation zugrunde liegende Publikationen und Manuskripte. 2.1 Fine scale mapping in the sex locus region of the honey bee (Apis mellifera)

2. Der Dissertation zugrunde liegende Publikationen und Manuskripte. 2.1 Fine scale mapping in the sex locus region of the honey bee (Apis mellifera) 2. Der Dissertation zugrunde liegende Publikationen und Manuskripte 2.1 Fine scale mapping in the sex locus region of the honey bee (Apis mellifera) M. Hasselmann 1, M. K. Fondrk², R. E. Page Jr.² und

More information

Classical Selection, Balancing Selection, and Neutral Mutations

Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection Perspective of the Fate of Mutations All mutations are EITHER beneficial or deleterious o Beneficial mutations are selected

More information

Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids

Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Plant growth conditions The soil was a 1:1 v/v mixture of loamy soil and organic compost. Initial soil water content was determined

More information

Supplementary Figure 1. Nature Genetics: doi: /ng.3848

Supplementary Figure 1. Nature Genetics: doi: /ng.3848 Supplementary Figure 1 Phenotypes and epigenetic properties of Fab2L flies. A- Phenotypic classification based on eye pigment levels in Fab2L male (orange bars) and female (yellow bars) flies (n>150).

More information

Supplementary Figure 1. Phenotype of the HI strain.

Supplementary Figure 1. Phenotype of the HI strain. Supplementary Figure 1. Phenotype of the HI strain. (A) Phenotype of the HI and wild type plant after flowering (~1month). Wild type plant is tall with well elongated inflorescence. All four HI plants

More information

Quantitative trait loci mapping of the stigma exertion rate and spikelet number per panicle in rice (Oryza sativa L.)

Quantitative trait loci mapping of the stigma exertion rate and spikelet number per panicle in rice (Oryza sativa L.) Quantitative trait loci mapping of the stigma exertion rate and spikelet number per panicle in rice (Oryza sativa L.) M.H. Rahman, P. Yu, Y.X. Zhang, L.P. Sun, W.X. Wu, X.H. Shen, X.D. Zhan, D.B. Chen,

More information

IDENTIFICATION OF THERMOSENSITIVE GENIC MALE-STERILE LINES WITH LOW CRITICAL STERILITY POINT FOR HYBRID RICE BREEDING

IDENTIFICATION OF THERMOSENSITIVE GENIC MALE-STERILE LINES WITH LOW CRITICAL STERILITY POINT FOR HYBRID RICE BREEDING Philippine Journal of Crop Science April 2005, 30(1): 19-28 Copyright 2005, Crop Science Society of the Philippines Released 22 April 2005 IDENTIFICATION OF THERMOSENSITIVE GENIC MALE-STERILE LINES WITH

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,

More information

Supplementary Information

Supplementary Information Supplementary Information Rice APC/C TE controls tillering through mediating the degradation of MONOCULM 1 Qibing Lin 1*, Dan Wang 1*, Hui Dong 2*, Suhai Gu 1, Zhijun Cheng 1, Jie Gong 2, Ruizhen Qin 1,

More information

The Regional Integrated Multi-Hazard Early Warning System for Africa and Asia CAP in RIMES

The Regional Integrated Multi-Hazard Early Warning System for Africa and Asia CAP in RIMES The Regional Integrated Multi-Hazard Early Warning System for Africa and Asia CAP in RIMES 2018 CAP Implementation Workshop OUTLINE 1. RIMES Overview 2. DSS tools developed in RIMES 3. CAP Integration

More information

Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.

Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny

More information

Nature Genetics: doi: /ng Supplementary Figure 1. The FIN and FAB genes act separately from the meristem maturation pathway.

Nature Genetics: doi: /ng Supplementary Figure 1. The FIN and FAB genes act separately from the meristem maturation pathway. Supplementary Figure 1 The FIN and FAB genes act separately from the meristem maturation pathway. (a) Representative inflorescence from the compound inflorescence (s, defective in the homolog of Arabidopsis

More information

Taxonomic status of Oryza glumaepatula Steud. I. Comparative morphological studies of New World diploids and Asian AA genome species

Taxonomic status of Oryza glumaepatula Steud. I. Comparative morphological studies of New World diploids and Asian AA genome species Genetic Resources and Crop Evolution 45: 197 203, 1998. 197 c 1998 Kluwer Academic Publishers. Printed in the Netherlands. Taxonomic status of Oryza glumaepatula Steud. I. Comparative morphological studies

More information

Principles of QTL Mapping. M.Imtiaz

Principles of QTL Mapping. M.Imtiaz Principles of QTL Mapping M.Imtiaz Introduction Definitions of terminology Reasons for QTL mapping Principles of QTL mapping Requirements For QTL Mapping Demonstration with experimental data Merit of QTL

More information

EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA

EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA Item Type text; Electronic Thesis Authors Bergstrand, Lauren Janel Publisher The University of Arizona. Rights Copyright is held by the author. Digital

More information

GFP GAL bp 3964 bp

GFP GAL bp 3964 bp Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive

More information

The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype.

The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype. Series 2: Cross Diagrams - Complementation There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:

More information

Natural Disasters in Member Countries (2002 Summary)

Natural Disasters in Member Countries (2002 Summary) 4.2 Member Countries and their Disaster Characteristics: Table 5: Natural Disasters in Member Countries (2002 Summary) (Country/Disaster Type/Disaster Characteristics) Data Country DisType Count of TotAff

More information

Climate Change and Plant Reproduction

Climate Change and Plant Reproduction Quantitative Trait Loci Mapping of Reproductive Traits Involved in Heat Stress Responses in Arabidopsis : Implications for Global Climate Change and Plant Reproduction Lazar Pavlovic, Greta Chiu, Jeffrey

More information

Biology I Level - 2nd Semester Final Review

Biology I Level - 2nd Semester Final Review Biology I Level - 2nd Semester Final Review The 2 nd Semester Final encompasses all material that was discussed during second semester. It s important that you review ALL notes and worksheets from the

More information

Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles

Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN

More information

Developing summerdormant tall fescue for the southern Great Plains

Developing summerdormant tall fescue for the southern Great Plains Developing summerdormant tall fescue for the southern Great Plains Persistence is the major constraint of growing tall fescue in south-central USA 40-60% stand loss in a year Improve persistence Drought

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature12791 Supplementary Figure 1 (1/3) WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 1 (2/3) 2 WWW.NATURE.COM/NATURE SUPPLEMENTARY

More information

Quantitative trait locus analysis for ear height in maize based on a recombinant inbred line population

Quantitative trait locus analysis for ear height in maize based on a recombinant inbred line population Quantitative trait locus analysis for ear height in maize based on a recombinant inbred line population Z.Q. Li 4,5, H.M. Zhang 1,4, X.P. Wu 1,4, Y. Sun 3,4 and X.H. Liu 2 1 Maize Research Institute, Shanxi

More information

QTL analysis for hybrid sterility and plant height in interspecific populations derived from a wild rice relative, Oryza longistaminata

QTL analysis for hybrid sterility and plant height in interspecific populations derived from a wild rice relative, Oryza longistaminata Breeding Science 59: 441 445 (2009) Note QTL analysis for hybrid sterility and plant height in interspecific populations derived from a wild rice relative, Oryza longistaminata Zhiwei Chen 1,2), Fengyi

More information

Asia. JigsawGeo. Free Printable Maps for Geography Education. Try our geography games for the ipod Touch or iphone.

Asia. JigsawGeo. Free Printable Maps for Geography Education. Try our geography games for the ipod Touch or iphone. Free Printable Maps for Geography Education Map with region names shown Map without names, for coloring or quizzes Map with coordinate system, for location practice Answer key for coordinate system quiz

More information

Identification of Trait-Improving Quantitative Trait Loci Alleles From a Wild Rice Relative, Oryza rufipogon

Identification of Trait-Improving Quantitative Trait Loci Alleles From a Wild Rice Relative, Oryza rufipogon Copyright 1998 by the Genetics Society of America Identification of Trait-Improving Quantitative Trait Loci Alleles From a Wild Rice Relative, Oryza rufipogon Jinhua Xiao,*,1 Jiming Li,*, Silvana Grandillo,*

More information

Investigations into biomass yield in perennial ryegrass (Lolium perenne L.)

Investigations into biomass yield in perennial ryegrass (Lolium perenne L.) Investigations into biomass yield in perennial ryegrass (Lolium perenne L.) Ulrike Anhalt 1,2, Pat Heslop-Harrison 2, Céline Tomaszewski 1,2, Hans-Peter Piepho 3, Oliver Fiehn 4 and Susanne Barth 1 1 2

More information

Genetics 275 Notes Week 7

Genetics 275 Notes Week 7 Cytoplasmic Inheritance Genetics 275 Notes Week 7 Criteriafor recognition of cytoplasmic inheritance: 1. Reciprocal crosses give different results -mainly due to the fact that the female parent contributes

More information

Molecular relationships between Australian annual wild rice, Oryza meridionalis, and two related perennial forms

Molecular relationships between Australian annual wild rice, Oryza meridionalis, and two related perennial forms Molecular relationships between Australian annual wild rice, Oryza meridionalis, and two related perennial forms Sotowa et al. Sotowa et al. Rice 2013, 6:26 Sotowa et al. Rice 2013, 6:26 RESEARCH Molecular

More information

The evolving story of rice evolution

The evolving story of rice evolution Available online at www.sciencedirect.com Plant Science 174 (2008) 394 408 Review The evolving story of rice evolution www.elsevier.com/locate/plantsci Duncan A. Vaughan a, *, Bao-Rong Lu b, Norihiko Tomooka

More information

Design your genome! How to exchange chromosomes and organelles between Arabidopsis ecotypes. (and why we d like to do so)

Design your genome! How to exchange chromosomes and organelles between Arabidopsis ecotypes. (and why we d like to do so) Design your genome! How to exchange chromosomes and organelles between Arabidopsis ecotypes. (and why we d like to do so) Erik Wijnker International Conference on New Plant Breeding Molecular Technologies

More information

Department of Forensic Psychiatry, School of Medicine & Forensics, Xi'an Jiaotong University, Xi'an, China;

Department of Forensic Psychiatry, School of Medicine & Forensics, Xi'an Jiaotong University, Xi'an, China; Title: Evaluation of genetic susceptibility of common variants in CACNA1D with schizophrenia in Han Chinese Author names and affiliations: Fanglin Guan a,e, Lu Li b, Chuchu Qiao b, Gang Chen b, Tinglin

More information

Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication

Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication SUPPORTING ONLINE MATERIALS Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication Bin Cong, Luz Barrero, & Steven Tanksley 1 SUPPORTING

More information

MOCK EXAMINATION 1. Name Class Date INSTRUCTIONS

MOCK EXAMINATION 1. Name Class Date INSTRUCTIONS Name Class Date PRIMARY 2 mathematics MOCK EXAMINATION 1 INSTRUCTIONS Total time for Section A, Section B and Section C: 1 hour 45 minutes The use of calculators is not allowed. SECTION A : Multiple Choice

More information

Characterization of Rice (Oryza Sativa L.) Germplasm Through Various Agro-Morphological Traits

Characterization of Rice (Oryza Sativa L.) Germplasm Through Various Agro-Morphological Traits Scientia Agriculturae www.pscipub.com/sa E-ISSN: 2310-953X / P-ISSN: 2311-0228 DOI: 10.15192/PSCP.SA.2015.9.2.8388 Sci. Agri. 9 (2), 2015: 83-88 PSCI Publications Characterization of Rice (Oryza Sativa

More information

Curriculum vitae Xigang Liu

Curriculum vitae Xigang Liu Curriculum vitae Xigang Liu 1, EDUCATION: 09/1993-07/1997 B.S. Major: Biology. College of Life Sciences, Hebei Normal University Academic Degree Paper: RAPD analysis of Taigu genic male-sterile wheat and

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/301/ra98/dc1 Supplementary Materials for Regulation of Epithelial Morphogenesis by the G Protein Coupled Receptor Mist and Its Ligand Fog Alyssa J. Manning,

More information

Maria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner

Maria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner ABA represses the transcription of chloroplast genes Maria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner Supplementary data Supplementary tables Table

More information

Fast and simple fluorescent RNA quality assessment

Fast and simple fluorescent RNA quality assessment Fast and simple fluorescent RNA quality assessment Chris Vonnegut Presented at ASHG Laboratory CoLab Session October, The world leader in serving science RNA Quality and Quantity RNA Sample Isolation Cells

More information

South, Southeast, and East Asia. Physical Geography

South, Southeast, and East Asia. Physical Geography South, Southeast, and East Asia Physical Geography Mountains v Mountains are important in Asia because they influence: A. Population patterns B. Movement of people and goods C. Climate Mountains v The

More information

Natural variation at the DEP1 locus enhances grain yield in rice

Natural variation at the DEP1 locus enhances grain yield in rice LETTERS Natural variation at the DEP1 locus enhances grain yield in rice Xianzhong Huang 1,6, Qian Qian 2,6, Zhengbin Liu 1, Hongying Sun 1, Shuyuan He 1,DaLuo 3, Guangmin Xia 4, Chengcai Chu 5, Jiayang

More information

Joong Hyoun Chin. Yoo-Jin Lee. Wenzhu Jiang. Hee-Jong Koh. Michael J. Thomson

Joong Hyoun Chin. Yoo-Jin Lee. Wenzhu Jiang. Hee-Jong Koh. Michael J. Thomson Genet Resour Crop Evol (2017) 64:405 418 DOI 10.1007/s10722-016-0368-1 RESEARCH ARTICLE Characterization of indica japonica subspecies-specific InDel loci in wild relatives of rice (Oryza sativa L. subsp.

More information

Managing segregating populations

Managing segregating populations Managing segregating populations Aim of the module At the end of the module, we should be able to: Apply the general principles of managing segregating populations generated from parental crossing; Describe

More information

Pollen fertility Vs Spikelet fertility in F2 of a CMS based hybrids in rice (Oryza sativa L.) under Aerobic condition

Pollen fertility Vs Spikelet fertility in F2 of a CMS based hybrids in rice (Oryza sativa L.) under Aerobic condition Research Article Pollen fertility Vs Spikelet fertility in F of a CMS based hybrids in rice (Oryza sativa L.) under Aerobic condition N.Naresh Babu,N.Shivakumar and Shailaja Hittalmani Abstract : Identification

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1. Haploid plant produced by centromere-mediated genome elimination Chromosomes containing altered CENH3 in their centromeres (green dots) are eliminated after fertilization in a cross to wild

More information

What are we learning from genome-wide association studies (GWAS) in rice?

What are we learning from genome-wide association studies (GWAS) in rice? What are we learning from genome-wide association studies (GWAS) in rice? Susan McCouch, Chih Wei Tung, Mark Wright, Adam Famoso, Randy Clark, Anthony Greenberg, Janelle Jung, Hyujung Kim, Josh Cobb, Moni

More information

Exam 1 PBG430/

Exam 1 PBG430/ 1 Exam 1 PBG430/530 2014 1. You read that the genome size of maize is 2,300 Mb and that in this species 2n = 20. This means that there are 2,300 Mb of DNA in a cell that is a. n (e.g. gamete) b. 2n (e.g.

More information

Through the genetic bottleneck: O. rufipogon as a source of trait-enhancing alleles for O. sativa

Through the genetic bottleneck: O. rufipogon as a source of trait-enhancing alleles for O. sativa Euphytica (2007) 154:317 339 DOI 10.1007/s10681-006-9210-8 Through the genetic bottleneck: O. rufipogon as a source of trait-enhancing alleles for O. sativa Susan R. McCouch Æ Megan Sweeney Æ Jiming Li

More information

RNAi Suppression of AGAMOUS-like Genes Causes Field Sterility in Populus

RNAi Suppression of AGAMOUS-like Genes Causes Field Sterility in Populus RNAi Suppression of AGAMOUS-like Genes Causes Field Sterility in Populus Haiwei Lu and Steven H. Strauss Oregon State University Forest Tree Workshop PAG XXVI, San Diego, CA, 2018 The containment issue

More information

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and

More information

Effects of cytoplasm on the fertility of thermo-sensitive genetic male sterile (TGMS) lines of rice

Effects of cytoplasm on the fertility of thermo-sensitive genetic male sterile (TGMS) lines of rice AJCS 8(7):999-1004 (2014) ISSN:1835-2707 Effects of cytoplasm on the of thermo-sensitive genetic male sterile (TGMS) lines of rice Gong-Ping Kang 1,2, Xiao-Jun Dai 1, Li-Jun Ou 1, Wen-Jia Li 1, Man-Zhong

More information

Quiz Section 4 Molecular analysis of inheritance: An amphibian puzzle

Quiz Section 4 Molecular analysis of inheritance: An amphibian puzzle Genome 371, Autumn 2018 Quiz Section 4 Molecular analysis of inheritance: An amphibian puzzle Goals: To illustrate how molecular tools can be used to track inheritance. In this particular example, we will

More information

Scaling Seed Kits Through Household Gardens

Scaling Seed Kits Through Household Gardens Scaling Seed Kits Through Household Gardens SENEGAL WESTERN SAHARA LIBERIA PORTUGAL REPULIC OF IRELAND COTE D IVOIRE UNITED KINGDOM GHANA NETHERLANDS BELGIUM DENMARK SWITZ. TUNISIA CAMEROON CZECH REPUBLIC

More information

New insights into the history of rice domestication

New insights into the history of rice domestication Review TRENDS in Genetics Vol.23 No.11 New insights into the history of rice domestication Michael J. Kovach, Megan T. Sweeney and Susan R. McCouch Cornell University, Department of Plant Breeding and

More information

Shoot Apex Development at Various Stages of Flowering in Sugarcane (Saccharum spp. hybrid)

Shoot Apex Development at Various Stages of Flowering in Sugarcane (Saccharum spp. hybrid) 2008 The Japan Mendel Society Cytologia 73(2): 173 177, 2008 Shoot Apex Development at Various Stages of Flowering in Sugarcane (Saccharum spp. hybrid) M. Swapna* and Praveen Kumer Singh Division of Crop

More information

allosteric cis-acting DNA element coding strand dominant constitutive mutation coordinate regulation of genes denatured

allosteric cis-acting DNA element coding strand dominant constitutive mutation coordinate regulation of genes denatured A B C D E F G H I J K L M N O P Q R S T U V W X Y Z AA BB CC DD EE FF GG HH II JJ KK LL MM NN OO PP QQ RR SS TT UU VV allosteric cis-acting DNA element coding strand codominant constitutive mutation coordinate

More information

When one gene is wild type and the other mutant:

When one gene is wild type and the other mutant: Series 2: Cross Diagrams Linkage Analysis There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:

More information

Biology. Revisiting Booklet. 6. Inheritance, Variation and Evolution. Name:

Biology. Revisiting Booklet. 6. Inheritance, Variation and Evolution. Name: Biology 6. Inheritance, Variation and Evolution Revisiting Booklet Name: Reproduction Name the process by which body cells divide:... What kind of cells are produced this way? Name the process by which

More information

Lecture 9. QTL Mapping 2: Outbred Populations

Lecture 9. QTL Mapping 2: Outbred Populations Lecture 9 QTL Mapping 2: Outbred Populations Bruce Walsh. Aug 2004. Royal Veterinary and Agricultural University, Denmark The major difference between QTL analysis using inbred-line crosses vs. outbred

More information

Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites

Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites Paper by: James P. Balhoff and Gregory A. Wray Presentation by: Stephanie Lucas Reviewed

More information

4/26/18. Domesticated plants vs. their wild relatives. Lettuce leaf size/shape, fewer secondary compounds

4/26/18. Domesticated plants vs. their wild relatives. Lettuce leaf size/shape, fewer secondary compounds The final exam: Tuesday, May 8 at 4:05-6:05pm in Ruttan Hall B35. 75 multiple choice questions for 150 points 50 questions from Lecture 20 27 25 questions directly from the first two exams. Key for exam

More information

You are encouraged to answer/comment on other people s questions. Domestication conversion of plants or animals to domestic uses

You are encouraged to answer/comment on other people s questions. Domestication conversion of plants or animals to domestic uses The final exam: Tuesday, May 8 at 4:05-6:05pm in Ruttan Hall B35. 75 multiple choice questions for 150 points 50 questions from Lecture 20 27 25 questions directly from the first two exams. Key for exam

More information

Supplementary Information. Drought response transcriptomics are altered in poplar with reduced tonoplast sucrose transporter expression

Supplementary Information. Drought response transcriptomics are altered in poplar with reduced tonoplast sucrose transporter expression Supplementary Information Drought response transcriptomics are altered in poplar with reduced tonoplast sucrose transporter expression Liang Jiao Xue, Christopher J. Frost, Chung Jui Tsai, Scott A. Harding

More information

Keywords: CGMS, combining ability, fertility restoration, heterosis, pigeonpea. Introduction

Keywords: CGMS, combining ability, fertility restoration, heterosis, pigeonpea. Introduction Sri Lanka Journal of Food and Agriculture (2015) Byregowda et al. 1(2): 1-8 ISSN 2424-6913 Research Paper Identification of fertility restorers, stable combiners and heterotic combinations across environments

More information

Horizontal gene transfer from trees to ectomycorrhizal fungi: Lessons from laboratory and host plant liberation experiments

Horizontal gene transfer from trees to ectomycorrhizal fungi: Lessons from laboratory and host plant liberation experiments Horizontal gene transfer from trees to ectomycorrhizal fungi: Lessons from laboratory and host plant liberation experiments Dr. Uwe Nehls 1,2, Dr. Chi Zhang 1, Dr. Mika Tarkka 1, Andrea Bock 1 1: University

More information

Mapping forests in monsoon Asia with ALOS PALSAR 50-m mosaic images and MODIS

Mapping forests in monsoon Asia with ALOS PALSAR 50-m mosaic images and MODIS 1 Supplementary Information 2 3 Mapping forests in monsoon Asia with ALOS PALSAR 50-m mosaic images and MODIS imagery in 2010 4 5 6 7 8 9 10 11 Yuanwei Qin, Xiangming Xiao, Jinwei Dong, Geli Zhang, Partha

More information

. Supplementary Information

. Supplementary Information . Supplementary Information Supplementary Figure S1. Mature embryo sac observations. Supplementary Figure S2. STT observations. Supplementary Figure S3. Comparison of the PTB1 cdna with that of the mutant.

More information

Ryuji Yamada Tokyo Climate Center Japan Meteorological Agency E mail: URL:

Ryuji Yamada Tokyo Climate Center Japan Meteorological Agency E mail: URL: Ryuji Yamada Tokyo Center Japan Meteorological Agency E mail: tcc@met.kishou.go.jp URL: http://ds.data.jma.go.jp/tcc/tcc/index.html Tokyo Center (TCC) Established in April 2002 at JMA to support climate

More information

Maize Genetics Cooperation Newsletter Vol Derkach 1

Maize Genetics Cooperation Newsletter Vol Derkach 1 Maize Genetics Cooperation Newsletter Vol 91 2017 Derkach 1 RELATIONSHIP BETWEEN MAIZE LANCASTER INBRED LINES ACCORDING TO SNP-ANALYSIS Derkach K. V., Satarova T. M., Dzubetsky B. V., Borysova V. V., Cherchel

More information

CMY. SCIENCE (CHEMISTRY) See C. P. B.Sc. Hons., Dip.Ed. A. B. Terence B.Sc., M.Ed., M.A. (IDT), PGDE

CMY. SCIENCE (CHEMISTRY) See C. P. B.Sc. Hons., Dip.Ed. A. B. Terence B.Sc., M.Ed., M.A. (IDT), PGDE 02 OL QEN Sci Chemistry ttp_b&w.pdf 1 26/9/2017 10:56:41 AM C M Y CM MY CY CMY K SCIENCE (CHEMISTRY) See C. P. B.Sc. Hons., Dip.Ed. A. B. Terence B.Sc., M.Ed., M.A. (IDT), PGDE Quick Exam Notes SCIENCE

More information

Gene Action and Combining Ability in Rice (Oryza sativa L.) Involving Indica and Tropical Japonica Genotypes

Gene Action and Combining Ability in Rice (Oryza sativa L.) Involving Indica and Tropical Japonica Genotypes International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 7 (2017) pp. 8-16 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.607.002

More information

By Geri Flanary To accompany AP Human Geography: A Study Guide 3 rd edition By Ethel Wood

By Geri Flanary To accompany AP Human Geography: A Study Guide 3 rd edition By Ethel Wood Session 1 By Geri Flanary To accompany AP Human Geography: A Study Guide 3 rd edition By Ethel Wood WHAT IS DEMOGRAPHY? It is the scientific or statistical study of population. It comes from the Greek

More information

Plant Molecular and Cellular Biology Lecture 10: Plant Cell Cycle Gary Peter

Plant Molecular and Cellular Biology Lecture 10: Plant Cell Cycle Gary Peter Plant Molecular and Cellular Biology Lecture 10: Plant Cell Cycle Gary Peter 9/10/2008 1 Learning Objectives Explain similarities and differences between fungal, mammalian and plant cell cycles Explain

More information

Curriculum Links. AQA GCE Biology. AS level

Curriculum Links. AQA GCE Biology. AS level Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2

More information

QTL Analysis of Yield-related Traits using an Advanced Backcross Population Derived from Common Wild Rice (Oryza rufipogon L)

QTL Analysis of Yield-related Traits using an Advanced Backcross Population Derived from Common Wild Rice (Oryza rufipogon L) Research Article Molecular Plant Breeding 2010, Vol.1 No.1 Open Access QTL Analysis of Yield-related Traits using an Advanced Backcross Population Derived from Common Wild Rice (Oryza rufipogon L) Zhaobin

More information

DROUGHT is one of the major abiotic stresses

DROUGHT is one of the major abiotic stresses Copyright Ó 2006 by the Genetics Society of America DOI: 10.1534/genetics.105.045062 Genetic Basis of Drought Resistance at Reproductive Stage in Rice: Separation of Drought Tolerance From Drought Avoidance

More information

Similar traits, different genes? Examining convergent evolution in related weedy rice populations

Similar traits, different genes? Examining convergent evolution in related weedy rice populations University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Publications from USDA-ARS / UNL Faculty U.S. Department of Agriculture: Agricultural Research Service, Lincoln, Nebraska

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/345/ra91/dc1 Supplementary Materials for TGF-β induced epithelial-to-mesenchymal transition proceeds through stepwise activation of multiple feedback loops Jingyu

More information

Report of the Research Coordination Meeting Genetics of Root-Knot Nematode Resistance in Cotton Dallas, Texas, October 24, 2007

Report of the Research Coordination Meeting Genetics of Root-Knot Nematode Resistance in Cotton Dallas, Texas, October 24, 2007 Report of the Research Coordination Meeting Genetics of Root-Knot Nematode Resistance in Cotton Dallas, Texas, October 24, 2007 Participants: Frank Callahan, Peng Chee, Richard Davis, Mamadou Diop, Osman

More information

Heredity and Genetics WKSH

Heredity and Genetics WKSH Chapter 6, Section 3 Heredity and Genetics WKSH KEY CONCEPT Mendel s research showed that traits are inherited as discrete units. Vocabulary trait purebred law of segregation genetics cross MAIN IDEA:

More information

Relationship Between Coleoptile Length and Drought Resistance and Their QTL Mapping in Rice

Relationship Between Coleoptile Length and Drought Resistance and Their QTL Mapping in Rice Rice Science, 2007, 14(1): 13-20 Copyright 2007, China National Rice Research Institute. Published by Elsevier BV. All rights reserved Relationship Between Coleoptile Length and Drought Resistance and

More information

The geneticist s questions

The geneticist s questions The geneticist s questions a) What is consequence of reduced gene function? 1) gene knockout (deletion, RNAi) b) What is the consequence of increased gene function? 2) gene overexpression c) What does

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION VOLUME: 1 ARTICLE NUMBER: 0119 In the format provided by the authors and unedited. Young inversion with multiple linked QTLs under selection in a hybrid zone Cheng-Ruei Lee 1, 2, Baosheng Wang 1,3, Julius

More information

Awide range of natural variation for flowering time

Awide range of natural variation for flowering time Copyright Ó 2006 by the Genetics Society of America DOI: 10.1534/genetics.105.050500 Substitution Mapping of dth1.1, a Flowering-Time Quantitative Trait Locus (QTL) Associated With Transgressive Variation

More information

Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach

Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach ABSTRACT SUBMITTED TO JAMIA MILLIA ISLAMIA NEW DELHI IN PARTIAL FULFILMENT OF

More information

Development of specific simple sequence repeat (SSR) markers for non-pollen type thermo-sensitive genic male sterile gene in rice (Oryza sativa L.

Development of specific simple sequence repeat (SSR) markers for non-pollen type thermo-sensitive genic male sterile gene in rice (Oryza sativa L. African Journal of Biotechnology Vol. 10(73), pp. 16437-16442, 21 November, 2011 Available online at http://www.academicjournals.org/ajb DOI: 10.5897/AJB11.2401 ISSN 1684 5315 2011 Academic Journals Full

More information

Identification of interspecific grain yield heterosis between two cultivated rice species Oryza sativa L. and Oryza glaberrima Steud.

Identification of interspecific grain yield heterosis between two cultivated rice species Oryza sativa L. and Oryza glaberrima Steud. AJCS 6(11):1558-1564 (2012) ISSN:1835-2707 Identification of interspecific grain yield heterosis between two cultivated rice species Oryza sativa L. and Oryza glaberrima Steud. Adedze Y.M. Nevame 1, Efisue

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/331/6019/876/dc1 Supporting Online Material for Synthetic Clonal Reproduction Through Seeds Mohan P. A. Marimuthu, Sylvie Jolivet, Maruthachalam Ravi, Lucie Pereira,

More information

International Student Enrollment Fall 2018 By CIP Code, Country of Citizenship, and Education Level Harpur College of Arts and Sciences

International Student Enrollment Fall 2018 By CIP Code, Country of Citizenship, and Education Level Harpur College of Arts and Sciences International Student Enrollment Fall 2018 By CIP Code, Country of Citizenship, and Education Level Harpur College of Arts and Sciences CIP Code Description Citizenship Graduate Undergrad Total 00.0000

More information