Natural variation at the DEP1 locus enhances grain yield in rice

Transcription

1 LETTERS Natural variation at the DEP1 locus enhances grain yield in rice Xianzhong Huang 1,6, Qian Qian 2,6, Zhengbin Liu 1, Hongying Sun 1, Shuyuan He 1,DaLuo 3, Guangmin Xia 4, Chengcai Chu 5, Jiayang Li 5 & Xiangdong Fu Nature America, Inc. All rights reserved. Grain yield is controlled by quantitative trait loci (QTLs) derived from natural variations in many crop plants. Here we report the molecular characterization of a major rice grain yield QTL that acts through the determination of panicle architecture. The dominant allele at the DEP1 locus is a gain-of-function mutation causing truncation of a phosphatidylethanolamine-binding protein-like domain protein. The effect of this allele is to enhance meristematic activity, resulting in a reduced length of the inflorescence internode, an increased number of grains per panicle and a consequent increase in grain yield. This allele is common to many Chinese high-yielding rice varieties and likely represents a relatively recent introduction into the cultivated rice gene pool. We also show that a functionally equivalent allele is present in the temperate cereals and seems to have arisen before the divergence of the wheat and barley lineages. Rice is one of mankind s major food staples. Given continuing population growth and increasing competition for arable land between food and energy crops, food security is becoming an ever more serious global problem. Improving crop productivity by selection for the components of grain yield and for optimal plant architecture has been the key focus of national and international rice breeding programs 1 3. Since the 1980s, a number of high-yielding japonica rice strains, whose architecture is characterized by dense and erect panicles, have been released as commercial varieties 4.InChina,examplesofthis japonica ideotype, such as Shennong 265 and Jiahua 1, have dominated the japonica rice acreage 5. Grain yield in rice represents the multiplicative integration of three main components (panicle number per plant, grain number per panicle and mean grain weight) 6.Theavailabilityof molecular marker based genetic maps has allowed hundreds of yield QTL to be detected 3,6. However, the way in which any of these QTL regulates grain productivity remains largely unknown. In recent years, several genes known as QTLs related to grain yield have been isolated by positional cloning However, only a few of them have been functionally characterized, such as Gn1a, a QTL for number of grain per panicle 8. The erect panicle type of leading highyielding japonica varieties is under the control of one major gene, which is modified by a number of other genes 13. Recently, a QTL responsible for erect panicle trait, qpe9-1, was mapped to chromosome 9 (refs. 14,15), but the candidate gene for the erect panicle trait has not yet been identified. Using mapping populations based on a cross between Shennong 265 and the non-erect type varieties, such as Nanjing 11 and Nipponbare, it has been shown that both a QTL for grain number per panicle and a QTL for panicle density are located in the region of chromosome 9 defined by the molecular markers RM3700 and RM7424, respectively (Fig. 1a, data not shown), which coincides with the location of qpe9-1 (ref. 15). Thus, it seems possible that a single locus, which we refer to as DENSE AND ERECT PANICLE1 (DEP1), is pleiotropically responsible for all three traits (dense panicle, high grain number per panicle and erect panicle). We have set out to fine map (the mutant DEP1 allele) by exploiting a large segregating F 2 population. This exercise narrowed its genetic location to an approximately 85-kb segment of the BAC AP between newly developed markers S2 and S11-2 (Fig. 1b and Supplementary Table 1 online). This region contains 15 predicted genes, but sequence comparisons involving the region from the mapping parents and Nipponbare showed that only one of these (LOC_Os09g26999) was polymorphic. Specifically, the variant involves the replacement of a 637-bp stretch of the middle of exon 5 by a 12-bp sequence, which has the effect of creating a premature stop codon and consequently a loss of 230 residues from the C terminus (Fig. 1c and Supplementary Fig. 1a online). DEP1 encodes a previously unknown PEBP (phosphatidylethanolamine-binding protein) like domain protein sharing some homology with the N terminus of GS3 (Supplementary Fig. 1b), a gene recently identified as being a key QTL for grain size in rice 9. All transgenic Shao 313 (NIL-) individuals carrying a pdep1: RNAi-DEP1 construct had curved panicles, elongated inflorescence internodes and fewer grains per panicle (Supplementary Fig. 2a 1 The State Key Laboratory of Plant Cell and Chromosome Engineering, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, National Centre for Plant Gene Research, Beijing, China. 2 The State Key Laboratory of Rice Biology, China National Rice Research Institute, Hangzhou, China. 3 Shanghai Institute of Plant Physiology and Ecology, Chinese Academy of Sciences, Shanghai, China. 4 College of Life Sciences, Shandong University, Jinan, China. 5 The State Key Laboratory of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing, China. 6 These authors contributed equally to this work. Correspondence should be addressed to X.F. (xdfu@genetics.ac.cn). Received 21 August 2008; accepted 12 January 2009; published online 22 March 2009; doi: /ng.352 NATURE GENETICS ADVANCE ONLINE PUBLICATION 1

2 LETTERS 2009 Nature America, Inc. All rights reserved. a b c RM444 4 S3 S13 S2 S7 6 AP n = 1, kb AP AP ATG ATG RM kb AP S9 C1 S11-2 RM7424 RM7048 RM257 RM242 C2 S5 625-bp deletion online). Transgenic Shao 314 (NIL-DEP1) plants expressing mutant DEP1 allele () under the control of its native promoter had a semidwarf stature (Fig. 2a), but had the same erect panicle as Shao 313 plants, along with an increased number of grains per panicle, shorter inflorescence internodes, and an increased number of both primary and secondary panicle branches (Supplementary Fig. 2b,c). In contrast, transgenic Shao 314 plants carrying a pdep1:dep1 construct showed no noticeable change in panicle architecture (Supplementary Fig. 2d). All the transgenic Nipponbare plants, in which was constitutively expressed under the control of a rice actin1 promoter, were severely dwarfed (Supplementary Fig. 2e) with erect panicles (data not shown), whereas Actin:DEP1 plants were unchanged with respect to either panicle size or plant architecture (Supplementary Fig. 2f). Thus, we concluded that acts as a dominant negative regulator of panicle architecture and grain number. To elucidate the cellular localization of DEP1, we fused green fluorescence protein (GFP) to the C terminus of both DEP1 and, and introduced the gene fusions into Nipponbare and Shao 314. GFP expression was detectable in the nuclei of both DEP1 and carriers (Fig. 2b and Supplementary Fig. 3a online). In NIL- plants, expression was present in the root, leaf, culm, inflorescence meristem and young inflorescence, with the highest expression in the inflorescence meristem at the stage of primary and secondary rachis branch formation (Fig. 2c and Supplementary Fig. 3b). In DEP1:GUS transgenic plants, expression was strong both in the inflorescence meristem and in the intercalary meristem (Supplementary Fig. 3c). Although DEP1 transcript abundance was reduced in NIL-DEP1 (Supplementary Fig. 3d), neither real-time PCR analysis nor an in situ hybridization analysis was able to highlight any clear differences RM088 RM n = Mb RM308 Tag atcctttttt premature stop TGA RM7424 DEP1 Figure 1 Positional cloning of. (a) The gene was mapped to the interval between the molecular marker RM3700 and RM7424 on rice chromosome 9 on the basis of the genotyping of 210 F 2 segregants. (b) The gene was further delimited to a B85-kb genomic region on Nipponbare BAC AP using 1,311 F 2 segregants. The number below line indicates the number of recombinants between DEP1 and the adjacent marker. An arrow indicates the site of predicted genes in the S2 to S11-2 interval. (c) Allelic variation of the DEP1 sequence. between the tissues specificity of expression profiles of NIL-DEP1 and NIL- plants (data not shown). During reproductive development, DEP1 was preferentially expressed on the adaxial side of the bract primordium, as well as in the bract primordia of primary and secondary rachis-branches. Within the inflorescence meristem, DEP1 was expressed weakly in the carpel and stamen primordia, with patchy expression in the lemma and palea (Supplementary Fig. 3e). Close examination of the shoot apex meristem (SAM) showed that the SAM of NIL- plants was larger than that of NIL-DEP1 plants (Fig. 2d and Supplementary Table 2 online). Following the transition to the reproductive phase, NIL- plants generated a greater number of inflorescence and panicle meristems, and hence developed a higher number of grains, and the same trends were observed among transgenic plants expressing. The number of root meristematic cells was stimulated by the presence of the Actin: construct (Supplementary Fig. 4 online). Cells in the uppermost internode of the mature NIL- culm were shorter than those in NIL-DEP1 plants (Fig. 2e). At the same time, cell number across the longitudinal axis of NIL- plants was higher than in NIL-DEP1 plants (Fig. 2f). Taken together, these observations suggest that the allele enhances meristematic activity and promotes cell proliferation. The activity of axillary meristem in the shoot apex is important for the determination of the extent of panicle branching and hence grain number LAX, FZP and RCN1 have been shown to be among the genes involved in the control of axillary meristem initiation and development There was no significant difference in the a c d NIL-DEP1 NIL-DEP1 pdep1: b C R LB LS SAM RM BM SM FL actin1 Figure 2 DEP1 expression and its effect on cell proliferation. (a) A transgenic Shao 314 plant expressing under the control of its native promoter has a semidwarf stature. Scale bar, 20 cm. (b) The -GFP fusion protein is present within the nucleus. Scale bar, 50 mm. (c) Expression of in various organs and different stages of inflorescences development. C, culm; R, root; LB, leaf blade; LS, leaf sheath; SAM, shoot apex meristem; RM, rachis meristem; BM, branch meristem; SM, spikelet meristem; FL, floral meristem. Rice actin1 was used as a control. (d) Close-up of the shoot apex meristem. Scale bar, 50 mm. (e) Longitudinal section of the uppermost internodes B2 cm above the highest node of the main culm of a mature plant. Outer to inner (left to right). Scale bar, 50 mm. (f) Cell number across the longitudinal axis is higher in NIL- plants. Data are given as mean ± s.e.m. (n ¼ 12 plants). e NIL- NIL- NIL-DEP1 f Cell number of stem in longitudinal axis NIL-DEP NIL- NIL-DEP1 2 ADVANCE ONLINE PUBLICATION NATURE GENETICS

3 LETTERS 2009 Nature America, Inc. All rights reserved. a No. of tillers per plant Figure 3 The phenotype of NIL- plants. (a) Dense and erect panicle. b c 300 P = 8.1E 09 NIL- NIL-DEP1 NIL- NIL-DEP1 0 NIL- NIL-DEP1 d 18 P = 0.06 e P = 1.4E 04 f P = 2.4E No. of secondary branches NIL- NIL-DEP1 Panicle length (cm) NIL- NIL-DEP1 NIL- NIL-DEP1 NIL- NIL-DEP1 g 60 P = 2.0E 10 h 40 P = 7.4E 05 i 50 P = 2.8E 08 transcriptional level of any of these three genes between NIL-DEP1 and NIL- plants (Supplementary Fig. 5a c online). Gn1a, a major grain number QTL, encodes a cytokinin oxidase/dehydrogenase, and has been implicated in the regulation of meristematic activity, panicle branching and grain number through its effect on the level of cytokinin 8.InNIL- plants, the gene was clearly downregulated (Supplementary Fig. 5d). Interesting, a NIL-Gn1a line had the same number of primary branches as the control line but developed more secondary branches 6,8. This suggests that genetically controls the number of both primary branches and secondary branches on primary branches at the panicle top, whereas Gn1a regulates the number of secondary branches on primary branches at the panicle base. To investigate whether allelic constitution at the DEP1 locus affects grain yield, we compared DEP1 and NIL line field performance (Fig. 3a c). The lines did not differ from one another with respect to a DEP1 TaDEP1 HvDEP1 TuDEP1 DEP1 TaDEP1 HvDEP1 TuDEP1 DEP1 TaDEP1 HvDEP1 TuDEP1 DEP1 TaDEP1 HvDEP1 TuDEP1 DEP1 TaDEP1 HvDEP1 TuDEP1 1,000-grain weight (g) NIL- NIL-DEP1 No. of grains per panicle No. of primary branches Grain yield per plant (g) NIL- NIL-DEP1 Scale bar, 4 cm. (b) Increased panicle branching and reduced rachis length. Scale bar, 4 cm. (c i) Comparison of panicle architecture. (c) Number of grains per panicle. (d) Number of culms.(e) Panicle length. (f) Number of primary branches per panicle. (g) Number of secondary branches per panicle. (h) 1,000-grain weight. (i) Grain yield per plant. The NIL plants were grown in standard paddy field with a distance of cm under conventional cultivation conditions. All data are given as mean ± s.e.m. (n ¼ 36 plants). A Student s t-test was used to generate the P values. either the heading date, the length of the grain-filling period or culm number (Fig. 3d). However, grain number per main panicle was significantly higher in the presence of (Fig. 3c), and there were clear differences in panicle architecture, inflorescence internode and panicle length (Fig. 3b,e), and the number of both primary (Fig. 3b,f) and secondary (Fig. 3g) branches per panicle. Increasing the number of grains can be associated with incomplete grain filling, but there was no evidence for grain-filling failure in the presence of. The 1,000-grain weight of NIL- plants was slightly less than that of NIL-DEP1 plants (Fig. 3h), but the overall grain yield per plant under field conditions was increased (+40.9%) (Fig. 3i). The vascular system of NIL- plants appeared rather better developed and their sclerenchyma cell walls were thicker at maturity than those in NIL-DEP1 plants (Supplementary Fig. 6 online). These traits are favorable for both water transport capacity and the mechanical strength of the stem, both of which are important factors for the breeding of high-yielding, lodging-resistant varieties. We tested the effect of on grain yield in an indica background by backcrossing the segment present in the japonica variety Wuyunjing 7 into the indica variety Zhefu 802. This NIL, ZF 802 (), produced more grains per panicle and out-yielded its recurrent parent (Supplementary Fig. 7 online). Thus, is a useful allele for increasing grain yield in rice. Pedigree records show that many high-yielding Chinese japonica varieties, including Shennong 265, were derived from the Italian land race Balilla 13,15, which was extensively cultivated in Italy in the 1970s and introduced into China in 1958 (ref. 15). The allelic constitution at the DEP1 locus was explored by resequencing from a panel of widely cultivated Chinese varieties (69 japonica and 83 indica). This truncated mutation was present in Balilla and all 36 japonica types having an erect or semierect panicle, including super high-yielding cultivars Liaojing 5 and Qianchonglang, but it was absent from all the other varieties. Thus, this natural allelic variation in DEP1 has clearly been b JM21 JM21 empty vector JM21 pubi:rnai-tadep1 c Length of ear (cm) JM21 JM21 empty vector JM21 pubi:rnai-tadep1 Figure 4 DEP1 homologs among the small-grained cereals. (a) A phylogenetic analysis, in which identical and conserved residues are indicated by dark gray boxes and variant residues by light gray boxes. (b,c) Comparison of ear length and structure between transgenic wheat plants carrying pubi-rnai-tadep1 and wild-type controls. Scale bar, 7 cm. Data are given as mean ± s.e.m. (n ¼ 20 plants). NATURE GENETICS ADVANCE ONLINE PUBLICATION 3

4 LETTERS 2009 Nature America, Inc. All rights reserved. exploited by japonica breeding programs in China. Several sequence variants at the DEP1 C terminus were present in the sample of indica types. The variety differed from the japonica variety Nipponbare by three amino acids, whereas that of the variety Teqing differed by two amino acids (Supplementary Fig. 8 online). The Nipponbare sequence differed from that of an accession of Oryza rufipogon by one nucleotide at position 663, but this did not produce a variant peptide. We investigated the structure of the homologs of DEP1 in other smallgrain cereals. Several truncated C-terminal deletions were observed in barley, and in bread wheat and its diploid wild progenitor Triticum urartu (Fig. 4a). To determine whether any novel gain-of-function was induced by the presence of these truncated genes, we generated a number of transgenic wheat plants carrying a pubi:rnai-tadep1 construct. The consequent downregulation of TaDEP1 resulted in an increase in the length of the ear, a less compact ear and a somewhat reduced number of spikelets (Fig. 4b,c). This suggests that a functionally equivalent mutation may have occurred early in the divergence of the wheat and barley lineages. Grain yield is heavily influenced by the architecture of the inflorescence. However, little is as yet known concerning the genetic control of this trait complex in crops. The identification of the DEP1 locus offers prospects for gaining a deeper understanding of the molecular basis of panicle branching in rice. As a key regulator of grain number, the DEP1 locus (and perhaps also its homologs in other small-grain cereals) may provide a means of manipulating grain yield in these crucial crops. METHODS Plant materials. The germplasm panel consisted of 83 indica (O. sativa L. ssp. indica), 69 japonica (ssp. japonica) varieties and one accession of common wild rice (O. rufipogon). Detailed information is given in Supplementary Methods online. Fine mapping of. Two F 2 populations were bred from the japonica indica crosses (Q and W101 NJ 6). The 1,521 segregating individuals with non-erect panicles at maturity were genotyped to identify the homozygous recombination plants for DEP1. Details of the markers used for genotyping are given in Supplementary Table 1. The genomic location of the DEP1 locus was defined by the two molecular markers S2 and S11-2. A search for candidates for was carried out by comparing the genomic DNA sequences of W101, Q169, 93-11, NJ 6 and Nipponbare. Vector construction and plant transformation. DNA fragments 2 kb upstream of the DEP1 transcription start site and 900 bp downstream of its termination site were amplified and cloned into the binary vector pcambia1300 to generate the pdep1:3 -UTR expression cassette. Full-length and DEP1 cdna were separately inserted into the binary vectors pdep1:3 -UTR, pcamv 35S: NOS and pactin:ocs. A pdep1: RNAi-DEP1 construct was based on the sequence of a 300-bp fragment of the N terminus of the DEP1 cdna sequence, which shows no significant homology with any other sequences in the rice genome. A 250-bp fragment was amplified from the bread wheat variety Ni to generate the construct pubi: RNAi-TaDEP1. Transgenic lines of wheat and rice were created by Agrobacterium-mediated transformation 22,23. The relevant PCR primer sequences are given in Supplementary Table 3 online. Transcript analysis. We extracted total RNA with the Trizol reagent (Invitrogen). Semiquantitative RT-PCR and RT-Southern blot analysis were done as described elsewhere 24. The reaction was terminated after 22 cycles and used rice actin1 as an internal control. Real-time PCR was done as described previously 25. All assays were repeated at least three times. Relevant PCR primer sequences are given in Supplementary Tables 4 and 5 online. Accession codes. GenBank: full-length DEP1 cdna, FJ039905; DEP1 genomic DNA, FJ039904; full-length TaDEP1 cdna, FJ039902; full-length HvDEP1 cdna, FJ Note: Supplementary information is available on the Nature Genetics website. ACKNOWLEDGMENTS We thank N. Harberd and Y. Xue for their critical comments. This research was supported by grants from the Ministry of Science and Technology of China (2009CB941501, 2007AA10Z190 and 2006AA10A101), Chinese Academy of Sciences (KSCX2-YW-N-050) and National Natural Science Foundation of China. AUTHOR CONTRIBUTIONS X.H. performed most of the experiments; Q.Q. conducted the QTL analysis and developed the NILs; Z.L and H.S. helped X.H. with analysis of field experiments; S.H. characterised transgenic wheat plants; D.L. conducted in situ hybridization experiments; G.X. performed wheat transformation and C.C. rice transformation; J.L. and X.F. supervised the study; X.F. designed the experiments and wrote the manuscript. All the authors discussed the results and contributed to the manuscript. Published online at Reprints and permissions information is available online at reprintsandpermissions/ 1. Yuan, L. Hybrid rice breeding for super high yield. Hybrid Rice 12, 1 6 (1997). 2. Khush, G.S. Green revolution: preparing for the 21st century. Genome 42, (1999). 3. Zhang, Q. Strategies for developing green super rice. Proc. Natl. Acad. Sci. USA 104, (2007). 4. Yang, S. et al. The primary discussion on the theories and methods of the ideotype breeding of rice. Acta Agron. Sin. 17, 6 13(1984). 5. Xu, Z., Zhang, W., Zhang, L. & Yang, S. Creation of new plant type and breeding rice for super high yield. Acta Agron. Sin 27, (2001). 6. Sakamoto, T. & Matsuoka, M. Identifying and exploiting grain yield genes in rice. Curr. Opin. Plant Biol. 11, (2008). 7. Li, X. et al. Control of tillering in rice. Nature 422, (2003). 8. Ashikari, M. et al. Cytokinin oxidase regulates rice grain production. Science 309, (2005). 9. Fan, C. et al. GS3, a major QTL for grain length and weight and minor QTL for grain width and thickness in rice, encodes a putative transmembrane protein. Theor. Appl. Genet. 112, (2006). 10. Song, X. et al. A QTL for rice grain width and weight encodes a previously unknown RING-type E3 ubiquitin ligase. Nat. Genet. 39, (2007). 11. Xue, W. et al. Natural variation in Ghd7 is an important regulator of heading date and yield potential in rice. Nat. Genet. 40, (2008). 12. Shomura, A. et al. Deletion in a gene associated with grain size increased yields during rice domestication. Nat. Genet. 40, (2008). 13. Xu, Z. et al. The heredity of the erect character and relation with other characters in rice. J. Shenyang Agric. Univ. 26, 1 7 (1995). 14. Kong, F. et al. Molecular tagging and mapping of the erect panicle gene in rice. Mol. Breed. 19, (2007). 15. Yan, C. et al. Identification and characterization of a major QTL responsible for erect panicle trait in japonica rice (Oryza sativa L.). Theor. Appl. Genet. 115, (2007). 16. Rao, N.N., Prasad, K., Kumar, P.R. & Vijayraghavan, U. Distinct regulatory role for RFL, the rice LFY homolog, in determining flowering time and plant architecture. Proc. Natl. Acad. Sci. USA 105, (2008). 17. Kellogg, E.A. Floral displays: genetic control of grass inflorescences. Curr. Opin. Plant Biol. 10, (2007). 18. Kurakawa, T. et al. Direct control of shoot meristem activity by a cytokinin activating enzyme. Nature 445, (2007). 19. Komastu, K. et al. LAX and SPA: major regulators of shoot branching in rice. Proc. Natl. Acad. Sci. USA 100, (2003). 20. Komastu, M. et al. FRIZZY PANICLE is required to prevent the formation of axillary meristems and to establish floral meristem identity in rice spikelets. Development 130, (2003). 21. Nakagawa, M., Shimamoto, K. & Kyozuka, J. Overexpression of RCN1 and RCN2, rice TERMINAL FLOWER 1/CENTRORADIALIS homologs, confers delay of phase transition and altered panicle morphology in rice. Plant J. 19, (2002). 22. Hiei, Y., Ohta, S., Komari, T. & Kumashiro, T. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J. 6, (1994). 23. Zhao, T. et al. Transgenic wheat progeny resistant to powdery mildew generated by Agrobacterium inoculum to the basal portion of wheat seedling. Plant Cell Rep. 25, (2006). 24. Fu, X. et al. Expression of Arabidopsis GAI in transgenic rice represses multiple gibberellin responses. Plant Cell 13, (2001). 25. Jiang, C. et al. Root architecture and anthocyanin accumulation of phosphate starvation responses are modulated by the GA-DELLA signaling pathway in Arabidopsis. Plant Physiol. 145, (2007). 4 ADVANCE ONLINE PUBLICATION NATURE GENETICS

5 Supplementary information Natural variation at the DEP1 locus enhances grain yield in rice Xianzhong Huang, Qian Qian, Zhengbin Liu, Hongying Sun, Shuyuan He, Da Luo, Guangmin Xia,Chengcai Chu, Jiayang Li & Xiangdong Fu Supplementary Methods Plant materials. The japonica varieties Shennong 265, Wuyunjing 7, Q169 and W101 carry the allele and have dense and erect panicles; the japonica varieties Nipponbare, Zhonghua 11 and Shao 314 have a drooping panicle at maturity. The Wuyunjing 7 x Shao 314 F 1 was backcrossed eight times with Shao 314 to generate the near-isogenic line Shao 313 (NIL-), and a NIL was generated by the same means in the background of the indica variety Zhefu 802 (ZF 802). Wheat transformation. The construct pubi:rnai-tadep1 was introduced into the Agrobacterium strain AGL1, and Agrobacterium-mediated transformation of the bread wheat variety JM 21 was performed as described previously 1. Transformation with an empty vector served as control. Field cultivation of rice. The rice plants were grown in a standard paddy field at the Experimental Station of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing. Seeds were germinated in a seed bed in late April, and transplanted to the field in late May. For yield potential evaluation, NIL- and NIL-DEP1 plants were grown in the paddy field by transplanting one plant per hill at a distance of cm under conventional cultivation conditions. All phonotypical data were measured from 36 NIL- or NIL-DEP1 plants, respectively. The 1

6 experiments were repeated in 2006 and RNA in situ hybridization. The full length DEP1 coding region was cloned into pbluescript SK(+) and linearized for use as a template for the synthesis of digoxigenin-labelled sense and anti-sense RNA probes. Tissue fixation and in situ hybridisation procedures were performed as described elsewhere 2. GUS staining. Rice tissue was collected and incubated at 37ºC in 0.5mg/mL 5-bromo-4-chloro-3-indolyl-D-glucuronide, 100mM sodium phosphate, ph 7.0 for 4h. The stained samples were photographed with a Leica MZ16FA stereomicroscope with Leica IM50 software. Detection of GFP fluorescence. Root tips were sectioned longitudinally, stained with 2μg/mL propidium iodide, 30mM 2-N-morpholino-ethanesulphonic acid and 100mM mannitol, ph 5.9 for 30min. GFP fluorescence was detected by Olympus laser confocal microscopy, as described previously 3. Sequence and phylogenetic analysis. Sequences were obtained from a BLAST search within the GenBank database. Total RNA was extracted using the Trizol reagent (Invitrogen) from various tissues of the barley variety Herta, the bread wheat variety Ni and the wild diploid wheat Triticum urartu. Reverse transcription was carried out using the AMV Reverse Transcriptase kit (Promega), PCR products were cloned into pgem-t vector (Promega) and sequenced using SP6 and T7 primers. Full-length cdnas were generated by 5 and 3 RACE (Clontech). The sequences were aligned using CLUSTALW ( The sequences of the primers are listed in Supplementary Table 4. Reference 2

7 1. Zhao, T. et al. Transgenic wheat progeny resistant to powdery mildew generated by Agrobacterium inoculum to the basal portion of wheat seedling. Plant Cell Rep. 25, (2006). 2. Coen, E. S. et al. Floricaula: a homeotic gene required for flower development in antirrhinum majus. Cell 63, (1990). 3. Fu, X. & Harberd, N. P. Auxin promotes Arabidopsis root growth by modulating gibberellin response. Nature 421, (2003). 3

8 Supplementary Tables Supplementary Table 1 Markers used for mapping of Marker type Forward primers (5-3 ) Reverse primers (5-3 ) Restriction enzymes RM RM3700 RM7424 RM7048 RM257 RM242 RM160 S3 S13 S2 S7 S9 C1 S11-2 C2 S5 RM088 RM308 SSR SSR SSR SSR SSR SSR SSR CAPS CAPS gctccacctgcttaagcatc cgagctaggtatgccacact aaatgccccatgcacaac agaagcccatctagcagcag caacccctaatttcacgctc cagttccgagcaagagtactc ggccaacgtgtgtatgtctc agctagcagctatagcttagctggagatcg tcatacgctaatggctcatctcg gaagtaggagctgccgtgtc cttcaactgcctgcgagaccacc agtttcttggtttccgatca tggacacttgttatcttctcat tcagctcagcttcagaacga taagccgatgattactccagac tcctccttccctacatccatc gaaagcatacggatgccaat aaatgcagggaagcaacagt cgccacactaccggtgtttctttat tgaagaccatgttctgcagg gatcggctatagatgaattgg ttgtcagattgtcaccaggg tcaagctagccacacagctg gacttcactggcactggatg ggatcggacgtggcatatg tatatgccaagacggatggg tctcatcgccatgcgaggcctc ccgtccatggtgttcaagatttt gaagtaggagctgccgtgtc gcttgactgacataatgccgcta catattggaatgctccctcct aactggaagtttgtaacactca agcggaggaaaggaaaggta gttcatttaaagaagtcctcaccg cccaatctagccaaatccaa tcatgtttgctgggtgacat tcagcatgcacgtctgataa cccatgcgcgcatggcaaattttat Hae III Taq I SSR: microsatellite, : sequence tagged site, CAPS: Cleaved amplified polymorphism Supplementary Table 2 Size of the shoot apex meristem is enhanced in three month old NIL- plants Width (µm) Height (µm) Height/width Shao 313 (NIL-) 233 ± ± Shao 314 (NIL-DEP1) ± ±

9 Supplementary Table 3 Primer sequences used to generate DNA constructs Name Forward (5-3 ) Reverse (5-3 ) 3 -UTR of Dep1 Promoter of Dep1 DEP1 cdna Dep1 cdna RNAi-Dep1 RNAi-TaDEP1 ctgcagtcgtaacccatgctgtctca gaattcgtctctcagtgagccgttcc actagtatgggggaggaggcggtggtgatgctcga actagtatgggggaggaggcggtggtgatgctcga gctcgaggcgagatcacgttcctcaag ggactagtatgggggagggcgcggtggtggt aagctttggcgagtaaatgagtccaa ggatcctcatgggcattatagcagca tctagagtcgactcaacataagcaaccactgaga tctagagtcgacctagatgttgaagcaggtgcag actagttgcagtttggcttacagcat agatctgcttccttttgttaattggtattagcgg Supplementary Table 4 Primer sequences used for transcript analysis and DNA constructs Name Forward (5-3 ) Reverse (5-3 ) TaDEP1 HvDEP1 TuDEP1 ggatccatgggggagggcgcggtggt tctagaatgggggagggcgcggtggt ggatccatgggggagggcgcggtggt gtcgacttaacacaggcacccgccagca gcgtcgactcaacacaggcacccgctagcg gtcgacttaacacaggcacccgccagca Supplementary Table 5 Primer sequences used for real-time PCR analysis Name Forward (5-3 ) Reverse (5-3 ) Dep1 LAX FZP RCN1 OsCKX2 Actin1 gcgagatcacgttcctcaag gccatccactacgtcaagt agatggtcgccggcttct gggtgatatgcgttctttcttc cgcaacaagtgggacagtaa agcaactgggatgatatgga tgcagtttggcttacagcat tggacgaagacacagcaagg atggagagtaggagtaggag ggcaggtactgcttgtaggc cagggcgatgtaggaaagc cagggcgatgtaggaaagc 5

10 Supplementary Figures Supplementary Fig. 1. Sequence analysis of predicted gene product. (a) Alignment of with DEP1. (b) Alignment of the putative PEBP-like domain with the N-terminus of the GS3 protein. The numbers on the right indicate the position of the residues in the full protein. Identical and conserved residues indicated by dark grey boxes, and variant residues by light grey boxes. 6

11 Supplementary Fig. 2. Characterization of transgenic rice plants. (a) The reduced expression of induces changes in panicle architecture in NIL- plants carrying pdep1:rnai-dep1. Scale bar: 2cm. (b) The panicle architecture of non-transgenic and transgenic NIL-DEP1 plants carrying the pdep1: construct. Scale bar: 3 cm. (c) The numbers of grains per main panicle is higher in transgenic NIL-DEP1 plants expressing under the control of the native DEP1 promoter. Data given as mean ± standard error (n=30 plants). (d) Transgenic NIL-DEP1 plants expressing DEP1 under the control of the native DEP1 promoter does not alter panicle architecture. Scale bar: 3cm. (e), Transgenic Nipponbare plants constitutively expressing under the control of the rice actin1 promoter have a dwarf stature. Scale bar: 10cm. (f) The structure of the main panicle of transgenic Nipponbare plants expressing DEP1 driven by the rice actin1 promoter. Scale bar: 4cm. 7

12 Supplementary Fig. 3. Expression of DEP1 and subcellular localisation of its gene product. (a) The DEP1-GFP fusion protein is present in the nucleus. Scale bar: 25μm. (b) The expression of during spikelet development, as measured by real time PCR. Values represent the ratio of expression to rice actin1. 1: Formation of primary branches; 2: Elongation of primary branches; 3: Formation of secondary branches; 4: Differentiation of glumes; 5: Differentiation of floral organs; 6: Rapid elongation of rachis and branches; 7: Heading and flowering. Values represent the ratio of expression 8

13 to rice actin1, and data are given as mean ± standard error. All assays were repeated at least three times. (c) GUS expression, driven by the native DEP1 promoter, in the intercalary meristem. (d) Reduced transcription of DEP1 in NIL-DEP1 plants (C, culm; R, root; LS, leaf sheath; SAM, shoot apex meristem; BM, branch meristem). E, NIL-DEP1; e, NIL-. Rice actin1 was used as control. (e) In situ hybridisation shows the expression profile of DEP1 during spikelet development. 1: DEP1 transcripts in the leaf primordium (arrow) during vegetative development; 2: during reproductive development, DEP1 is expressed in the leaf (arrow), the adaxial side of the bract primordium (triangle), and in the bract primordium at the rachis branch (star); 3: strong expression in the panicle and leaf (arrow) at the initiation of spikelet primordia (stars); 4: expression is patchy in the lemma, palea and glume (triangle) primordia; 5: patchy expression inside the rachis branch (triangle); 6: weak expression in the carpel and stamen primordia (arrow), and patchy expression in the lemma and palea (triangle); 7: negative control preparation made with a sense DEP1 probe. Scale bar: 50μm. 9

14 Supplementary Fig. 4. Transgenic plants expressing produce more root meristem cells. (a) Longitudinal section of the rice root tip. Arrows indicated the transition zone between the meristem and the elongation-differentiation zone. Scale bar: 50μm. (b) Root meristem of non-transgenic Nipponbare and transgenic plants expressing. All data given as mean ± standard error (n=30 plants). 10

15 Supplementary Fig. 5. Transcriptional levels in NIL- and NIL-DEP1 of (a) RCN1, (b) LAX, (c) FZP, (d) OsCKX2. Data are displayed as the ratio of expression to rice actin1 RNA, data given as mean ± standard error. All assays were repeated at least three times. 11

16 Supplementary Fig. 6. Panicle architecture of a NIL in the background of indiva variety ZF 802. (a) Panicle characterization of ZF 802 (). Scale bar: 2cm. (b) Mature de-seeded panicles showing rachis length and panicle branching. Scale bar: 2cm. (c) Number of grains per panicle in ZF 802 () and wild type ZF 802. Data given as mean ± standard error (n=20 plants). 12

17 Supplementary Fig. 7. Vascular bundles in NIL- plants. (a) The internodes of NIL- and NIL-DEP1 plants. (b) The increased number of vascular bundles in the flag leaf veins of NIL- plants. 13

18 Supplementary Fig. 8. Allelic variation for DEP1 in domesticated and wild rice. The numbers on the right indicate the position of residues in the full length protein. The japonica varieties represented are Nipponbare, Wanhui 31 (WH 3), Shao 313; and the indica varieties are Guangluai 4 (GLA4), Zheshan 97B (ZX97B), TN 1, 93-11, Nanjing 6 (NJ 6), Zhefu 802 (ZF 802), Minghui 63 (MH 63), Miyang 46 (MY 46), Peiai 64 (PA 64), Teqing; the accession of wild rice (O. rufipogon) is Dongxiang wild rice. 14