Table S1 List of primers used for genotyping and qrt-pcr.

Size: px
Start display at page:

Download "Table S1 List of primers used for genotyping and qrt-pcr."

Transcription

1 Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!! R! AAACACCTTGGAACTGTCCTAGC!! max3-11, max3-12! F! TGAGACTAGAGAGGATAACGGC!!! R! AACATCTCTCCACCGAAACCGC!! max4-7! F! CTTAGGTTAGTACACCTTCG!!! R! GTCTCCGTCACTATCGGCGC!! max4-8! F! CTCTCCAAACTCACCG!!! R! AGTTTCCCGTATTTGCTCCCG! qrt-pcr! gene! ligomer*! 5'-sequence-3'! rice! D10! F! CTGTACAAGTTCGAGTGGCACC!!! R! CCTCGTCCGTCTCCTCGTAC!!! T! f-caaggccagcggcaagattg-t**!! Ubiquitin! F! AAGGTCACCAGGCTCAGGAAG!!! R! GATCGAAGTGGTTGGCC!!! T! f-caacaacgactgcggcgcg-t**! *F, R and T respectively indicate forward, reverse (primers) and TaqMan probes. **f and t respectively indicate the fluorescence labels, FAM and TAMRA.

2 a D3 (s06g ) (Ishikawa et al. 2005) 12) D10 (s01g ) transposon d3-1 (Arite et al. 2007) 14) CTG (L112) CCG (P) ATC (S552) ATA (Stop) d10-1 d10-2 D17/HTD1 (s04g ) Δ2Δ1 *d kb b MAX2 (At2g42620) Δ2 Δ39 *max2-3 (SALK_092836) *max2-4 (SALK_028336) MAX3 (At2g44990) *max3-12 (SALK_015785) Δ15 max3-11 (SALK_023975) (Auldridge et al. 2006) 17) MAX4 (At4g32810) Δ10 Δ28 *max4-7 (SALK_082552) *max4-8 (SALK_072750) 0.5kb Figure S1 Rice and Arabidopsis branching mutants used in this study. Shaded boxes indicate exons. *New mutant alleles identified in the current study. (a) Rice mutants in the Shiokari background (d3-1, d10-1 and d17-1) and the Nipponbare background (d10-2). (b) Arabidopsis mutants (Col-0 background).

3 NaH, CD2 Me THF D C (tautomerism) CD H Br K 2 C 3 N-methylpyrrolidone D Figure S2 Scheme for the synthesis of (±)-[6'-d 1 ]-5DS CD 2 Me; deuterium-labeled methyl formate..

4 m/z 347 m/z '-epi-orobanchol standard (100 pg) WT (D10 D10) Heterozygote (D10-2 d10-2) Homozygote (d10-2) m/z 347 m/z Retention time (min) 2'-epi-orobanchol standard (100 pg) WT (D10 D10) Heterozygote (D10 d10-2) Homozygote (d10-2 d10-2) 6.00 Figure S3 LC-MS/MS analysis of strigolactones in root exudates of wild type and d10-2 mutant (Nipponbare background). Progenies of heterozygous D10 d10-2 plants were germinated and individual plants were genotyped by PCR using primers described in Table S1. Ten seedlings (2 weeks old) for each genotype were pooled and 2'-epi-orobanchol (or its isomer) in root exudates were analyzed by selected reaction monitoring on LC-MS/MS. [M+H] + (m/z 347) was selected as a parent ion on quadrapole MS and [M+H 142] + (m/z 205.1) and [M+H 250] + (m/z 97.0) were detected as fragment ions on time-of-flight MS. These ion transitions were detectable in root exudates of segregated wild type (D10 D10) and heterozygotes (D10 d10-2), but not in those of d10-2 homozygotes. Note to Figure S3. In root exudates of Shiokari seedlings, epi-5ds was the only strigolactone detectable by LC-MS/MS analysis. However, in our previous survey of known strigolactones using Nipponbare seedlings, we detected 2'-epiorobanchol (or its isomer) in addition to epi-5ds. We therefore used the d10-2 allele in the Nipponbare background to see if the content of 2'-epi-orobanchol (or its isomer) is reduced by the d10 mutation. Because homozygous d10-2 mutant plants were nearly sterile in our growth condition, we used progenies of heterozygotes (D10 d10-2) for this experiment. Consistent with the previous notion, we were able to detect a mono-hydroxylated form of epi-5ds (tentatively identified as 2'-epi-orobanchol or its isomer) in root exudates from the wild type and the heterozygote, but not in exudates from the homozygous d10-2 mutant. These data provide evidence that overall strigolactone levels are decreased in root exudates of d10 seedlings.

5 a 4th 3rd 2nd b 50 Height (cm) c Length of outgrowing tillers (mm) nd week 3rd week 4th week Figure S4 Effect of on tiller growth of wild type seedlings. a, Four-week-old wild type seedlings grown hydroponically in the presence or absence of in the culture media. Arrowheads indicate outgrowth of tillers. The 5th tiller is not visible as it is enclosed by the leaf sheath. Bar is 10 cm. b,c, treatment inhibited the growth of tillers (b), but did not change the plant height (c). Data are the means ± s.d. (n=8).

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions. Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods

More information

Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.

Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny

More information

EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA

EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA Item Type text; Electronic Thesis Authors Bergstrand, Lauren Janel Publisher The University of Arizona. Rights Copyright is held by the author. Digital

More information

GFP GAL bp 3964 bp

GFP GAL bp 3964 bp Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive

More information

Supplemental Data. Perrella et al. (2013). Plant Cell /tpc

Supplemental Data. Perrella et al. (2013). Plant Cell /tpc Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization

More information

Ethylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis

Ethylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis Ethylene is critical to the maintenance of primary root growth and Fe homeostasis under Fe stress in Arabidopsis Guangjie Li, Weifeng Xu, Herbert J. Kronzucker, Weiming Shi * Supplementary Data Supplementary

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative

More information

** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.

** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation. Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *

More information

Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc

Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc Supplemental Data. Chen and Thelen (2010). Plant Cell 10.1105/tpc.109.071837 1 C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector

More information

Title. Authors. Characterization of a major QTL for manganese accumulation in rice grain

Title. Authors. Characterization of a major QTL for manganese accumulation in rice grain Title Characterization of a major QTL for manganese accumulation in rice grain Authors Chaolei Liu, Guang Chen, Yuanyuan Li, Youlin Peng, Anpeng Zhang, Kai Hong, Hongzhen Jiang, Banpu Ruan, Bin Zhang,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1. Haploid plant produced by centromere-mediated genome elimination Chromosomes containing altered CENH3 in their centromeres (green dots) are eliminated after fertilization in a cross to wild

More information

Supplemental Data. Wang et al. (2014). Plant Cell /tpc

Supplemental Data. Wang et al. (2014). Plant Cell /tpc Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and

More information

GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL

GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,

More information

Chapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype.

Chapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype. Chapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype. please read pages 38-47; 49-55;57-63. Slide 1 of Chapter 2 1 Extension sot Mendelian Behavior of Genes Single gene inheritance

More information

The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype.

The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype. Series 2: Cross Diagrams - Complementation There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:

More information

Solutions to Problem Set 4

Solutions to Problem Set 4 Question 1 Solutions to 7.014 Problem Set 4 Because you have not read much scientific literature, you decide to study the genetics of garden peas. You have two pure breeding pea strains. One that is tall

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Microarray analysis Grains of 7 DAP of the wild-type and gif1 were harvested for RNA preparation. Microarray analysis was performed with the Affymetrix (Santa Clara, CA) GeneChip

More information

Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids

Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Plant growth conditions The soil was a 1:1 v/v mixture of loamy soil and organic compost. Initial soil water content was determined

More information

Interaction between strigolactone and other plant hormones

Interaction between strigolactone and other plant hormones Interaction between strigolactone and other plant hormones Biosynthesis and Metabolism of Normal growth and development Kaori Yoneyama, X Xie, T Kisugi, T Nomura, K Yoneyama (Weed Science Center, Utsunomiya

More information

Regulation of Phosphate Homeostasis by microrna in Plants

Regulation of Phosphate Homeostasis by microrna in Plants Regulation of Phosphate Homeostasis by microrna in Plants Tzyy-Jen Chiou 1 *, Kyaw Aung 1,2, Shu-I Lin 1,3, Chia-Chune Wu 1, Su-Fen Chiang 1, and Chun-Lin Su 1 Abstract Upon phosphate (Pi) starvation,

More information

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and

More information

Solutions to Even-Numbered Exercises to accompany An Introduction to Population Genetics: Theory and Applications Rasmus Nielsen Montgomery Slatkin

Solutions to Even-Numbered Exercises to accompany An Introduction to Population Genetics: Theory and Applications Rasmus Nielsen Montgomery Slatkin Solutions to Even-Numbered Exercises to accompany An Introduction to Population Genetics: Theory and Applications Rasmus Nielsen Montgomery Slatkin CHAPTER 1 1.2 The expected homozygosity, given allele

More information

Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.

Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background. Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on

More information

Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2

Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2 Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2 IRT1, FRO2 and FIT expression levels in roots of the wild-type, nas4x- 1 and nas4x-2, showing that in both nas mutants

More information

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation

More information

Supporting Online Material

Supporting Online Material 1 Stomatal Patterning and Differentiation by Synergistic Interactions of Receptor Kinases Elena D. Shpak, Jessica Messmer McAbee, Lynn Jo Pillitteri, and Keiko U. Torii Supporting Online Material Material

More information

Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice Supplementary Figure 2.

Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice Supplementary Figure 2. Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice. Percentage of marginal zone B cells in the spleen of wild-type mice (+/+), mice homozygous for cpm or pri

More information

Supplementary Figure 1. Phenotype of the HI strain.

Supplementary Figure 1. Phenotype of the HI strain. Supplementary Figure 1. Phenotype of the HI strain. (A) Phenotype of the HI and wild type plant after flowering (~1month). Wild type plant is tall with well elongated inflorescence. All four HI plants

More information

Nature Genetics: doi: /ng Supplementary Figure 1. The FIN and FAB genes act separately from the meristem maturation pathway.

Nature Genetics: doi: /ng Supplementary Figure 1. The FIN and FAB genes act separately from the meristem maturation pathway. Supplementary Figure 1 The FIN and FAB genes act separately from the meristem maturation pathway. (a) Representative inflorescence from the compound inflorescence (s, defective in the homolog of Arabidopsis

More information

Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering

Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering by Valverde et. Al Published in Science 2004 Presented by Boyana Grigorova CBMG 688R Feb. 12, 2007 Circadian Rhythms: The Clock Within

More information

When one gene is wild type and the other mutant:

When one gene is wild type and the other mutant: Series 2: Cross Diagrams Linkage Analysis There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:

More information

Engineering light response pathways in crop plants for improved performance under high planting density

Engineering light response pathways in crop plants for improved performance under high planting density Engineering light response pathways in crop plants for improved performance under high planting density Tom Brutnell Boyce Thompson Institute for Plant Research Cornell University, Ithaca NY 6000 years

More information

Duplication of an upstream silencer of FZP increases grain yield in rice

Duplication of an upstream silencer of FZP increases grain yield in rice SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41477-017-0042-4 In the format provided by the authors and unedited. Duplication of an upstream silencer of FZP increases grain yield in rice

More information

REVISION: GENETICS & EVOLUTION 20 MARCH 2013

REVISION: GENETICS & EVOLUTION 20 MARCH 2013 REVISION: GENETICS & EVOLUTION 20 MARCH 2013 Lesson Description In this lesson, we revise: The principles of Genetics including monohybrid crosses Sex linked traits and how to use a pedigree chart The

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/452/ra106/dc1 Supplementary Materials for Stem-piped light activates phytochrome B to trigger light responses in Arabidopsis thaliana roots Hyo-Jun Lee, Jun-Ho

More information

Genetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity

Genetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity Genetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity Shih-Heng Su, Maria Cristina Suarez-Rodriguez, Patrick Krysan

More information

Verification of the Principles of Genetics by Manipulating Saccharomyces Cerevisiae and Observing Meiotic Products ABSTRACT

Verification of the Principles of Genetics by Manipulating Saccharomyces Cerevisiae and Observing Meiotic Products ABSTRACT November 27, 2002 Bio251 Dr. Calhoon Verification of the Principles of Genetics by Manipulating Saccharomyces Cerevisiae and Observing Meiotic Products ABSTRACT The experiment was conducted to verify the

More information

Segregation versus mitotic recombination APPENDIX

Segregation versus mitotic recombination APPENDIX APPENDIX Waiting time until the first successful mutation The first time lag, T 1, is the waiting time until the first successful mutant appears, creating an Aa individual within a population composed

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/331/6019/876/dc1 Supporting Online Material for Synthetic Clonal Reproduction Through Seeds Mohan P. A. Marimuthu, Sylvie Jolivet, Maruthachalam Ravi, Lucie Pereira,

More information

Yesterday s Picture UNIT 3D

Yesterday s Picture UNIT 3D Warm-Up Blood types are determined by a single gene with several alleles. The allele encoding the Type A phenotype (I A ) is dominant to the allele encoding the Type O phenotype (i). Determine the phenotype

More information

Classical Selection, Balancing Selection, and Neutral Mutations

Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection Perspective of the Fate of Mutations All mutations are EITHER beneficial or deleterious o Beneficial mutations are selected

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature10534 Supplementary Fig. 1. Diagrammatic representation of the N-end rule pathway of targeted proteolysis (after Graciet and Wellmer 2010 9 ). Tertiary, secondary

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,

More information

23-. Shoot and root development depend on ratio of IAA/CK

23-. Shoot and root development depend on ratio of IAA/CK Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal

More information

Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type

Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type A B 2 3 3 2 1 1 Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type (A) and d27 (B) seedlings at the four

More information

allosteric cis-acting DNA element coding strand dominant constitutive mutation coordinate regulation of genes denatured

allosteric cis-acting DNA element coding strand dominant constitutive mutation coordinate regulation of genes denatured A B C D E F G H I J K L M N O P Q R S T U V W X Y Z AA BB CC DD EE FF GG HH II JJ KK LL MM NN OO PP QQ RR SS TT UU VV allosteric cis-acting DNA element coding strand codominant constitutive mutation coordinate

More information

Cell Division and Genetics

Cell Division and Genetics Name Date Cell Division and Genetics 1. Black fur is dominant over brown fur in a particular population of guinea pig. The genetic information that gives a guinea pig brown fur is described as having A.

More information

Chapter Three. The effect of reduced DNA methylation on the flowering time and vernalization. response of Arabidopsis thaliana

Chapter Three. The effect of reduced DNA methylation on the flowering time and vernalization. response of Arabidopsis thaliana Chapter Three The effect of reduced DNA methylation on the flowering time and vernalization response of Arabidopsis thaliana 3.1 Introduction The time at which a plant flowers is influenced by environmental

More information

Life Cycles, Meiosis and Genetic Variability24/02/2015 2:26 PM

Life Cycles, Meiosis and Genetic Variability24/02/2015 2:26 PM Life Cycles, Meiosis and Genetic Variability iclicker: 1. A chromosome just before mitosis contains two double stranded DNA molecules. 2. This replicated chromosome contains DNA from only one of your parents

More information

Supplemental Data. Yang et al. (2012). Plant Cell /tpc

Supplemental Data. Yang et al. (2012). Plant Cell /tpc Supplemental Figure 1. Mature flowers of P. heterotricha. (A) An inflorescence of P. heterotricha showing the front view of a zygomorphic flower characterized by two small dorsal petals and only two fertile

More information

Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao

Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao New Phytologist Supporting Information Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bhlh transcription factor MtTT8 Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang

More information

AEC 550 Conservation Genetics Lecture #2 Probability, Random mating, HW Expectations, & Genetic Diversity,

AEC 550 Conservation Genetics Lecture #2 Probability, Random mating, HW Expectations, & Genetic Diversity, AEC 550 Conservation Genetics Lecture #2 Probability, Random mating, HW Expectations, & Genetic Diversity, Today: Review Probability in Populatin Genetics Review basic statistics Population Definition

More information

m1 m2 m3 m4 m5 m6 m7 m8 wt m m m m m m m m8 - + wt +

m1 m2 m3 m4 m5 m6 m7 m8 wt m m m m m m m m8 - + wt + otherwise, you couldn't grow them!) You perform pairwise infections with each of your mutant bacteriophage strains and get the following results: (+) = pair of phages lysed host cells, (-) = pair of phages

More information

The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively as positive regulators of salt stress tolerance in rice

The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively as positive regulators of salt stress tolerance in rice Lou et al. BMC Plant Biology (2018) 18:203 https://doi.org/10.1186/s12870-018-1408-0 RESEARCH ARTICLE Open Access The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively

More information

3/4/2015. Review. Phenotype

3/4/2015. Review. Phenotype Review Phenotype 1 Genes Crossing Over Frequency cn cinnabar eyes Cy curly wings L lobe eyes pr purple eyes sm smooth abdomen pr - L 9% Cy - L 33% sm - pr 19% cn - pr 2% Cy - sm 43% cn - sm 17% Polygenic

More information

Objectives. Announcements. Comparison of mitosis and meiosis

Objectives. Announcements. Comparison of mitosis and meiosis Announcements Colloquium sessions for which you can get credit posted on web site: Feb 20, 27 Mar 6, 13, 20 Apr 17, 24 May 15. Review study CD that came with text for lab this week (especially mitosis

More information

Development 143: doi: /dev : Supplementary information

Development 143: doi: /dev : Supplementary information Supplementary Materials and Methods Plant materials The mutants and transgenic plants used in the present study were as follows: E361 (from Alex Webb s laboratory); tmm-1, ptmm::tmm-gfp and flp-1 (from

More information

fact that of the thrum plants which did appear, all but 2 came from made over a number of years. Families grown from seed set by open

fact that of the thrum plants which did appear, all but 2 came from made over a number of years. Families grown from seed set by open OUTCROSSING ON HOMOSTYLE PRIMROSES JACK L. CROSBY Botany Department, Durham Colleges in the University of Durham 1. INTRODUCTION Bodmer (198) gives figures which he claims demonstrate that homostyle primroses

More information

Heredity and Genetics WKSH

Heredity and Genetics WKSH Chapter 6, Section 3 Heredity and Genetics WKSH KEY CONCEPT Mendel s research showed that traits are inherited as discrete units. Vocabulary trait purebred law of segregation genetics cross MAIN IDEA:

More information

1.5.1 ESTIMATION OF HAPLOTYPE FREQUENCIES:

1.5.1 ESTIMATION OF HAPLOTYPE FREQUENCIES: .5. ESTIMATION OF HAPLOTYPE FREQUENCIES: Chapter - 8 For SNPs, alleles A j,b j at locus j there are 4 haplotypes: A A, A B, B A and B B frequencies q,q,q 3,q 4. Assume HWE at haplotype level. Only the

More information

Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed

Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed using the Geneious software. Accession numbers of the

More information

The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype.

The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype. Series 1: Cross Diagrams There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome: When both

More information

Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated

Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplemental Methods Isolation and mapping of SPCH An EMS-mutagenized population of tmm-1 (Col);E1728 (an enhancer trap GFP marking guard cells) was created. M2 seeds were collected from M1 s planted in

More information

Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication

Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication SUPPORTING ONLINE MATERIALS Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication Bin Cong, Luz Barrero, & Steven Tanksley 1 SUPPORTING

More information

Genetics 275 Notes Week 7

Genetics 275 Notes Week 7 Cytoplasmic Inheritance Genetics 275 Notes Week 7 Criteriafor recognition of cytoplasmic inheritance: 1. Reciprocal crosses give different results -mainly due to the fact that the female parent contributes

More information

Heterozygous BMN lines

Heterozygous BMN lines Optical density at 80 hours 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 a YPD b YPD + 1µM nystatin c YPD + 2µM nystatin d YPD + 4µM nystatin 1 3 5 6 9 13 16 20 21 22 23 25 28 29 30

More information

CSS 350 Midterm #2, 4/2/01

CSS 350 Midterm #2, 4/2/01 6. In corn three unlinked dominant genes are necessary for aleurone color. The genotypes B-D-B- are colored. If any of these loci is homozygous recessive the aleurone will be colorless. What is the expected

More information

Results. Experiment 1: Monohybrid Cross for Pea Color. Table 1.1: P 1 Cross Results for Pea Color. Parent Descriptions: 1 st Parent: 2 nd Parent:

Results. Experiment 1: Monohybrid Cross for Pea Color. Table 1.1: P 1 Cross Results for Pea Color. Parent Descriptions: 1 st Parent: 2 nd Parent: Results Experiment 1: Monohybrid Cross for Pea Color Table 1.1: P 1 Cross Results for Pea Color Green Peas Yellow Peas Green Peas: Yellow Peas: Table 1.2: F 1 Cross Results for Pea Color: Green Peas Yellow

More information

DOI: 10.1038/ncb2819 Gαi3 / Actin / Acetylated Tubulin Gαi3 / Actin / Acetylated Tubulin a a Gαi3 a Actin Gαi3 WT Gαi3 WT Gαi3 WT b b Gαi3 b Actin Gαi3 KO Gαi3 KO Gαi3 KO # # Figure S1 Loss of protein

More information

Supplemental Data. Hou et al. (2016). Plant Cell /tpc

Supplemental Data. Hou et al. (2016). Plant Cell /tpc Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc.16.295 A Distance to 1 st nt of start codon Distance to 1 st nt of stop codon B Normalized PARE abundance 8 14 nt 17 nt Frame1 Arabidopsis inflorescence

More information

Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day

Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day conditions. Photo was taken when the wild type plant started to bolt. Scale bar represents 1 cm. Supplemental Figure 2. Flowering

More information

Biology Final Review Ch pg Biology is the study of

Biology Final Review Ch pg Biology is the study of Biology Final Review Ch. 1 1-3 pg. 17-25 1. Biology is the study of Ch.2 2-3 pg. 45-49 2. All organic compounds contain. 3. Starch is an example of which type of organic compound? 4. What monomers make

More information

Genetic Characterization and Functional Analysis of the GID1 Gibberellin Receptors in Arabidopsis W

Genetic Characterization and Functional Analysis of the GID1 Gibberellin Receptors in Arabidopsis W The Plant Cell, Vol. 18, 3399 3414, December 2006, www.plantcell.org ª 2006 American Society of Plant Biologists Genetic Characterization and Functional Analysis of the GID1 Gibberellin Receptors in Arabidopsis

More information

Chromosome Chr Duplica Duplic t a ion Pixley

Chromosome Chr Duplica Duplic t a ion Pixley Chromosome Duplication Pixley Figure 4-6 Molecular Biology of the Cell ( Garland Science 2008) Figure 4-72 Molecular Biology of the Cell ( Garland Science 2008) Interphase During mitosis (cell division),

More information

Legend: S spotted Genotypes: P1 SS & ss F1 Ss ss plain F2 (with ratio) 1SS :2 WSs: 1ss. Legend W white White bull 1 Ww red cows ww ww red

Legend: S spotted Genotypes: P1 SS & ss F1 Ss ss plain F2 (with ratio) 1SS :2 WSs: 1ss. Legend W white White bull 1 Ww red cows ww ww red On my honor, this is my work GENETICS 310 EXAM 1 June 8, 2018 I. Following are 3 sets of data collected from crosses: 1. Spotted by Plain gave all spotted in the F1 and 9 spotted and 3 plain in the F2.

More information

Arabidopsis COMPASS-Like Complexes Mediate Histone H3 Lysine-4 Trimethylation to Control Floral Transition and Plant Development

Arabidopsis COMPASS-Like Complexes Mediate Histone H3 Lysine-4 Trimethylation to Control Floral Transition and Plant Development Arabidopsis COMPASS-Like Complexes Mediate Histone H3 Lysine-4 Trimethylation to Control Floral Transition and Plant Development Danhua Jiang 1,2, Nicholas C. Kong 1,2, Xiaofeng Gu 2, Zicong Li 1, Yuehui

More information

mrna Codon Table Mutant Dinosaur Name: Period:

mrna Codon Table Mutant Dinosaur Name: Period: Mutant Dinosaur Name: Period: Intro Your dinosaur is born with a new genetic mutation. Your job is to map out the genes that are influenced by the mutation and to discover how the new dinosaurs interact

More information

Supplemental Data. Gao et al. (2012). Plant Cell /tpc

Supplemental Data. Gao et al. (2012). Plant Cell /tpc Supplemental Figure 1. Plant EMP Proteins. (A) The Accession numbers of the 12 EMP members from Arabidopsis. (B) Phylogenetic analysis of EMP proteins from Arabidopsis, human and yeast using the Mac Vector

More information

CHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection

CHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection CHAPTER 23 THE EVOLUTIONS OF POPULATIONS Section C: Genetic Variation, the Substrate for Natural Selection 1. Genetic variation occurs within and between populations 2. Mutation and sexual recombination

More information

Biology 211 (1) Exam 4! Chapter 12!

Biology 211 (1) Exam 4! Chapter 12! Biology 211 (1) Exam 4 Chapter 12 1. Why does replication occurs in an uncondensed state? 1. 2. A is a single strand of DNA. When DNA is added to associated protein molecules, it is referred to as. 3.

More information

Quantitative Genetics I: Traits controlled my many loci. Quantitative Genetics: Traits controlled my many loci

Quantitative Genetics I: Traits controlled my many loci. Quantitative Genetics: Traits controlled my many loci Quantitative Genetics: Traits controlled my many loci So far in our discussions, we have focused on understanding how selection works on a small number of loci (1 or 2). However in many cases, evolutionary

More information

Quiz Section 4 Molecular analysis of inheritance: An amphibian puzzle

Quiz Section 4 Molecular analysis of inheritance: An amphibian puzzle Genome 371, Autumn 2018 Quiz Section 4 Molecular analysis of inheritance: An amphibian puzzle Goals: To illustrate how molecular tools can be used to track inheritance. In this particular example, we will

More information

PYR1 PYL1 PYL2 PYL3 PYL4 PYL5 PYL6 PYL7 PYL8 PYL9 PYL10 PYL11/12

PYR1 PYL1 PYL2 PYL3 PYL4 PYL5 PYL6 PYL7 PYL8 PYL9 PYL10 PYL11/12 Supplemental Data. Gonzalez-Guzman et al. Plant Cell. (212). 1.115/tpc.112.98574 Supplemental Figure 1. Gene expression levels of the PYR/PYL/RCAR ABA receptors in the Arabidopsis transcriptome genomic

More information

** LCA LCN PCA

** LCA LCN PCA % of wild type value % of wild type value a 12 1 8 2 b 12 1 8 2 LCA LCN PCA Col- sod3-1 Supplementary Figure 1 sod3-1 influences cell proliferation. (a) Fifth leaf cell area (LCA) and leaf cell number

More information

Supplemental material

Supplemental material Supplemental material Table 1- Segregation analysis of sgt1a sgt1b double mutant plants Parental genotype No. of lines Normal seeds Phenotype Abnormal seeds Ratio of abnormal seeds (%) WT 3 171 2 1.16

More information

. Supplementary Information

. Supplementary Information . Supplementary Information Supplementary Figure S1. Mature embryo sac observations. Supplementary Figure S2. STT observations. Supplementary Figure S3. Comparison of the PTB1 cdna with that of the mutant.

More information

Biological Roles of Cytokinins

Biological Roles of Cytokinins Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators

More information

Lipid transfer proteins confer resistance to trichothecenes

Lipid transfer proteins confer resistance to trichothecenes Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance

More information

Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles

Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN

More information

GENETICS 603 Exam 3, Dec 2, 2011

GENETICS 603 Exam 3, Dec 2, 2011 GENETICS 603 Exam 3, Dec 2, 2011 Name I. Chromosome IV in Drosophila is a very small chromosome with few genes. Fruitflies that are trisomic for chromosome IV have no apparent phenotypic abnormalities,

More information

SOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent Seed Germination Downstream of PIL5 W

SOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent Seed Germination Downstream of PIL5 W The Plant Cell, Vol. 20: 1260 1277, May 2008, www.plantcell.org ª 2008 American Society of Plant Biologists SOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent

More information

Liu, Yang (2012) The characterization of a novel abscission-related gene in Arabidopsis thaliana. PhD thesis, University of Nottingham.

Liu, Yang (2012) The characterization of a novel abscission-related gene in Arabidopsis thaliana. PhD thesis, University of Nottingham. Liu, Yang (2012) The characterization of a novel abscission-related gene in Arabidopsis thaliana. PhD thesis, University of Nottingham. Access from the University of Nottingham repository: http://eprints.nottingham.ac.uk/12529/3/thesis_part_2_final.pdf

More information

DEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA

DEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA DEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA CHASE BALLARD LINDA EAN HECTOR LOPEZ DR. JOANNA WERNER-FRACZEK IN COLLABORATION WITH DR. PATRICIA SPRINGER S LAB AT UCR AND ROBERT KOBLE PURPOSE OF RESEARCH

More information

Mutation of the cytosolic ribosomal protein-encoding RPS10B gene affects shoot meristematic function in Arabidopsis

Mutation of the cytosolic ribosomal protein-encoding RPS10B gene affects shoot meristematic function in Arabidopsis Stirnberg et al. BMC Plant Biology 2012, 12:160 RESEARCH ARTICLE Mutation of the cytosolic ribosomal protein-encoding RPS10B gene affects shoot meristematic function in Arabidopsis Petra Stirnberg 1, Jin-Ping

More information

Breeding Values and Inbreeding. Breeding Values and Inbreeding

Breeding Values and Inbreeding. Breeding Values and Inbreeding Breeding Values and Inbreeding Genotypic Values For the bi-allelic single locus case, we previously defined the mean genotypic (or equivalently the mean phenotypic values) to be a if genotype is A 2 A

More information

Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.

Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C. UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2017-2018 GENETICS BIO-5009A Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section

More information

Exam 1 PBG430/

Exam 1 PBG430/ 1 Exam 1 PBG430/530 2014 1. You read that the genome size of maize is 2,300 Mb and that in this species 2n = 20. This means that there are 2,300 Mb of DNA in a cell that is a. n (e.g. gamete) b. 2n (e.g.

More information

1 Errors in mitosis and meiosis can result in chromosomal abnormalities.

1 Errors in mitosis and meiosis can result in chromosomal abnormalities. Slide 1 / 21 1 Errors in mitosis and meiosis can result in chromosomal abnormalities. a. Identify and describe a common chromosomal mutation. Slide 2 / 21 Errors in mitosis and meiosis can result in chromosomal

More information

Actions of auxin. Hormones: communicating with chemicals History: Discovery of a growth substance (hormone- auxin)

Actions of auxin. Hormones: communicating with chemicals History: Discovery of a growth substance (hormone- auxin) Hormones: communicating with chemicals History- discovery of plant hormone. Auxin Concepts of hormones Auxin levels are regulated by synthesis/degradation, transport, compartmentation, conjugation. Polar

More information