Table S1 List of primers used for genotyping and qrt-pcr.
|
|
- Felicia Stokes
- 5 years ago
- Views:
Transcription
1 Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!! R! AAACACCTTGGAACTGTCCTAGC!! max3-11, max3-12! F! TGAGACTAGAGAGGATAACGGC!!! R! AACATCTCTCCACCGAAACCGC!! max4-7! F! CTTAGGTTAGTACACCTTCG!!! R! GTCTCCGTCACTATCGGCGC!! max4-8! F! CTCTCCAAACTCACCG!!! R! AGTTTCCCGTATTTGCTCCCG! qrt-pcr! gene! ligomer*! 5'-sequence-3'! rice! D10! F! CTGTACAAGTTCGAGTGGCACC!!! R! CCTCGTCCGTCTCCTCGTAC!!! T! f-caaggccagcggcaagattg-t**!! Ubiquitin! F! AAGGTCACCAGGCTCAGGAAG!!! R! GATCGAAGTGGTTGGCC!!! T! f-caacaacgactgcggcgcg-t**! *F, R and T respectively indicate forward, reverse (primers) and TaqMan probes. **f and t respectively indicate the fluorescence labels, FAM and TAMRA.
2 a D3 (s06g ) (Ishikawa et al. 2005) 12) D10 (s01g ) transposon d3-1 (Arite et al. 2007) 14) CTG (L112) CCG (P) ATC (S552) ATA (Stop) d10-1 d10-2 D17/HTD1 (s04g ) Δ2Δ1 *d kb b MAX2 (At2g42620) Δ2 Δ39 *max2-3 (SALK_092836) *max2-4 (SALK_028336) MAX3 (At2g44990) *max3-12 (SALK_015785) Δ15 max3-11 (SALK_023975) (Auldridge et al. 2006) 17) MAX4 (At4g32810) Δ10 Δ28 *max4-7 (SALK_082552) *max4-8 (SALK_072750) 0.5kb Figure S1 Rice and Arabidopsis branching mutants used in this study. Shaded boxes indicate exons. *New mutant alleles identified in the current study. (a) Rice mutants in the Shiokari background (d3-1, d10-1 and d17-1) and the Nipponbare background (d10-2). (b) Arabidopsis mutants (Col-0 background).
3 NaH, CD2 Me THF D C (tautomerism) CD H Br K 2 C 3 N-methylpyrrolidone D Figure S2 Scheme for the synthesis of (±)-[6'-d 1 ]-5DS CD 2 Me; deuterium-labeled methyl formate..
4 m/z 347 m/z '-epi-orobanchol standard (100 pg) WT (D10 D10) Heterozygote (D10-2 d10-2) Homozygote (d10-2) m/z 347 m/z Retention time (min) 2'-epi-orobanchol standard (100 pg) WT (D10 D10) Heterozygote (D10 d10-2) Homozygote (d10-2 d10-2) 6.00 Figure S3 LC-MS/MS analysis of strigolactones in root exudates of wild type and d10-2 mutant (Nipponbare background). Progenies of heterozygous D10 d10-2 plants were germinated and individual plants were genotyped by PCR using primers described in Table S1. Ten seedlings (2 weeks old) for each genotype were pooled and 2'-epi-orobanchol (or its isomer) in root exudates were analyzed by selected reaction monitoring on LC-MS/MS. [M+H] + (m/z 347) was selected as a parent ion on quadrapole MS and [M+H 142] + (m/z 205.1) and [M+H 250] + (m/z 97.0) were detected as fragment ions on time-of-flight MS. These ion transitions were detectable in root exudates of segregated wild type (D10 D10) and heterozygotes (D10 d10-2), but not in those of d10-2 homozygotes. Note to Figure S3. In root exudates of Shiokari seedlings, epi-5ds was the only strigolactone detectable by LC-MS/MS analysis. However, in our previous survey of known strigolactones using Nipponbare seedlings, we detected 2'-epiorobanchol (or its isomer) in addition to epi-5ds. We therefore used the d10-2 allele in the Nipponbare background to see if the content of 2'-epi-orobanchol (or its isomer) is reduced by the d10 mutation. Because homozygous d10-2 mutant plants were nearly sterile in our growth condition, we used progenies of heterozygotes (D10 d10-2) for this experiment. Consistent with the previous notion, we were able to detect a mono-hydroxylated form of epi-5ds (tentatively identified as 2'-epi-orobanchol or its isomer) in root exudates from the wild type and the heterozygote, but not in exudates from the homozygous d10-2 mutant. These data provide evidence that overall strigolactone levels are decreased in root exudates of d10 seedlings.
5 a 4th 3rd 2nd b 50 Height (cm) c Length of outgrowing tillers (mm) nd week 3rd week 4th week Figure S4 Effect of on tiller growth of wild type seedlings. a, Four-week-old wild type seedlings grown hydroponically in the presence or absence of in the culture media. Arrowheads indicate outgrowth of tillers. The 5th tiller is not visible as it is enclosed by the leaf sheath. Bar is 10 cm. b,c, treatment inhibited the growth of tillers (b), but did not change the plant height (c). Data are the means ± s.d. (n=8).
Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.
Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods
More informationSupplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.
Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny
More informationEXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA
EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA Item Type text; Electronic Thesis Authors Bergstrand, Lauren Janel Publisher The University of Arizona. Rights Copyright is held by the author. Digital
More informationGFP GAL bp 3964 bp
Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive
More informationSupplemental Data. Perrella et al. (2013). Plant Cell /tpc
Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization
More informationEthylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis
Ethylene is critical to the maintenance of primary root growth and Fe homeostasis under Fe stress in Arabidopsis Guangjie Li, Weifeng Xu, Herbert J. Kronzucker, Weiming Shi * Supplementary Data Supplementary
More informationSUPPLEMENTARY INFORMATION
reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative
More information** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.
Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *
More informationSupplemental Data. Chen and Thelen (2010). Plant Cell /tpc
Supplemental Data. Chen and Thelen (2010). Plant Cell 10.1105/tpc.109.071837 1 C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector
More informationTitle. Authors. Characterization of a major QTL for manganese accumulation in rice grain
Title Characterization of a major QTL for manganese accumulation in rice grain Authors Chaolei Liu, Guang Chen, Yuanyuan Li, Youlin Peng, Anpeng Zhang, Kai Hong, Hongzhen Jiang, Banpu Ruan, Bin Zhang,
More informationSUPPLEMENTARY INFORMATION
Figure S1. Haploid plant produced by centromere-mediated genome elimination Chromosomes containing altered CENH3 in their centromeres (green dots) are eliminated after fertilization in a cross to wild
More informationSupplemental Data. Wang et al. (2014). Plant Cell /tpc
Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and
More informationGENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL
GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,
More informationChapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype.
Chapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype. please read pages 38-47; 49-55;57-63. Slide 1 of Chapter 2 1 Extension sot Mendelian Behavior of Genes Single gene inheritance
More informationThe phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype.
Series 2: Cross Diagrams - Complementation There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:
More informationSolutions to Problem Set 4
Question 1 Solutions to 7.014 Problem Set 4 Because you have not read much scientific literature, you decide to study the genetics of garden peas. You have two pure breeding pea strains. One that is tall
More informationSupplementary Methods
Supplementary Methods Microarray analysis Grains of 7 DAP of the wild-type and gif1 were harvested for RNA preparation. Microarray analysis was performed with the Affymetrix (Santa Clara, CA) GeneChip
More informationHeterosis and inbreeding depression of epigenetic Arabidopsis hybrids
Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Plant growth conditions The soil was a 1:1 v/v mixture of loamy soil and organic compost. Initial soil water content was determined
More informationInteraction between strigolactone and other plant hormones
Interaction between strigolactone and other plant hormones Biosynthesis and Metabolism of Normal growth and development Kaori Yoneyama, X Xie, T Kisugi, T Nomura, K Yoneyama (Weed Science Center, Utsunomiya
More informationRegulation of Phosphate Homeostasis by microrna in Plants
Regulation of Phosphate Homeostasis by microrna in Plants Tzyy-Jen Chiou 1 *, Kyaw Aung 1,2, Shu-I Lin 1,3, Chia-Chune Wu 1, Su-Fen Chiang 1, and Chun-Lin Su 1 Abstract Upon phosphate (Pi) starvation,
More informationSupplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc
Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and
More informationSolutions to Even-Numbered Exercises to accompany An Introduction to Population Genetics: Theory and Applications Rasmus Nielsen Montgomery Slatkin
Solutions to Even-Numbered Exercises to accompany An Introduction to Population Genetics: Theory and Applications Rasmus Nielsen Montgomery Slatkin CHAPTER 1 1.2 The expected homozygosity, given allele
More informationNature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.
Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on
More informationSupplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2
Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2 IRT1, FRO2 and FIT expression levels in roots of the wild-type, nas4x- 1 and nas4x-2, showing that in both nas mutants
More informationSupplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc
Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation
More informationSupporting Online Material
1 Stomatal Patterning and Differentiation by Synergistic Interactions of Receptor Kinases Elena D. Shpak, Jessica Messmer McAbee, Lynn Jo Pillitteri, and Keiko U. Torii Supporting Online Material Material
More informationSupplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice Supplementary Figure 2.
Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice. Percentage of marginal zone B cells in the spleen of wild-type mice (+/+), mice homozygous for cpm or pri
More informationSupplementary Figure 1. Phenotype of the HI strain.
Supplementary Figure 1. Phenotype of the HI strain. (A) Phenotype of the HI and wild type plant after flowering (~1month). Wild type plant is tall with well elongated inflorescence. All four HI plants
More informationNature Genetics: doi: /ng Supplementary Figure 1. The FIN and FAB genes act separately from the meristem maturation pathway.
Supplementary Figure 1 The FIN and FAB genes act separately from the meristem maturation pathway. (a) Representative inflorescence from the compound inflorescence (s, defective in the homolog of Arabidopsis
More informationPhotoreceptor Regulation of Constans Protein in Photoperiodic Flowering
Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering by Valverde et. Al Published in Science 2004 Presented by Boyana Grigorova CBMG 688R Feb. 12, 2007 Circadian Rhythms: The Clock Within
More informationWhen one gene is wild type and the other mutant:
Series 2: Cross Diagrams Linkage Analysis There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:
More informationEngineering light response pathways in crop plants for improved performance under high planting density
Engineering light response pathways in crop plants for improved performance under high planting density Tom Brutnell Boyce Thompson Institute for Plant Research Cornell University, Ithaca NY 6000 years
More informationDuplication of an upstream silencer of FZP increases grain yield in rice
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41477-017-0042-4 In the format provided by the authors and unedited. Duplication of an upstream silencer of FZP increases grain yield in rice
More informationREVISION: GENETICS & EVOLUTION 20 MARCH 2013
REVISION: GENETICS & EVOLUTION 20 MARCH 2013 Lesson Description In this lesson, we revise: The principles of Genetics including monohybrid crosses Sex linked traits and how to use a pedigree chart The
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/452/ra106/dc1 Supplementary Materials for Stem-piped light activates phytochrome B to trigger light responses in Arabidopsis thaliana roots Hyo-Jun Lee, Jun-Ho
More informationGenetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity
Genetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity Shih-Heng Su, Maria Cristina Suarez-Rodriguez, Patrick Krysan
More informationVerification of the Principles of Genetics by Manipulating Saccharomyces Cerevisiae and Observing Meiotic Products ABSTRACT
November 27, 2002 Bio251 Dr. Calhoon Verification of the Principles of Genetics by Manipulating Saccharomyces Cerevisiae and Observing Meiotic Products ABSTRACT The experiment was conducted to verify the
More informationSegregation versus mitotic recombination APPENDIX
APPENDIX Waiting time until the first successful mutation The first time lag, T 1, is the waiting time until the first successful mutant appears, creating an Aa individual within a population composed
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/331/6019/876/dc1 Supporting Online Material for Synthetic Clonal Reproduction Through Seeds Mohan P. A. Marimuthu, Sylvie Jolivet, Maruthachalam Ravi, Lucie Pereira,
More informationYesterday s Picture UNIT 3D
Warm-Up Blood types are determined by a single gene with several alleles. The allele encoding the Type A phenotype (I A ) is dominant to the allele encoding the Type O phenotype (i). Determine the phenotype
More informationClassical Selection, Balancing Selection, and Neutral Mutations
Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection Perspective of the Fate of Mutations All mutations are EITHER beneficial or deleterious o Beneficial mutations are selected
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10534 Supplementary Fig. 1. Diagrammatic representation of the N-end rule pathway of targeted proteolysis (after Graciet and Wellmer 2010 9 ). Tertiary, secondary
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
More information23-. Shoot and root development depend on ratio of IAA/CK
Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal
More informationSupplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type
A B 2 3 3 2 1 1 Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type (A) and d27 (B) seedlings at the four
More informationallosteric cis-acting DNA element coding strand dominant constitutive mutation coordinate regulation of genes denatured
A B C D E F G H I J K L M N O P Q R S T U V W X Y Z AA BB CC DD EE FF GG HH II JJ KK LL MM NN OO PP QQ RR SS TT UU VV allosteric cis-acting DNA element coding strand codominant constitutive mutation coordinate
More informationCell Division and Genetics
Name Date Cell Division and Genetics 1. Black fur is dominant over brown fur in a particular population of guinea pig. The genetic information that gives a guinea pig brown fur is described as having A.
More informationChapter Three. The effect of reduced DNA methylation on the flowering time and vernalization. response of Arabidopsis thaliana
Chapter Three The effect of reduced DNA methylation on the flowering time and vernalization response of Arabidopsis thaliana 3.1 Introduction The time at which a plant flowers is influenced by environmental
More informationLife Cycles, Meiosis and Genetic Variability24/02/2015 2:26 PM
Life Cycles, Meiosis and Genetic Variability iclicker: 1. A chromosome just before mitosis contains two double stranded DNA molecules. 2. This replicated chromosome contains DNA from only one of your parents
More informationSupplemental Data. Yang et al. (2012). Plant Cell /tpc
Supplemental Figure 1. Mature flowers of P. heterotricha. (A) An inflorescence of P. heterotricha showing the front view of a zygomorphic flower characterized by two small dorsal petals and only two fertile
More informationPenghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao
New Phytologist Supporting Information Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bhlh transcription factor MtTT8 Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang
More informationAEC 550 Conservation Genetics Lecture #2 Probability, Random mating, HW Expectations, & Genetic Diversity,
AEC 550 Conservation Genetics Lecture #2 Probability, Random mating, HW Expectations, & Genetic Diversity, Today: Review Probability in Populatin Genetics Review basic statistics Population Definition
More informationm1 m2 m3 m4 m5 m6 m7 m8 wt m m m m m m m m8 - + wt +
otherwise, you couldn't grow them!) You perform pairwise infections with each of your mutant bacteriophage strains and get the following results: (+) = pair of phages lysed host cells, (-) = pair of phages
More informationThe sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively as positive regulators of salt stress tolerance in rice
Lou et al. BMC Plant Biology (2018) 18:203 https://doi.org/10.1186/s12870-018-1408-0 RESEARCH ARTICLE Open Access The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively
More information3/4/2015. Review. Phenotype
Review Phenotype 1 Genes Crossing Over Frequency cn cinnabar eyes Cy curly wings L lobe eyes pr purple eyes sm smooth abdomen pr - L 9% Cy - L 33% sm - pr 19% cn - pr 2% Cy - sm 43% cn - sm 17% Polygenic
More informationObjectives. Announcements. Comparison of mitosis and meiosis
Announcements Colloquium sessions for which you can get credit posted on web site: Feb 20, 27 Mar 6, 13, 20 Apr 17, 24 May 15. Review study CD that came with text for lab this week (especially mitosis
More informationDevelopment 143: doi: /dev : Supplementary information
Supplementary Materials and Methods Plant materials The mutants and transgenic plants used in the present study were as follows: E361 (from Alex Webb s laboratory); tmm-1, ptmm::tmm-gfp and flp-1 (from
More informationfact that of the thrum plants which did appear, all but 2 came from made over a number of years. Families grown from seed set by open
OUTCROSSING ON HOMOSTYLE PRIMROSES JACK L. CROSBY Botany Department, Durham Colleges in the University of Durham 1. INTRODUCTION Bodmer (198) gives figures which he claims demonstrate that homostyle primroses
More informationHeredity and Genetics WKSH
Chapter 6, Section 3 Heredity and Genetics WKSH KEY CONCEPT Mendel s research showed that traits are inherited as discrete units. Vocabulary trait purebred law of segregation genetics cross MAIN IDEA:
More information1.5.1 ESTIMATION OF HAPLOTYPE FREQUENCIES:
.5. ESTIMATION OF HAPLOTYPE FREQUENCIES: Chapter - 8 For SNPs, alleles A j,b j at locus j there are 4 haplotypes: A A, A B, B A and B B frequencies q,q,q 3,q 4. Assume HWE at haplotype level. Only the
More informationSupplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed
Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed using the Geneious software. Accession numbers of the
More informationThe phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype.
Series 1: Cross Diagrams There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome: When both
More informationFigure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated
Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin
More informationSUPPLEMENTARY INFORMATION
Supplemental Methods Isolation and mapping of SPCH An EMS-mutagenized population of tmm-1 (Col);E1728 (an enhancer trap GFP marking guard cells) was created. M2 seeds were collected from M1 s planted in
More informationRegulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication
SUPPORTING ONLINE MATERIALS Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication Bin Cong, Luz Barrero, & Steven Tanksley 1 SUPPORTING
More informationGenetics 275 Notes Week 7
Cytoplasmic Inheritance Genetics 275 Notes Week 7 Criteriafor recognition of cytoplasmic inheritance: 1. Reciprocal crosses give different results -mainly due to the fact that the female parent contributes
More informationHeterozygous BMN lines
Optical density at 80 hours 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 a YPD b YPD + 1µM nystatin c YPD + 2µM nystatin d YPD + 4µM nystatin 1 3 5 6 9 13 16 20 21 22 23 25 28 29 30
More informationCSS 350 Midterm #2, 4/2/01
6. In corn three unlinked dominant genes are necessary for aleurone color. The genotypes B-D-B- are colored. If any of these loci is homozygous recessive the aleurone will be colorless. What is the expected
More informationResults. Experiment 1: Monohybrid Cross for Pea Color. Table 1.1: P 1 Cross Results for Pea Color. Parent Descriptions: 1 st Parent: 2 nd Parent:
Results Experiment 1: Monohybrid Cross for Pea Color Table 1.1: P 1 Cross Results for Pea Color Green Peas Yellow Peas Green Peas: Yellow Peas: Table 1.2: F 1 Cross Results for Pea Color: Green Peas Yellow
More informationDOI: 10.1038/ncb2819 Gαi3 / Actin / Acetylated Tubulin Gαi3 / Actin / Acetylated Tubulin a a Gαi3 a Actin Gαi3 WT Gαi3 WT Gαi3 WT b b Gαi3 b Actin Gαi3 KO Gαi3 KO Gαi3 KO # # Figure S1 Loss of protein
More informationSupplemental Data. Hou et al. (2016). Plant Cell /tpc
Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc.16.295 A Distance to 1 st nt of start codon Distance to 1 st nt of stop codon B Normalized PARE abundance 8 14 nt 17 nt Frame1 Arabidopsis inflorescence
More informationSupplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day
Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day conditions. Photo was taken when the wild type plant started to bolt. Scale bar represents 1 cm. Supplemental Figure 2. Flowering
More informationBiology Final Review Ch pg Biology is the study of
Biology Final Review Ch. 1 1-3 pg. 17-25 1. Biology is the study of Ch.2 2-3 pg. 45-49 2. All organic compounds contain. 3. Starch is an example of which type of organic compound? 4. What monomers make
More informationGenetic Characterization and Functional Analysis of the GID1 Gibberellin Receptors in Arabidopsis W
The Plant Cell, Vol. 18, 3399 3414, December 2006, www.plantcell.org ª 2006 American Society of Plant Biologists Genetic Characterization and Functional Analysis of the GID1 Gibberellin Receptors in Arabidopsis
More informationChromosome Chr Duplica Duplic t a ion Pixley
Chromosome Duplication Pixley Figure 4-6 Molecular Biology of the Cell ( Garland Science 2008) Figure 4-72 Molecular Biology of the Cell ( Garland Science 2008) Interphase During mitosis (cell division),
More informationLegend: S spotted Genotypes: P1 SS & ss F1 Ss ss plain F2 (with ratio) 1SS :2 WSs: 1ss. Legend W white White bull 1 Ww red cows ww ww red
On my honor, this is my work GENETICS 310 EXAM 1 June 8, 2018 I. Following are 3 sets of data collected from crosses: 1. Spotted by Plain gave all spotted in the F1 and 9 spotted and 3 plain in the F2.
More informationArabidopsis COMPASS-Like Complexes Mediate Histone H3 Lysine-4 Trimethylation to Control Floral Transition and Plant Development
Arabidopsis COMPASS-Like Complexes Mediate Histone H3 Lysine-4 Trimethylation to Control Floral Transition and Plant Development Danhua Jiang 1,2, Nicholas C. Kong 1,2, Xiaofeng Gu 2, Zicong Li 1, Yuehui
More informationmrna Codon Table Mutant Dinosaur Name: Period:
Mutant Dinosaur Name: Period: Intro Your dinosaur is born with a new genetic mutation. Your job is to map out the genes that are influenced by the mutation and to discover how the new dinosaurs interact
More informationSupplemental Data. Gao et al. (2012). Plant Cell /tpc
Supplemental Figure 1. Plant EMP Proteins. (A) The Accession numbers of the 12 EMP members from Arabidopsis. (B) Phylogenetic analysis of EMP proteins from Arabidopsis, human and yeast using the Mac Vector
More informationCHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection
CHAPTER 23 THE EVOLUTIONS OF POPULATIONS Section C: Genetic Variation, the Substrate for Natural Selection 1. Genetic variation occurs within and between populations 2. Mutation and sexual recombination
More informationBiology 211 (1) Exam 4! Chapter 12!
Biology 211 (1) Exam 4 Chapter 12 1. Why does replication occurs in an uncondensed state? 1. 2. A is a single strand of DNA. When DNA is added to associated protein molecules, it is referred to as. 3.
More informationQuantitative Genetics I: Traits controlled my many loci. Quantitative Genetics: Traits controlled my many loci
Quantitative Genetics: Traits controlled my many loci So far in our discussions, we have focused on understanding how selection works on a small number of loci (1 or 2). However in many cases, evolutionary
More informationQuiz Section 4 Molecular analysis of inheritance: An amphibian puzzle
Genome 371, Autumn 2018 Quiz Section 4 Molecular analysis of inheritance: An amphibian puzzle Goals: To illustrate how molecular tools can be used to track inheritance. In this particular example, we will
More informationPYR1 PYL1 PYL2 PYL3 PYL4 PYL5 PYL6 PYL7 PYL8 PYL9 PYL10 PYL11/12
Supplemental Data. Gonzalez-Guzman et al. Plant Cell. (212). 1.115/tpc.112.98574 Supplemental Figure 1. Gene expression levels of the PYR/PYL/RCAR ABA receptors in the Arabidopsis transcriptome genomic
More information** LCA LCN PCA
% of wild type value % of wild type value a 12 1 8 2 b 12 1 8 2 LCA LCN PCA Col- sod3-1 Supplementary Figure 1 sod3-1 influences cell proliferation. (a) Fifth leaf cell area (LCA) and leaf cell number
More informationSupplemental material
Supplemental material Table 1- Segregation analysis of sgt1a sgt1b double mutant plants Parental genotype No. of lines Normal seeds Phenotype Abnormal seeds Ratio of abnormal seeds (%) WT 3 171 2 1.16
More information. Supplementary Information
. Supplementary Information Supplementary Figure S1. Mature embryo sac observations. Supplementary Figure S2. STT observations. Supplementary Figure S3. Comparison of the PTB1 cdna with that of the mutant.
More informationBiological Roles of Cytokinins
Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators
More informationLipid transfer proteins confer resistance to trichothecenes
Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance
More informationIllegitimate translation causes unexpected gene expression from on-target out-of-frame alleles
Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN
More informationGENETICS 603 Exam 3, Dec 2, 2011
GENETICS 603 Exam 3, Dec 2, 2011 Name I. Chromosome IV in Drosophila is a very small chromosome with few genes. Fruitflies that are trisomic for chromosome IV have no apparent phenotypic abnormalities,
More informationSOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent Seed Germination Downstream of PIL5 W
The Plant Cell, Vol. 20: 1260 1277, May 2008, www.plantcell.org ª 2008 American Society of Plant Biologists SOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent
More informationLiu, Yang (2012) The characterization of a novel abscission-related gene in Arabidopsis thaliana. PhD thesis, University of Nottingham.
Liu, Yang (2012) The characterization of a novel abscission-related gene in Arabidopsis thaliana. PhD thesis, University of Nottingham. Access from the University of Nottingham repository: http://eprints.nottingham.ac.uk/12529/3/thesis_part_2_final.pdf
More informationDEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA
DEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA CHASE BALLARD LINDA EAN HECTOR LOPEZ DR. JOANNA WERNER-FRACZEK IN COLLABORATION WITH DR. PATRICIA SPRINGER S LAB AT UCR AND ROBERT KOBLE PURPOSE OF RESEARCH
More informationMutation of the cytosolic ribosomal protein-encoding RPS10B gene affects shoot meristematic function in Arabidopsis
Stirnberg et al. BMC Plant Biology 2012, 12:160 RESEARCH ARTICLE Mutation of the cytosolic ribosomal protein-encoding RPS10B gene affects shoot meristematic function in Arabidopsis Petra Stirnberg 1, Jin-Ping
More informationBreeding Values and Inbreeding. Breeding Values and Inbreeding
Breeding Values and Inbreeding Genotypic Values For the bi-allelic single locus case, we previously defined the mean genotypic (or equivalently the mean phenotypic values) to be a if genotype is A 2 A
More informationTime allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2017-2018 GENETICS BIO-5009A Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section
More informationExam 1 PBG430/
1 Exam 1 PBG430/530 2014 1. You read that the genome size of maize is 2,300 Mb and that in this species 2n = 20. This means that there are 2,300 Mb of DNA in a cell that is a. n (e.g. gamete) b. 2n (e.g.
More information1 Errors in mitosis and meiosis can result in chromosomal abnormalities.
Slide 1 / 21 1 Errors in mitosis and meiosis can result in chromosomal abnormalities. a. Identify and describe a common chromosomal mutation. Slide 2 / 21 Errors in mitosis and meiosis can result in chromosomal
More informationActions of auxin. Hormones: communicating with chemicals History: Discovery of a growth substance (hormone- auxin)
Hormones: communicating with chemicals History- discovery of plant hormone. Auxin Concepts of hormones Auxin levels are regulated by synthesis/degradation, transport, compartmentation, conjugation. Polar
More information