Supplemental Data. Hou et al. (2016). Plant Cell /tpc

Transcription

1 Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc A Distance to 1 st nt of start codon Distance to 1 st nt of stop codon B Normalized PARE abundance 8 14 nt 17 nt Frame1 Arabidopsis inflorescence Frame2 Frame3 12 WT_rep1 12 WT_rep2-51 (ATG) (TAA/TGA/TAG) +37 Percentage (%) % 31% 32% % 31% 31% % 3% 32% Frame 5 UTR 3 nt CDS 3 UTR AAAAA C Percentage (%) P =.2 P =.6 38% 31% 32% Frame Supplemental Figure Truncated RNA Ends Show a 3-nt Periodicity and Significant Frame Bias in the CDS. (A) The positional distribution of 5 ends of truncated RNA mapped to the regions surrounding the start codon and the stop codon of Arabidopsis. Three replicates of PARE data were generated from wild-type Arabidopsis inflorescences. Blue bars indicate positions falling in the translational frame (frame 1) of annotated CDS if 5 - truncated ends represent the 5 edge of a ribosome and the distance from the 5 edge of a ribosome to the first base of the A site is 17 nt. Red arrowheads beneath the graphs represent the first nt in the start codon (left side) or the stop codon (right side). The illustration at the bottom shows the size of an mrna fragment protected by a plant ribosome and the position of ribosomes decoding start and stop codons. CDS, coding sequence (dark blue); UTR, untranslated region (light blue); E, the exit site; P, the peptidyl site; A, the aminoacyl site. (B) The proportion of 5 -truncated RNA ends mapped to complete CDS in three frames. frame 1, the translational frame of TAIR annotated CDS; frames 2 and 3, two frames offset +1 and +2 from frame 1. (C) Statistical test of the distribution of PARE in three frames. Each bar represents the mean of three replicates ± SE (two-tailed Student s t test, n = 3). 1

2 Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc Arabidopsis SAMDC 5 UTR Distance to 1 st nt of stop codon (nt) Supplemental Figure 2. Overaccumulation of 5 -Truncated RNA Ends at the 3 End of Arabidopsis SAMDC uorf. The positional distribution of 5 ends of truncated RNA generated by PARE and ribosome-protected mrna fragments generated by Ribo-Seq in Arabidopsis SAMDC 5 UTRs. The PARE data of Arabidopsis inflorescences and the Ribo-Seq data of light-treated seedlings plotted were retrieved from the data sets published by German et al. (28) and Liu et al. (213), respectively. The PARE data of seedlings were generated by this study. The region of the CPuORF is shown as a dark blue line under the graph and the PARE and Ribo-Seq peaks at position 16 nt upstream of the uorf stop codon is highlighted in red. TP1M, tags per 1 million; TP5M, tags per 5 million. 2

3 Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc Arabidopsis bzip2 5 UTR Arabidopsis bzip11 5 UTR Arabidopsis bzip53 5 UTR Distance to 1 st nt of stop codon (nt) Supplemental Figure 3. The Comparison of PARE and Ribo-Seq Read Distribution in Arabidopsis bzip uorfs. The positional distribution of 5 ends of truncated RNA generated by PARE and ribosome-protected mrna fragments generated by Ribo-Seq in Arabidopsis bzip2, bzip11, and bzip53 5 UTRs. The PARE data of Arabidopsis inflorescences and the Ribo-Seq data of normoxic (in air) seedlings plotted were retrieved from the data sets published by German et al. (28) and Juntawong et al. (214), respectively. The PARE data of seedlings were generated by this study. Regions of CPuORFs are shown as dark blue lines under the graphs and the PARE and Ribo-Seq peaks at positions 16, 46, and 76 nt upstream of the uorf stop codon are highlighted in red. TP1M, tags per 1 million; TP5M, tags per 5 million. 3

4 Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc Peak_Index.4 1 Locus Arabidopsis inflorescences CPuORFs 6 (64) AT5G319.2 AT5G319.1 Expressed transcript AT1G AT1G AtBHLH144 Basic helix-loop-helix AT5G AT5G AdoMetDC2 AdoMetDC AT4G AT4G Expressed transcript AT3G AT3G247.1 AdoMetDC1 AdoMetDC AT1G AT1G778.1 Expressed transcript AT2G AT2G432.1 Amine oxidase AT3G AT3G Expressed transcript AT2G AT2G Expressed transcript AT5G AT5G946.1 AtBHLH143 Basic helix-loop-helix AT1G AT1G AtBHLH144 Basic helix-loop-helix AT5G AT5G528.1 Zinc finger, C3HC4-type (RING finger) AT4G AT4G TPPase AT2G AT2G AtBHLH156 Basic helix-loop-helix AT4G AT4G Expressed transcript AT1G AT1G AtERF#118 Group VI-L ERF/AP2 transcription factor AT3G AT3G Expressed transcript AT3G AT3G595.1 Amine oxidase AT5G AT5G946.1 AtBHLH143 Basic helix-loop-helix AT5G AT5G Expressed transcript AT1G AT1G Expressed transcript AT3G AT3G147.1 HAT5, HB-1, HD-ZIP-1, ATHB1Homeobox AT3G AT3G ZIK1, WNK5 MAP kinase, PPC family AT4G AT4G AtMPK22 MAP kinase, PPC family AT4G AT4G Expressed transcript AT5G AT5G AtMPK23 MAP kinase, PPC family AT5G AT5G Ankyrin repeat AT1G AT1G Putative eif-5 AT1G AT1G736.1 NMT3 Methyltransferase AT5G AT5G967.1 and.2 Expressed transcript AT5G AT5G SAUR Auxin responsive AT5G AT5G AtBHLH142, SAC51 Basic helix-loop-helix AT5G AT5G Expressed transcript AT1G AT1G Expressed transcript AT5G AT5G784.1 Ankyrin repeat AT1G AT1G615.1 Basic helix-loop-helix AT5G AT5G AtBHLH142, SAC51 Basic helix-loop-helix AT1G AT1G Expressed transcript AT4G AT4G AT-HSFB1, ATHSF4 Heat shock factor AT5G AT5G655.1 Calcium response kinase, PPC family 4.2. AT4G AT4G TPPase AT5G AT5G AtbZIP1 Basic leucine zipper AT4G AT4G GBF6, ATB2, AtbZIP11 Basic leucine zipper AT3G AT3G18.1 XPL1, NMT1, PEAMT1 Phosphoethanolamine N-methyltransferas AT3G AT3G AtbZIP53 Basic leucine zipper AT5G AT5G946.1 AtBHLH143 Basic helix-loop-helix AT2G AT2G GBF5, AtbZIP2 Basic leucine zipper AT3G AT3G AdoMetDC3 AdoMetDC AT5G511.1 AT5G51.1 AtBHLH145 Basic helix-loop-helix AT1G AT1G AtbZIP44 Basic leucine zipper AT5G AT5G AtBHLH142, SAC51 Basic helix-loop-helix AT2G AT2G AtBHLH155 Basic helix-loop-helix AT5G AT5G171.1 Expressed transcript Distance to 1 st nt of stop codon (nt) Supplemental Figure 4. Site-Specific Enrichment of 5'-Truncated RNA Ends in Arabidopsis CPuORFs Clustered heat maps of 5 -truncated RNA ends mapped in a 55-nt region upstream of CPuORF stop codons in wild-type Arabidopsis inflorescences. Arabidopsis PARE data used in this analysis were published by German et al. (German et al., 28). The first nt of the stop codon is assigned position, and the color of data points represents the Peak_Index value, which is calculated by dividing the number of PARE or Ribo-Seq starting at the position indicated by the number of total in a 31-nt flanking region. The numbers of annotated CPuORFs (indicated in parentheses) and uorfs included in heat maps are shown above the heat map. 4

5 Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc Distance to 1 st nt of stop codon (nt) Supplemental Figure 5. PARE Read Distribution in Arabidopsis uorfs with RNA Degradation Signatures Representing Ribosome Stacking at Stop Codons PARE data of Arabidopsis inflorescences and seedlings were generated by this study. Regions of uorfs are shown as dark blue lines under the graphs and the PARE peaks at positions 16, 45 and 46 nt upstream of the uorf stop codon are highlighted in red. 5

6 Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc (TP1M) PARE ( Inflorescence ) Arabidopsis CIPK6 5 UTR Ribo-seq ( Normoxia ) (TP5M) PARE ( Seedling ) Arabidopsis MYB34 5 UTR Ribo-seq ( Normoxia ) PARE ( Seedling ) Arabidopsis MYB51 5 UTR Ribo-seq ( Normoxia ) (TP5M) Distance to 1 st nt of stop codon (nt) Supplemental Figure 6. The Comparison of PARE and Ribo-Seq Read Distribution in Arabidopsis CIPK6, MYB34 and MYB51 uorfs The positional distribution of 5 ends of truncated RNA generated by PARE and ribosome-protected mrna fragments generated by Ribo-Seq in Arabidopsis CIPK6, MYB34, and MYB51 5 UTRs. The PARE data of Arabidopsis inflorescences and the Ribo-Seq data of normoxic (in air) seedlings plotted were retrieved from the data sets published by German et al. (28) and Juntawong et al. (214), respectively. The PARE data of Arabidopsis seedlings were generated by this study. Regions of CPuORFs are shown as dark blue lines under the graphs, and the PARE and Ribo-Seq peaks at positions 16, 45, and 46 nt upstream of the uorf stop codon are highlighted in red. TP1M, tags per 1 million; TP5M, tags per 5 million. 6

7 Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc CIPK6pro:UTR(ΔORF):GUS CIPK6pro:UTR(WT):GUS A B C D E I J F G H K L M N O P Q R S T U V Supplemental Figure 7. Negative Regulation of CIPK6 uorf in Reporter Gene Expression in Various Tissues (A) to (V) Histochemical staining of Arabidopsis transgenic plants carrying a GUS reporter gene driven by the Arabidopsis CIPK6 promoter with a wild-type (CIPK6pro:UTR(WT):GUS) or a deleted uorf (CIPK6pro:UTR( uorf):gus). GUS staining of seedlings (A) and (L), rosette leaves (B) to (D) and (M) to (O), cauline leaves (E) to (F) and (P) to (Q), inflorescences (G) to (H) and (R) to (S), mature flowers (I) and (T), and siliques (J) to (K) and (U) to (V). Bar = 2 mm. 7

8 Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc Arabidopsis CGS1 MTO1 region Coordinate of CDS Supplemental Figure 8. The Comparison of PARE Read Distribution with the 5 Ends of the Degradation Intermediates Previously Identified around the MTO1 Region of CGS1 The PARE data of seedlings and inflorescences plotted were generated by this study and the predominant PARE peaks are highlighted in red and marked with coordinates. The coordinates for the 5 ends of the degradation intermediates reported by Yamashita et al. (214) are indicated with black arrowheads and coordinates under the graphs. 8

9 Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc A Number of phased regions Arabidopsis seedling Size of interval (nt) B Number of phased regions Arabidopsis inflorescence (average of 3 samples) * * * * * * * * * * Size of interval (nt) C Number of phased regions Arabidopsis inflorescence (intersection of 2 samples) Size of interval (nt) Supplemental Figure 9. Phasing Analysis of PARE Peaks in the CDS. The number of CDS regions with three predominant PARE peaks arranged at intervals from 2 to 4 nt was identified with in-house PARE data from Arabidopsis inflorescences and seedlings by inhouse Perl scripts. (A) The numbers of phased regions identified in one sample of Arabidopsis seedlings are plotted. (B) The average numbers of phased regions identified in three samples of inflorescences are shown with standard errors, and the intervals with the number of phased regions significantly lower (P <.5, two-tailed Student s t test, n = 3) than that of the interval of 3 nt are indicated with an asterisk. (C) The numbers of phased regions identified repeatedly in at least two samples of inflorescences are shown in the plot of the intersection of 2 samples. 9

10 Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc Arabidopsis RING/U-box superfamily protein (AT1G142.1) (TP5M) Arabidopsis pentatricopeptide repeat protein (AT1G1683.1) (TP5M) (TP5M) Arabidopsis plastidic type I signal peptidase 2B (AT2G344.1) Arabidopsis unknown protein (AT4G ) (TP5M) Coordinate of CDS Supplemental Figure 1. The Comparison of PARE and Ribo-Seq Read Distribution in CDS Regions with 3-nt Phased PARE Peaks The positional distribution of 5 ends of truncated RNA generated by PARE and ribosome-protected mrna fragments generated by Ribo-Seq in Arabidopsis CDS regions potentially associated with stacked ribosomes. The PARE data of Arabidopsis inflorescences plotted were generated by this study, and the Ribo-Seq data of normoxic (in air) seedlings plotted were retrieved from the data set published by Juntawong et al. (214). The 3-nt phased PARE peaks and the corresponding Ribo-Seq peaks are highlighted in red with coordinates indicated above. TP5M, tags per 5 million. 1

11 Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc ORF mir39 non-cleavable site mir39 cleavable site (TP5M) Arabidopsis TAS3a (TP5M) Arabidopsis TAS3b -61 (TP5M) -88 Arabidopsis TAS3c -4 Distance to 1 st nt of non-cleavable mir39 target site Supplemental Figure 11. The Comparison of PARE and Ribo-Seq Read Distribution in Arabidopsis TAS3 Genes. The positional distribution of 5 ends of truncated RNA generated by PARE and ribosome-protected mrna fragments generated by Ribo-Seq in three Arabidopsis TAS3 genes. The PARE data of seedlings plotted were generated by this study and the Ribo-Seq data of normoxic (in air) seedlings plotted were retrieved from the data set published by Juntawong et al. (214). The predominant PARE and Ribo-Seq peaks are highlighted in red and marked with their distances to the first nucleotide of the non-cleavable mir39 target site, which is assigned position. TP5M, tags per 5 million. 11

12 Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc A ORF mir39 non-cleavable site mir39 cleavable site Arabidopsis TAS3a rep Arabidopsis TAS3a rep Arabidopsis TAS3b rep Arabidopsis TAS3b rep Distance to 1 st nt of non-cleavable mir39 target site 12

13 Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc Arabidopsis TAS3c rep Arabidopsis TAS3c rep B 8 mir159-guided cleavage 5 ends in MYB65 Distance to 1 st nt of non-cleavable mir39 target site (TP5M) WT WT rdr6 ago7 WT rdr6 ago7 rep1 rep2 Supplemental Figure 12. Three Arabidopsis TAS3 Genes Accumulate AGO7-Dependent but RDR6- Independent Phased 5 -Truncated RNA Ends Upstream of Non-Cleavable mir39 Target Sites. (A) Comparison of 5 -truncated RNA ends generated in the region upstream of the non-cleavable mir39 target site of three TAS3 genes in wild type (WT), rdr6 and ago7 seedlings with two replicates of PARE data (rep1 and rep2). The predominant PARE peaks are highlighted in red and marked with their distances to the first nucleotide of non-cleavable mir39 target sites, which are assigned position. TP5M, tags per 5 million. (B) The normalized abundance of the mir159-guided cleavage 5 ends of MYB65 is used as the control for PARE library construction and sequencing. TP5M, tags per 5 million. 13

14 Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc Supplemental Table 1. Sequences of Primers for Cloning, Modified RLM 5 RACE, qrt-pcr and Probes for RNA Gel Blot Analysis ID Sequence (5-3 ) Primers for RLM 5' RACE TAS3a-RACE-R TAS3a-RACE-nested-R BZIP2-RACE-R BZIP11-RACE-R MYB65-RACE-R Primers for cloning MYB34-5 UTR-F MYB34-5 UTR-R MYB51-5 UTR-F MYB51-5 UTR-R CIPK6-pro+5 UTR(1.2kb)-F CIPK6-pro+5 UTR(1.2kb)-R Primers for qrt-pcr TAS3a-QF TAS3a-QR GUS-QF GUS-QR UBQ5-QF UBQ5-QR Probes for RNA gel blot TAS3a-5 D2(-)-as U6-as Restriction sites for cloning are underlined CTATATTGAGAAGAGATAGAATAGAATC ACGAGAAAATAATAAAACGTTTAGAAAG TGACGACGGAGTCCGACGGGTTA TCCTCCGATCCTGACGACGTTTG CAGCGACCAAACAGGAGGCATATTG CATGCCATGGAGAATTATAAAAAAAAAAC CATGCCATGGCTCTCTGCTCTT CATGCCATGGGTAACACAAACAGTT CATGCCATGGTCTTGATTCTTCAAA ATCCACCCAAACGGATAAAAATTA GGTTTTTTACTTTACAACGATGATTAGA AGGAAAACATAACCTCCGTGATG TAACACCGCTTTATCATTGAAACTG TGGCCTGGCAGGAGAAACT CGTATCCACGCCGTATTCG GCCGACTACAACATCCAGAAGG TGCAACACAGCGAGCTTAACC ACCTCTAATTCGTTCGAGTCA TCATCCTTGCGCAGGGGCCA 14