Lecture 18 June 2 nd, Gene Expression Regulation Mutations

Save this PDF as:

Size: px
Start display at page:

Download "Lecture 18 June 2 nd, Gene Expression Regulation Mutations"


1 Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations

2 From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase (RT) DNA Protein Inserts into host (e.g. human cell) genome (INTEGRATION) mrna RT cdna (Complementary DNA)

3 From Gene to Protein: Mutations DNA* RNA* PROTEIN* Mutation are changes in genetic material of a cell. Chromosomal Mutations: (e.g. Duplications and deletions) large-scale mutations: multiple genes are affected Multiple phenotypes Point Mutations: 1 base pair (bp) substitution in one gene Missense mutation 1 bp change different a.a. encoded UGC (cys) UGG (trp) Nonsense mutation 1 bp change STOP codon UGC (cys) UGA (STOP) Silent mutation 1 bp change codon is the same (due to wobble) UGC (cys) UGU (cys)

4 From Gene to Protein: Mutations DNA* RNA* PROTEIN* Frameshift Mutations: Insert or Delete a basepair Frameshift in ORF Frameshift in ORF Insert or delete an a.a.

5 From Gene to Protein: Mutations (silent)

6 From Gene to Protein: Mutations What about mutations that are not in the coding sequence? Affect mrna synthesis - promoter - termination - splicing Affect Translation - mutation in RBS (Prok) - Stability of mrna (3 UTR polyaaa tail)

7 Regulation of Gene Expression Every cell in the body has the same DNA So how can cells be so different from one another?? (cell shape, function, etc) Transcription Gene Regulation!!! DNA RNA

8 Regulation of Gene Expression Transcriptional UNIT (DNA!) Promoter 1 st base of mrna Terminator P Start Stop T 5 UTR Coding Region 3 UTR Promoter is very important RNA polymerase binds choses sense/template strand Can Determine how active a gene will be!!

9 Regulation of Gene Expression Promoters DNA sequence that RNA polymerase binds Good Promoter Poor Promoter RNA Pol binds tightly and lots of mrna is made RNA Pol binds poorly and little of mrna is made Encoded in the DNA of the promoter how often a gene is transcribed Promoter sequences are constantly changing from: good to poor HOW? Allosteric Regulation!! Regulation of RNA polymerase Transcriptional Activator: Recruit RNA polymerase to a promotoer: ON! Transcriptional Repressor: Block RNA polymerase: OFF!

10 Regulation of Gene Expression Transcriptional Activators and Repressors Repressor (TR) can bind at the promoter or a nearby sequence and block RNA pol : turns gene OFF! RNA Pol P ORF

11 Regulation of Gene Expression Transcriptional Activators and Repressors Repressor (TR) can bind at the promoter or a nearby sequence and block RNA pol : turns gene OFF! RNA Pol TR P X ORF RNA Pol P TR X ORF TR RNA Pol P X Binding site for repressor ORF

12 Regulation of Gene Expression Transcriptional Activators and Repressors Activator (TA) Binds to specific sequence, next to promoter, recruits RNA pol to that promoter turns gene ON! TA RNA Pol P ORF Binding site for activator

13 Regulation of Gene Expression Prokaryotic Gene Regulation A typical scenario: An individual bacteria can respond to environmental change by regulating gene expression How can negative feedback inhibition affect more than one gene?

14 Regulation of Gene Expression: Prokaryotic Prokaryotic Gene Regulation Normal food is glucose; Lactose is polymer of galactose-glucose so the amount of lactose permease (a receptor molecule which brings lactose inside cell) is normally low at the cell surface Lactose ( ) is low Lactose ( ) is high Allosteric Regulation! Bacteria will induce multiple genes which take advantage of lactose as a food source

15 Regulation of Gene Expression: Prokaryotic Prokaryotic Gene Regulation: OPERONS The Lac OPERON: Inducible Operon lacz: lacy: laca: Encodes beta-galactosidase (cleaves galactose-glucose into separate molecules) Encodes lactose permease (transports lactose inside cell) Encodes lactose transacetylase (helps cell use lactose) Operator: Controls RNA Pol access to gene!!

16 Regulation of Gene Expression: Prokaryotic Prokaryotic Gene Regulation: OPERONS The Lac OPERON: Inducible Operon Gene for repressor is adjacent to Lac operon!

17 Regulation of Gene Expression: Prokaryotic Prokaryotic Gene Regulation: OPERONS The Lac OPERON: Inducible Operon When Lactose is absent: default is OFF! No Transcription!

18 Regulation of Gene Expression: Prokaryotic Prokaryotic Gene Regulation: OPERONS The Lac OPERON: Inducible Operon When Lactose is present: ON! Lactose Binds repressor Transcription happens!

19 Regulation of Gene Expression: Prokaryotic Prokaryotic Gene Regulation: OPERONS The Tryptophan OPERON: Repressible Operon When Tryptophan is absent: default is ON! Transcription happens!

20 Regulation of Gene Expression: Prokaryotic Prokaryotic Gene Regulation: OPERONS The Tryptophan OPERON: Repressible Operon When Tryptophan is present: OFF! No Transcription!

21 Regulation of Gene Expression: Eukaryotes Organization of the Eukaryotic Genome Compared to simple Prokaryotes Much Larger Genome Multicellular Cell specialization (due to cell differentiation?) Has > 25,000 Genes Lots of DNA that does not code for RNA or protein KEY! Multiple levels of Gene Expression Regulation!

22 Regulation of Gene Expression: Eukaryotes Eukaryotic Gene Regulation No Operons 3 polymerases RNA pol I, II, and III RNA Pol s can t bind DNA alone Require Transcription factors!! DNA Promoter sequences don t act alone Proximal Control Sequence Enhancer Sequences Silencer Sequences Chromatin regulation: access to gene by RNA polymerase

23 Regulation of Gene Expression: Eukaryotes Transcription factors Bind to the minor and major grooves of the DNA Double helix Transcription factor DNA binding motifs (examples) DNA Sequence Specific!! Recruit RNA pol turn genes ON! Zinc helps stabilize a finger like protrusion that binds DNA at the major groove Helix-turn-Helix Zinc finger

24 Regulation of Gene Expression: Eukaryotes DNA Regulatory Elements (sequences!) Proximal Control Elements right next to promoter sequence transcription factors bind here allow for multiple genes in one pathway to be turned on HOW? Can share similar DNA Seq. in front of promoters for different genes Example: SRE sequences (stress response element) transcription factors will bind SRE element and turn multiple genes

25 Regulation of Gene Expression: Eukaryotes DNA Regulatory Elements (sequences!) Enhancers Transcription activators DNA sequences sometimes 1000 s of by away Recruit transcription factors turn genes ON! Bend DNA to bring activators near transcription factors and RNA pol

26 Regulation of Gene Expression: Eukaryotes Enhancers (transcription activators)

27 Regulation of Gene Expression: Eukaryotes DNA Regulatory Elements (sequences!) Enhancers Transcription activators DNA sequences sometimes 1000 s of by away Recruit transcription factors turn genes ON! Bend DNA to bring activators near transcription factors and RNA pol Silencers Transcription repressors 1000 s bp away inhibit transcription turn genes OFF!

28 Regulation of Gene Expression: Eukaryotes Chromatin DNA-Protein (Histones) complex DNA packing Nucleosome basic unit of DNA packing DNA wrapped around histones supercoiling DNA double Helix 2 M Histones 10 M Beads on a string (TEM) Linker DNA (string) Nucleosome Note: Chromosome (in metaphase of cell cycle) can be 1-2 microns in diameter!!

29 Regulation of Gene Expression: Eukaryotes How Can DNA Packing affect Gene Expression? Physically hide genes Affects accessibility! Block access to RNA Polymerase Transcription factors must break DNA-Histone interactions and recruit RNA Pol.

Chapter 18: Control of Gene Expression

Chapter 18: Control of Gene Expression Chapter 18: Control of Gene Expression 海洋生物研究所 曾令銘 海事大樓 426 室分機 : 5326 Differential Expression of Genes Prokaryotes and eukaryotes precisely regulate gene expression in response to environmental conditions

More information


CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter

More information

Regulation of Gene Expression

Regulation of Gene Expression Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

Chapter 15 Active Reading Guide Regulation of Gene Expression

Chapter 15 Active Reading Guide Regulation of Gene Expression Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,

More information

Chapter 18 Regulation of Gene Expression

Chapter 18 Regulation of Gene Expression Chapter 18 Regulation of Gene Expression Differential gene expression Every somatic cell in an individual organism contains the same genetic information and replicated from the same original fertilized

More information

Control of Prokaryotic (Bacterial) Gene Expression. AP Biology

Control of Prokaryotic (Bacterial) Gene Expression. AP Biology Control of Prokaryotic (Bacterial) Gene Expression Figure 18.1 How can this fish s eyes see equally well in both air and water? Aka. Quatro ojas Regulation of Gene Expression: Prokaryotes and eukaryotes

More information

Prokaryotic Gene Expression (Learning Objectives)

Prokaryotic Gene Expression (Learning Objectives) Prokaryotic Gene Expression (Learning Objectives) 1. Learn how bacteria respond to changes of metabolites in their environment: short-term and longer-term. 2. Compare and contrast transcriptional control

More information


UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11 UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11 REVIEW: Signals that Start and Stop Transcription and Translation BUT, HOW DO CELLS CONTROL WHICH GENES ARE EXPRESSED AND WHEN? First of

More information

Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:

Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail

More information

Multiple Choice Review- Eukaryotic Gene Expression

Multiple Choice Review- Eukaryotic Gene Expression Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule

More information

Regulation of Gene Expression in Bacteria and Their Viruses

Regulation of Gene Expression in Bacteria and Their Viruses 11 Regulation of Gene Expression in Bacteria and Their Viruses WORKING WITH THE FIGURES 1. Compare the structure of IPTG shown in Figure 11-7 with the structure of galactose shown in Figure 11-5. Why is

More information

Regulation of Gene Expression at the level of Transcription

Regulation of Gene Expression at the level of Transcription Regulation of Gene Expression at the level of Transcription (examples are mostly bacterial) Diarmaid Hughes ICM/Microbiology VT2009 Regulation of Gene Expression at the level of Transcription (examples

More information

Prokaryotic Gene Expression (Learning Objectives)

Prokaryotic Gene Expression (Learning Objectives) Prokaryotic Gene Expression (Learning Objectives) 1. Learn how bacteria respond to changes of metabolites in their environment: short-term and longer-term. 2. Compare and contrast transcriptional control

More information

Chapters 12&13 Notes: DNA, RNA & Protein Synthesis

Chapters 12&13 Notes: DNA, RNA & Protein Synthesis Chapters 12&13 Notes: DNA, RNA & Protein Synthesis Name Period Words to Know: nucleotides, DNA, complementary base pairing, replication, genes, proteins, mrna, rrna, trna, transcription, translation, codon,

More information

Eukaryotic Gene Expression

Eukaryotic Gene Expression Eukaryotic Gene Expression Lectures 22-23 Several Features Distinguish Eukaryotic Processes From Mechanisms in Bacteria 123 Eukaryotic Gene Expression Several Features Distinguish Eukaryotic Processes

More information

Controllo dell espressione genica: procarioti

Controllo dell espressione genica: procarioti Controllo dell espressione genica: procarioti 1. Operon Regolazione dell espressione nei procarioti 2. Regulation mostly on the transcriptional level. POSITIVE: energy saving, regulation of only one mrna

More information


PROTEIN SYNTHESIS INTRO MR. POMERANTZ Page 1 of 6 Protein synthesis Intro. Use the text book to help properly answer the following questions 1. RNA differs from DNA in that RNA a. is single-stranded. c. contains the nitrogen

More information

Eukaryotic vs. Prokaryotic genes

Eukaryotic vs. Prokaryotic genes BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 18: Eukaryotic genes http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Eukaryotic vs. Prokaryotic genes Like in prokaryotes,

More information

DNA Technology, Bacteria, Virus and Meiosis Test REVIEW

DNA Technology, Bacteria, Virus and Meiosis Test REVIEW Be prepared to turn in a completed test review before your test. In addition to the questions below you should be able to make and analyze a plasmid map. Prokaryotic Gene Regulation 1. What is meant by

More information

The Making of the Fittest: Evolving Switches, Evolving Bodies

The Making of the Fittest: Evolving Switches, Evolving Bodies INTRODUCTION MODELING THE REGULATORY SWITCHES OF THE PITX1 GENE IN STICKLEBACK FISH The types and amounts of proteins produced by a given cell in the body are very important and carefully regulated. Transcribing

More information

Week 10! !

Week 10! ! Week 10! 10-24-2013! Annotated Bibliography! Sources of papers! 3 papers! Peer-reviewed scientific literature (no review articles)! No more than 2 from:! the same author! the same journal! 2 of the 3 must

More information

Ch 10, 11 &14 Preview

Ch 10, 11 &14 Preview Ch 10, 11 &14 Preview Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Why did the original one-gene, one-enzyme hypothesis have to be modified? a. Some

More information

Chapter 20. Initiation of transcription. Eukaryotic transcription initiation

Chapter 20. Initiation of transcription. Eukaryotic transcription initiation Chapter 20. Initiation of transcription Eukaryotic transcription initiation 2003. 5.22 Prokaryotic vs eukaryotic Bacteria = one RNA polymerase Eukaryotes have three RNA polymerases (I, II, and III) in

More information

Lecture 4: Transcription networks basic concepts

Lecture 4: Transcription networks basic concepts Lecture 4: Transcription networks basic concepts - Activators and repressors - Input functions; Logic input functions; Multidimensional input functions - Dynamics and response time 2.1 Introduction The

More information

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology 2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the

More information

Slide 1 / 54. Gene Expression in Eukaryotic cells

Slide 1 / 54. Gene Expression in Eukaryotic cells Slide 1 / 54 Gene Expression in Eukaryotic cells Slide 2 / 54 Central Dogma DNA is the the genetic material of the eukaryotic cell. Watson & Crick worked out the structure of DNA as a double helix. According

More information

Old FINAL EXAM BIO409/509 NAME. Please number your answers and write them on the attached, lined paper.

Old FINAL EXAM BIO409/509 NAME. Please number your answers and write them on the attached, lined paper. Old FINAL EXAM BIO409/509 NAME Please number your answers and write them on the attached, lined paper. Gene expression can be regulated at several steps. Describe one example for each of the following:

More information

Videos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.

Videos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu. Translation Translation Videos Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.be/itsb2sqr-r0 Translation Translation The

More information

Gene Control Mechanisms at Transcription and Translation Levels

Gene Control Mechanisms at Transcription and Translation Levels Gene Control Mechanisms at Transcription and Translation Levels Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 9

More information

Three types of RNA polymerase in eukaryotic nuclei

Three types of RNA polymerase in eukaryotic nuclei Three types of RNA polymerase in eukaryotic nuclei Type Location RNA synthesized Effect of α-amanitin I Nucleolus Pre-rRNA for 18,.8 and 8S rrnas Insensitive II Nucleoplasm Pre-mRNA, some snrnas Sensitive

More information

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17. Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:

More information

Chapters 7 & 8. Weaver, 2/e. Mol Biol X107A.

Chapters 7 & 8. Weaver, 2/e. Mol Biol X107A. Chapters 7 & 8. Weaver, 2/e. Mol Biol X107A. Ch 7. Operons: Fine control of prokaryotic transcription. Ch 8. Major shifts in prokaryotic transcription. A. Introduction... 1 B. Terms... 2 C. Lac operon:

More information

Genetics 304 Lecture 6

Genetics 304 Lecture 6 Genetics 304 Lecture 6 00/01/27 Assigned Readings Busby, S. and R.H. Ebright (1994). Promoter structure, promoter recognition, and transcription activation in prokaryotes. Cell 79:743-746. Reed, W.L. and

More information

RNA Processing: Eukaryotic mrnas

RNA Processing: Eukaryotic mrnas RNA Processing: Eukaryotic mrnas Eukaryotic mrnas have three main parts (Figure 13.8): 5! untranslated region (5! UTR), varies in length. The coding sequence specifies the amino acid sequence of the protein

More information

A Boolean Network Model of the L-Arabinose Operon

A Boolean Network Model of the L-Arabinose Operon Clemson University TigerPrints All Theses Theses 5-2016 A Boolean Network Model of the L-Arabinose Operon Andy Jenkins Clemson University, leej@g.clemson.edu Follow this and additional works at: http://tigerprints.clemson.edu/all_theses

More information

Stochastic simulations

Stochastic simulations Stochastic simulations Application to molecular networks Literature overview Noise in genetic networks Origins How to measure and distinguish between the two types of noise (intrinsic vs extrinsic)? What

More information

Biology st lecture for test two/thursday

Biology st lecture for test two/thursday Biology 101 2 25 99 1 st lecture for test two/thursday DNA Structure and Replication We have 23 paternal chromosomes and 23 maternal chromosomes from dad and mom. The chromosomes are chosen randomly on

More information

Gene Expression Transcription Pogil Answer Key

Gene Expression Transcription Pogil Answer Key Transcription Pogil Answer Key Free PDF ebook Download: Transcription Pogil Answer Key Download or Read Online ebook gene expression transcription pogil answer key in PDF Format From The Best User Guide

More information

Stochastic simulations!

Stochastic simulations! Stochastic simulations! Application to biomolecular networks! Literature overview Noise in genetic networks! Origins! How to measure the noise and distinguish between the two sources of noise (intrinsic

More information

Предсказание и анализ промотерных последовательностей. Татьяна Татаринова

Предсказание и анализ промотерных последовательностей. Татьяна Татаринова Предсказание и анализ промотерных последовательностей Татьяна Татаринова Eukaryotic Transcription 2 Initiation Promoter: the DNA sequence that initially binds the RNA polymerase The structure of promoter-polymerase

More information

nucleus: DNA & chromosomes

nucleus: DNA & chromosomes nucleus: DNA & chromosomes chapter 5 nuclear organization nuclear structure nuclear envelope nucleoplasm nuclear matrix nucleolus nuclear envelope nucleolus nuclear matrix nucleoplasm nuclear pore nuclear

More information

AQA Biology A-level. relationships between organisms. Notes.

AQA Biology A-level. relationships between organisms. Notes. AQA Biology A-level Topic 4: Genetic information, variation and relationships between organisms Notes DNA, genes and chromosomes Both DNA and RNA carry information, for instance DNA holds genetic information

More information

Lecture 6: The feed-forward loop (FFL) network motif

Lecture 6: The feed-forward loop (FFL) network motif Lecture 6: The feed-forward loop (FFL) network motif Chapter 4 of Alon x 4. Introduction x z y z y Feed-forward loop (FFL) a= 3-node feedback loop (3Loop) a=3 Fig 4.a The feed-forward loop (FFL) and the

More information

Lecture 1: Biomolecular Modeling

Lecture 1: Biomolecular Modeling Lecture 1: Biomolecular Modeling Richard M. Murray Caltech CDS/BE Goals: Motivate the role of dynamics and feedback in the the cell Provide mathematical tools for analyzing and predicting the dynamics

More information

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16 Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection

More information

Cellular Neuroanatomy I The Prototypical Neuron: Soma. Reading: BCP Chapter 2

Cellular Neuroanatomy I The Prototypical Neuron: Soma. Reading: BCP Chapter 2 Cellular Neuroanatomy I The Prototypical Neuron: Soma Reading: BCP Chapter 2 Functional Unit of the Nervous System The functional unit of the nervous system is the neuron. Neurons are cells specialized

More information

Objective 3.01 (DNA, RNA and Protein Synthesis)

Objective 3.01 (DNA, RNA and Protein Synthesis) Objective 3.01 (DNA, RNA and Protein Synthesis) DNA Structure o Discovered by Watson and Crick o Double-stranded o Shape is a double helix (twisted ladder) o Made of chains of nucleotides: o Has four types

More information

Special Topics on Genetics

Special Topics on Genetics ARISTOTLE UNIVERSITY OF THESSALONIKI OPEN COURSES Section 9: Transposable elements Drosopoulou E License The offered educational material is subject to Creative Commons licensing. For educational material,

More information

Vital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655)

Vital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655) We still consider the E. coli genome as a fairly typical bacterial genome, and given the extensive information available about this organism and it's lifestyle, the E. coli genome is a useful point of

More information

On the Use of the Hill Functions in Mathematical Models of Gene Regulatory Networks

On the Use of the Hill Functions in Mathematical Models of Gene Regulatory Networks Math. Model. Nat. Phenom. Vol. 3, No. 2, 2008, pp. 85-97 On the Use of the Hill Functions in Mathematical Models of Gene Regulatory Networks M. Santillán 1 Centro de Investigación y de Estudios Avanzados

More information

Sequence analysis and comparison

Sequence analysis and comparison The aim with sequence identification: Sequence analysis and comparison Marjolein Thunnissen Lund September 2012 Is there any known protein sequence that is homologous to mine? Are there any other species

More information

Midterm 1. Average score: 74.4 Median score: 77

Midterm 1. Average score: 74.4 Median score: 77 Midterm 1 Average score: 74.4 Median score: 77 NAME: TA (circle one) Jody Westbrook or Jessica Piel Section (circle one) Tue Wed Thur MCB 141 First Midterm Feb. 21, 2008 Only answer 4 of these 5 problems.

More information

Honors Biology Fall Final Exam Study Guide

Honors Biology Fall Final Exam Study Guide Honors Biology Fall Final Exam Study Guide Helpful Information: Exam has 100 multiple choice questions. Be ready with pencils and a four-function calculator on the day of the test. Review ALL vocabulary,

More information

Viroids. NOMENCLATURE Replication Pathogenicity. Nabil Killiny

Viroids. NOMENCLATURE Replication Pathogenicity. Nabil Killiny Viroids NOMENCLATURE Replication Pathogenicity Nabil Killiny A VIROID is A VIR(virus) OID(like) particle. Viroids are sub-viruses composed exclusively of a single circular strand of nucleic acid (RNA)

More information

Analysis and modelling of protein interaction networks

Analysis and modelling of protein interaction networks Analysis and modelling of protein interaction networks - A study of the two-hybrid experiment Karin Stibius Jensen Analysis and modelling of protein interaction networks - A study of the two-hybrid experiment

More information

Nuclear Functional Organization

Nuclear Functional Organization Lecture #4 The Cell as a Machine Nuclear Functional Organization Background readings from Chapters 4 of Alberts et al. Molecular Biology of the Cell (4 th Edition) Description of Functions by Biosystems

More information

Measuring TF-DNA interactions

Measuring TF-DNA interactions Measuring TF-DNA interactions How is Biological Complexity Achieved? Mediated by Transcription Factors (TFs) 2 Regulation of Gene Expression by Transcription Factors TF trans-acting factors TF TF TF TF

More information

Bio/Life: Cell Biology

Bio/Life: Cell Biology Bio/Life: Cell Biology 1a The fundamental life processes of plants and animals depend on a variety of chemical reactions that occur in specialized areas of the organism's cells. As a basis for understanding

More information

1. Contains the sugar ribose instead of deoxyribose. 2. Single-stranded instead of double stranded. 3. Contains uracil in place of thymine.

1. Contains the sugar ribose instead of deoxyribose. 2. Single-stranded instead of double stranded. 3. Contains uracil in place of thymine. Protein Synthesis & Mutations RNA 1. Contains the sugar ribose instead of deoxyribose. 2. Single-stranded instead of double stranded. 3. Contains uracil in place of thymine. RNA Contains: 1. Adenine 2.

More information

Chapter 6- An Introduction to Metabolism*

Chapter 6- An Introduction to Metabolism* Chapter 6- An Introduction to Metabolism* *Lecture notes are to be used as a study guide only and do not represent the comprehensive information you will need to know for the exams. The Energy of Life

More information

Simulation of Chemical Reactions

Simulation of Chemical Reactions Simulation of Chemical Reactions Cameron Finucane & Alejandro Ribeiro Dept. of Electrical and Systems Engineering University of Pennsylvania aribeiro@seas.upenn.edu http://www.seas.upenn.edu/users/~aribeiro/

More information

Student Learning Outcomes: Nucleus distinguishes Eukaryotes from Prokaryotes

Student Learning Outcomes: Nucleus distinguishes Eukaryotes from Prokaryotes 9 The Nucleus Student Learning Outcomes: Nucleus distinguishes Eukaryotes from Prokaryotes Explain general structures of Nuclear Envelope, Nuclear Lamina, Nuclear Pore Complex Explain movement of proteins

More information

The activities of eukaryotic replication origins in chromatin

The activities of eukaryotic replication origins in chromatin Biochimica et Biophysica Acta 1677 (2004) 142 157 Review The activities of eukaryotic replication origins in chromatin Michael Weinreich a, *, Madeleine A. Palacios DeBeer b, Catherine A. Fox b, * a Laboratory

More information

Biology Semester 1 Study Guide

Biology Semester 1 Study Guide Name Per Date Biology Semester 1 Study Guide The following Gizmos meet the standards assessed by the Biology EOC and should be reviewed during the first semester: 1. Rabbit Population by Season Gizmo 2.

More information

Biofundamentals, Fall 2008 FINAL

Biofundamentals, Fall 2008 FINAL Biofundamentals, Fall 2008 FINAL Name: 1. The following processes are required to produce a transcription factor... A. transcription! B. translation C. transcription and translation D. replication 2. How

More information

Describe the process of cell division in prokaryotic cells. The Cell Cycle

Describe the process of cell division in prokaryotic cells. The Cell Cycle The Cell Cycle Objective # 1 In this topic we will examine the cell cycle, the series of changes that a cell goes through from one division to the next. We will pay particular attention to how the genetic

More information

Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1

Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1 Name I. Multiple Choice (1 point each) Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1 B 1. Which is possessed by eukaryotes but not by prokaryotes? A. Cell wall B. Distinct nucleus

More information

MATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME

MATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME MATHEMATICAL MODELING AND THE HUMAN GENOME Hilary S. Booth Australian National University, Australia Keywords: Human genome, DNA, bioinformatics, sequence analysis, evolution. Contents 1. Introduction:

More information

Regulatory Region of the Divergent Klebsiella pneumoniae

Regulatory Region of the Divergent Klebsiella pneumoniae JOURNAL OF BACTEROLOGY, Sept. 1985, p. 858-862 0021-9193/85/090858-05$02.00/0 Copyright C 1985, American Society for Microbiology Vol. 163, No. 3 Regulatory Region of the Divergent Klebsiella pneumoniae

More information

Information Content in Genetics:

Information Content in Genetics: Information Content in Genetics: DNA, RNA and protein mrna translation into protein (protein synthesis) Francis Crick, 1958 [Crick, F. H. C. in Symp. Soc. Exp. Biol., The Biological Replication of Macromolecules,

More information

Genome Evolution: Overview

Genome Evolution: Overview Genome Evolution: Overview J Bruce Walsh, University of Arizona, Tucson, Arizona, USA The genome is the total genetic constitution of an organism. Understanding of the structure and evolution of genomes

More information

2. Yeast two-hybrid system

2. Yeast two-hybrid system 2. Yeast two-hybrid system I. Process workflow a. Mating of haploid two-hybrid strains on YPD plates b. Replica-plating of diploids on selective plates c. Two-hydrid experiment plating on selective plates

More information

Written Exam 15 December Course name: Introduction to Systems Biology Course no

Written Exam 15 December Course name: Introduction to Systems Biology Course no Technical University of Denmark Written Exam 15 December 2008 Course name: Introduction to Systems Biology Course no. 27041 Aids allowed: Open book exam Provide your answers and calculations on separate

More information

Random Boolean Networks

Random Boolean Networks Random Boolean Networks Boolean network definition The first Boolean networks were proposed by Stuart A. Kauffman in 1969, as random models of genetic regulatory networks (Kauffman 1969, 1993). A Random

More information

Cell Division: the process of copying and dividing entire cells The cell grows, prepares for division, and then divides to form new daughter cells.

Cell Division: the process of copying and dividing entire cells The cell grows, prepares for division, and then divides to form new daughter cells. Mitosis & Meiosis SC.912.L.16.17 Compare and contrast mitosis and meiosis and relate to the processes of sexual and asexual reproduction and their consequences for genetic variation. 1. Students will describe

More information

5.1. Cells have distinct phases of growth, reproduction, and normal functions. G 1. Cell Growth and Division CHAPTER 5 THE CELL CYCLE KEY CONCEPT

5.1. Cells have distinct phases of growth, reproduction, and normal functions. G 1. Cell Growth and Division CHAPTER 5 THE CELL CYCLE KEY CONCEPT SECTION 5.1 THE CELL CYCLE Study Guide KEY CONCEPT Cells have distinct phases of growth, reproduction, and normal functions. VOCABULARY cell cycle mitosis cytokinesis The cell cycle has four main stages.

More information

2. Draw two water molecules. Using a dotted line, show a hydrogen bond that could form between them.

2. Draw two water molecules. Using a dotted line, show a hydrogen bond that could form between them. Biology Final Review Packet Directions: Answer the questions below. You may use any notes, worksheets, or your textbook to find the answers. The questions are divided up based on the different units we

More information

Describe the structure and composition of the cell membrane. (make a sketch) What does the Theory of Endosymbiosis state?

Describe the structure and composition of the cell membrane. (make a sketch) What does the Theory of Endosymbiosis state? Station 1. Analyze the nature of the relationships between structures and functions in living cells. a. Explain the role of cell organelles for both prokaryotic and eukaryotic cells, including the cell

More information

DNA, Chromosomes, and Genes

DNA, Chromosomes, and Genes N, hromosomes, and Genes 1 You have most likely already learned about deoxyribonucleic acid (N), chromosomes, and genes. You have learned that all three of these substances have something to do with heredity

More information

TRANSCRIPTOMICS. (or the analysis of the transcriptome) Mario Cáceres. Main objectives of genomics. Determine the entire DNA sequence of an organism

TRANSCRIPTOMICS. (or the analysis of the transcriptome) Mario Cáceres. Main objectives of genomics. Determine the entire DNA sequence of an organism TRANSCRIPTOMICS (or the analysis of the transcriptome) Mario Cáceres Main objectives of genomics Determine the entire DNA sequence of an organism Identify and annotate the complete set of genes encoded

More information

BIOLOGICAL PHYSICS MAJOR OPTION QUESTION SHEET 1 - will be covered in 1st of 3 supervisions

BIOLOGICAL PHYSICS MAJOR OPTION QUESTION SHEET 1 - will be covered in 1st of 3 supervisions 1 BIOLOGICAL PHYSICS MAJOR OPTION 2017 - QUESTION SHEET 1 - will be covered in 1st of 3 supervisions MODULE A Lecture 1: Intro and concepts A1 Intro (a) Roughly 2-3 kg of bacteria are in your large intestine.

More information

Bioinformatics: Network Analysis

Bioinformatics: Network Analysis Bioinformatics: Network Analysis Kinetics of Gene Regulation COMP 572 (BIOS 572 / BIOE 564) - Fall 2013 Luay Nakhleh, Rice University 1 The simplest model of gene expression involves only two steps: the

More information


CHAPTER 12 - THE CELL CYCLE (pgs ) CHAPTER 12 - THE CELL CYCLE (pgs. 228-245) CHAPTER SEVEN TARGETS I. Describe the importance of mitosis in single-celled and multi-cellular organisms. II. Explain the organization of DNA molecules and their

More information

DNA is present in such large amounts in many tissues that

DNA is present in such large amounts in many tissues that 12 2 hromosomes and Replication Section 12 2 is present in such large amounts in many tissues that it s easy to extract and analyze. But where is found in the cell? How is it organized? Where are the genes

More information

10.1 Cell Growth, Division, and Reproduction

10.1 Cell Growth, Division, and Reproduction 10.1 Cell Growth, Division, and Reproduction Lesson Objectives Explain the problems that growth causes for cells. Compare asexual and sexual reproduction. Lesson Summary Limits to Cell Size There are two

More information

Comparison of Deterministic and Stochastic Models of the lac Operon Genetic Network

Comparison of Deterministic and Stochastic Models of the lac Operon Genetic Network Biophysical Journal Volume 96 February 2009 887 906 887 Comparison of Deterministic and Stochastic Models of the lac Operon Genetic Network Michail Stamatakis* and Nikos V. Mantzaris Department of Chemical

More information

Topic 3: Genetics (Student) Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species.

Topic 3: Genetics (Student) Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species. Topic 3: Genetics (Student) 3.2 Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species. 3.2 Chromosomes 3.2.U1 Prokaryotes have one chromosome consisting of

More information

AP Biology Unit 6 Practice Test 1. A group of cells is assayed for DNA content immediately following mitosis and is found to have an average of 8

AP Biology Unit 6 Practice Test 1. A group of cells is assayed for DNA content immediately following mitosis and is found to have an average of 8 AP Biology Unit 6 Practice Test Name: 1. A group of cells is assayed for DNA content immediately following mitosis and is found to have an average of 8 picograms of DNA per nucleus. How many picograms

More information

10.2 The Process of Cell Division

10.2 The Process of Cell Division 10.2 The Process of Cell Division Lesson Objectives Describe the role of chromosomes in cell division. Name the main events of the cell cycle. Describe what happens during the four phases of mitosis. Describe

More information

Modeling network dynamics: the lac operon, a case study

Modeling network dynamics: the lac operon, a case study Modeling network dynamics: the lac operon, a case study José M. G. Vilar 1, C lin C. Guet 1,2, and Stanislas Leibler 1 1 The Rockefeller University, 1230 York Avenue, New York, NY 10021, USA 2 Dept. of

More information

GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H*" ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION

GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H* ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION FIFTH EDITION IV I ^HHk ^ttm IZTI/^Q i I II MPHBBMWBBIHB '-llwmpbi^hbwm^^pfc ' GSBHSRSBRSRRk LlML I I \l 1MB ^HP'^^MMMP" jflp^^^^^^^^st I Iv^O FROM GENES TO GENOMES %^MiM^PM^^MWi99Mi$9i0^^ ^^^^^^^^^^^^^V^^^fii^^t^i^^^^^

More information

Quantitative Measurement of Genome-wide Protein Domain Co-occurrence of Transcription Factors

Quantitative Measurement of Genome-wide Protein Domain Co-occurrence of Transcription Factors Quantitative Measurement of Genome-wide Protein Domain Co-occurrence of Transcription Factors Arli Parikesit, Peter F. Stadler, Sonja J. Prohaska Bioinformatics Group Institute of Computer Science University

More information

Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles

Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN

More information

Analysis of Escherichia coli amino acid transporters

Analysis of Escherichia coli amino acid transporters Ph.D thesis Analysis of Escherichia coli amino acid transporters Presented by Attila Szvetnik Supervisor: Dr. Miklós Kálmán Biology Ph.D School University of Szeged Bay Zoltán Foundation for Applied Research

More information

Lecture 10: Cyclins, cyclin kinases and cell division

Lecture 10: Cyclins, cyclin kinases and cell division Chem*3560 Lecture 10: Cyclins, cyclin kinases and cell division The eukaryotic cell cycle Actively growing mammalian cells divide roughly every 24 hours, and follow a precise sequence of events know as

More information

A DNA Sequence 2017/12/6 1

A DNA Sequence 2017/12/6 1 A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta

More information

The Role of RNA Editing in Dynamic Environments

The Role of RNA Editing in Dynamic Environments The Role of RNA Editing in Dynamic Environments Luis M. Rocha and Chien-Feng Huang Modeling, Algorithms and Informatics Group (CCS-3) Computer and Computational Sciences Division Los Alamos National Laboratory,

More information

Physical Biology of the Cell. Rob Phillips, Jane Kondev and Julie Theriot

Physical Biology of the Cell. Rob Phillips, Jane Kondev and Julie Theriot Physical Biology of the Cell Rob Phillips, Jane Kondev and Julie Theriot April 4, 2008 Contents 0.1 Preface................................ 14 I The Facts of Life 21 1 Why: Biology By the Numbers 23 1.1

More information