SUPPLEMENTARY INFORMATION

Transcription

1 reverse F L C Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative RT-PCR of the GFP sensor transcript carrying either the FLC 3 sequences (COOLAIR ) or rbcs3a 3 sequences. Before is RNA from seedlings that have not been in the cold, During from seedlings cold-treated for 1 days, and After seedlings that had been in the cold for 1 days and then grown for a further 7d at oc. Supplementary Figure. Features of the FLC antisense transcripts. a, The FLC genomic structure is indicated together with the structure of the sense (shown above) and antisense transcripts (shown below). b, Graphical representation of the individual 3` RACE products recovered. c, Representation of 5` RACE products. d, COOLAIR canonical splice sites in the GFP antisense transcript e, qrt-pcr quantification of FLC sense / FLC antisense (set primers) transcripts in a range of late-flowering mutants. Supplementary Figure 1. FLC is the only gene in the 5kb region showing cold-induced antisense transcripts. Signal intensity (log) for the median of a 1bp staggered window along a genomic region of 5kb of Arabidopsis chromosome V. Genomic structure of genes in the region, boxes represent exons; lines represent IGR and introns SFCA Col- FRI cold fca 317 FRI cold 315 FRI cold kb forward Supplementary Fig doi: 1.138/nature818 1

2 doi: 1.138/nature818 a 1 kb exon 1 exon 7 intron 1 b c d FLC exon7 FLCgenomic ACAATCTTCCGGTGACTCTCCCACTACTTAATTAGccacct...accttattcgtgtga FLCas ACAATCTTCCGGTGACTCTCCCACTACTTAATTAGCCAC CTTATTCGTGTGA GFPas TCACCCTTCCGGTGACTCTCCCACTACTTAATTAGCCAC CTTATTCGTGTGA GFP FLC exon7 e 35 COOLAIR - set/ubc FLC/UBC 3 relative expression Col flk fy- fpa FRI fca-9 Supplementary Figure. Features of the FLC antisense transcripts. a, The FLC genomic structure is indicated together with the structure of the sense (shown above) and antisense transcripts (shown below). b, Graphical representation of the individual 3` RACE products recovered. c, Representation of 5` RACE products. d, COOLAIR canonical splice sites in the GFP antisense transcript e, qrt-pcr quantification of FLC sense / FLC antisense (set primers) transcripts in a range of late-flowering mutants.

3 doi: 1.138/nature818 GFP mrna GFP mrna 35Sprom GFP COOLAIR 35Sprom GFP control region #5 # #78 #81 -RT control GFP mrna UBC Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative RT-PCR of the GFP sensor transcript carrying either the FLC 3 sequences (COOLAIR ) or rbcs3a 3 sequences. Before is RNA from seedlings that have not been in the cold, During from seedlings cold-treated for 1 days, and After seedlings that had been in the cold for 1 days and then grown for a further 7d at o C. 3

4 doi: 1.138/nature818 no treatment cold exposed COOLAIR LUC terminator LUC COOLAIR FLC control LUC terminator Supplementary Figure. The COOLAIR is induced by cold. Three luciferase fusions were analysed and their structure is shown schematically, together with an image of luciferase activity taken on a Berthold Technologies NightOwl II LB 983 NC 1 camera. Seedlings were given either No treatment or were Cold-treated for 1 days and matched for developmental stage. The upper panel shows a COOLAIR luciferase fusion and the expression of this is induced by 1 days of cold. The middle panel shows a FLC-luciferase translational fusion we have used previously to monitor FLC mrna levels. 1 days cold has little effect on the expression of this fusion in agreement with the effect of 1 days cold on sense FLC mrna levels. The lower panel shows a luciferase fusion driven by the At3g353 which is not cold-induced.

5 doi: 1.138/nature818 1 induced.9 fold cold cold 8 COOLAIR relative expression induced. fold induced. fold Col- FRI (sf) nrpda-, nrpdb-1 Supplementary Figure 5. Cold-induction of COOLAIR in a poliv/polv double mutant. qpcr analysis of the short COOLAIR transcript in non- treated or 1 day cold-treated seedlings. 5

6 doi: 1.138/nature818 WT vin3 COOLAIR relative expression cold exposure (days) Supplementary Figure. COOLAIR expression continues for longer in the cold in vin3. qrt-pcr quantification of relative FLC antisense transcript levels in wild-type and vin3 seedlings. Seedlings were grown for 7 days and then transferred to cold for different lengths of time and then harvested straight from the cold.