Supplemental Data. Perrella et al. (2013). Plant Cell /tpc

Size: px
Start display at page:

Download "Supplemental Data. Perrella et al. (2013). Plant Cell /tpc"

Transcription

1 Intensity Intensity Intensity Intensity Intensity Intensity C D Distance (μm) E 50 F Distance (μm) Supplemental Figure 1: Co-localization of HDC1 with HD6 and HD19 within nuclei of transiently expressing tobacco epidermis cells. High-magnification images of nuclei in tobacco (N. benthamiana) epidermal leaf cells after transient expression of GFP-HDC1 and RFP-HD6 or RFP-HD19. Each row contains the following images from left to right: bright field, GFP fluorescence, RFP fluorescence, GFP/RFP overlay, quantitative comparison GFP and RFP signals along line scan (arrows in overlay images). HDC1 co-localizes with HD6 (-C) and HD19 (D-F) in the entire nucleus (, D), in distinct speckles (-E) or in the nucleolus (C, F). Scale bar is 10 µm. 1

2 HDC1 mrn /Tub C WT hdc1-1 Pair 1 Pair 2 Pair 3 Pair 4 Tub 9 HDC1-GFP HDC1 Rubisco D hdc1-1 WT GFP-HDC1. thaliana N. tabacum WT 35S Ubi10 HDC1 HDC1 Supplemental Fig. S2 Supplemental Figure 2: Confirmation of hdc1-1 knockout and HDC1 over-expressing lines : Position of T-DN and primer pairs in the genomic DN of hdc1-1 knockout line (GI-Kat 054G03). Numbers indicate position of primer pairs used for genotyping. : HDC1 mrn in wildtype and hdc1-1 as determined by RT-PCR using the primer pairs indicated in. Tubulin 9 (Tub 9) was used as a loading control. C: Western blot with anti-hdc1 detects HDC1 in. thaliana wildtype but not in hdc1-1. Detection of the larger HDC1-GFP fusion protein transiently expressed in tobacco is shown for comparison. Rubisco (loading control) was detected by Ponceau staining. D: HDC1 mrn levels (relative to Tub 9) in two lines overexpressing HDC1 under control of 35-S or Ubiquitin-10 promoters. sterisks indicate significant differences (p < 0.001) to wild type (WT). 2

3 HDC1 mrn /RPII Germination (%) Salk_ Sail_1263_E05 C WT Salk_ Sail_1263_E Primer pair Primer pair WT Salk Sail WT Salk Sail 1263 [] /mm Supplemental Fig. S3 Supplemental Figure 3: Salk and Sail1263E05 are not hdc1 knockouts : Position of T-DN and primer pairs in the genomic DN for Salk_ and Sail_1263_E05 lines. : HDC1 mrn levels in wildtype, Salk_ and Sail_1263_E05 using the primer pairs indicated in. RpII is RN polymeraseii (loading control). sterisks indicate significant differences to the wild type (p<0.05). C: Germination rates of. thaliana wildtype (black), Salk_ (grey stripes) and Sail_1263_E05 (light grey stripes) on agar containing different concentrations of. ars are means +/- SE of at least 3 plates containing at least 50 seeds each. Note that neither of the lines shows hypersensitivity. 3

4 mrn /TU9 Control mm WT KO OX 2 DG 6 DG Supplemental Fig. S4 Supplemental Figure 4: Without HDC1 does not alter germination or progression of seedlings to vegetative stage : ppearance of young seedlings on day 6 after sowing. Wildtype (upper third of plate), hdc1-1 (centre) and OX (lower) seeds were imbibed and allowed to germinate on half strength Murashige Skoog medium without (control) or with 0.3 µm added. Pictures were taken on the same day as germination rate was scored. Note that without, number and size of seedlings is similar for all lines. : Transcript levels for embryogenesis related genes I3, FUS3 and LEC1 in wildtype (WT, black), hdc1-1 knockout (KO, white) and HDC1 over-expressing (OX, grey) seedlings 2-6 days after germination (DG). ars represent means of 4 technical qpcr replicates with mrn pooled from 50 seedlings. sterisk indicates significant difference to wildtype (p < 0.05). 4

5 Plant weight /g [] /mm C FW DW FW DW Supplemental Fig. S5 Supplemental Figure 5: HD6 over-expression does not affect germination or growth. : Germination rates of imbibed wildtype (black), 35S:HDC1 (light grey) and 35S:HD6 (dark grey) seeds. Germination rates in % reflect the number of seedlings that had developed cotyledons on day 6, normalized to the total number of seeds plated out. ars are means ± SE of 3 plates containing 50 seeds each. sterisks indicate significant differences (p < 0.05) to wildtype. : Transcript levels of HD6 in wildtype and 35S::HD6 lines. C: Shoot weights (FW: fresh weight, DW: dry weight of 5-weeks old plants). ars are means of 8 plants. 5

6 HDC1-OX1 HDC1-OX2 Wildtype hdc1-1 Supplemental fig. S6 Supplemental Figure 6: Root and leaf growth phenotypes in young plants. Leaf surface areas and main root length of 2-weeks old wildtype (black), hdc1-1 (white) and HDC1-OX (grey). For leaf surface measurements plants were grown on soil. fter 2 weeks, leaves were removed in order of appearance and analyzed with Image J. For root measurements plants were germinated and grown on vertical agar plates containing half-strength MS medium. ars are means ± SE of 3 plants for leaf surface data and of at least 8 plants for root data. sterisks indicate significant differences (p < 0.05) to wildtype. 6

7 Plant weight /g FW DW FW DW Supplemental Fig. 7 Supplemental Figure 7: HD6 knockdown affects plant growth without delaying leaf development : Fresh and dry weights of 4-weeks old wildtype (Col-DR5, black) and hda6-knockdown (axe1-5, white dotted) plants. : Leaf numbers in wildtype and axe1-5 mutants. ars are means ± SE of 5 plants. sterisk indicates significant difference (p < 0.05) to wildtype. 7

8 [] /%WT+ [] ng/mg DW Control mm NaCl for 24 h Supplemental Figure 8: HDC1 has a small effect on content after salt treatment. : Shoot content of wildtype (WT, black), hdc1-1 knockout (KO, white) and HDC1 over-expressing (OX, grey). Plants were grown for 4 weeks in short day conditions and subjected (+) or not (-) to 150 mm NaCl for 24 h in hydroponics. bsolute results from three independently treated plant batches (5 plants each) are shown. : Relative change of content in hdc1-1 and HDC1-overexpressing plants compared to wildtype. content was normalized to the content of salt-treated wildtype plants in the same batch. ars are means ± SE of 3 independently treated plant batches (same as in ). Differences were significant with P-values of p = 0.3 (OX/WT, ) or p = 0.14 (KO/ WT). 8

9 ChIP DN /CT2 /Input 1 3 OX WT KO OX WT KO Supplemental Figure 9: HDC1 alters H3K9K14 acetylation levels in 1 but not 3 Relative amounts of DN associated with acetylated H3K9/K14 for 1 and 3 determined by ChIPqPCR in wildtype (WT, black), hdc1-1 knockout (KO, white) and HDC1 over-expressing (OX, grey) plants. Leaf tissue was pooled from 4-weeks old plants grown in 3 independent batches 12 plants each. Chromatin extracted and immunoprecipitated with anti-h3k9k14c. qpcr-amplified ChIP-DN was normalized to actin 2 and to input DN (chromatin before immunoprecipitation). ars are means of 4 technical qpcr-replicates ± SE. sterisks indicate significant differences to the wild type (p < 0.05). 9

10 HDC1 Control Gene X No expression Stress induced Low sensitivity hdc1 No expression induced High sensitivity HDC1 Gene Y Low expression repressed High sensitivity hdc1 High expression repressed High sensitivity Supplemental Figure 10: Scenarios for the effects of HDC1 on -dependent gene expression : In the case of -inducible gene X, HDC1 decreases sensitivity without altering transcription in control conditions. No transcription factors are present in control conditions and hence the gene remains inactive independent of its de-acetylation state. Under stress the gene is transcribed through the action of an -induced activator (e.g. transcription factor). How much of the activator is required for gene activity depends on the histone acetylation status of the gene. Thus, to obtain the same effect, more stimulus () is required when HDC1 is overexpressed (hypo-sensitivity) and less stimulus is required when HDC1 is knocked out (hyper-sensitivity). : In the case of -repressed gene Y, HDC1 decreases constitutive transcript levels with or without altering -sensitivity. In this case transcription factors are present in control conditions and have to overcome the repressive effect of deacetylation. HDC1 therefore directly determines constitutive expression levels. Stress induces a repressor that effectively blocks transcription. Whether knockout/overexpression of HDC1 alters stress-sensitivity will depend on the level at which the repressor operates. In the scenario shown here the -induced repressor acts downstream of transcription factor activity and is therefore independent of HDC1 levels. 10

11 % Control % Control Water-limited Shoot Rosette FW DW Salt-stressed Root Shoot HDC1-OX1 HDC1-OX2 Wildtype hdc1-1 FW DW FW DW Supplemental Figure 11: Effects of HDC1 expression on stress-sensitivity during vegetative growth. : Rosette diameter, fresh weight (FW) and dry weight (DW) at the end of the water-limiting experiment (day 40) relative to control (well-watered). For labelling of lines see legend box in figure. : Root and shoot fresh weight (FW) and dry weight (DW) of plants at the end of the salt stress experiment (day 6) relative to control. Due to low root DW, plants had to be pooled for determination of DW. 11

12 Supplemental Table 1: Primers for genotyping gdn

13 Supplemental Table 1 cont.

** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.

** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation. Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *

More information

Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated

Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin

More information

Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc

Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc Supplemental Data. Chen and Thelen (2010). Plant Cell 10.1105/tpc.109.071837 1 C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector

More information

Ethylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis

Ethylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis Ethylene is critical to the maintenance of primary root growth and Fe homeostasis under Fe stress in Arabidopsis Guangjie Li, Weifeng Xu, Herbert J. Kronzucker, Weiming Shi * Supplementary Data Supplementary

More information

GFP GAL bp 3964 bp

GFP GAL bp 3964 bp Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive

More information

Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed

Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed using the Geneious software. Accession numbers of the

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,

More information

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions. Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods

More information

Supplementary Figure 1. Phenotype of the HI strain.

Supplementary Figure 1. Phenotype of the HI strain. Supplementary Figure 1. Phenotype of the HI strain. (A) Phenotype of the HI and wild type plant after flowering (~1month). Wild type plant is tall with well elongated inflorescence. All four HI plants

More information

Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2

Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2 Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2 IRT1, FRO2 and FIT expression levels in roots of the wild-type, nas4x- 1 and nas4x-2, showing that in both nas mutants

More information

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation

More information

GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL

GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,

More information

Table S1 List of primers used for genotyping and qrt-pcr.

Table S1 List of primers used for genotyping and qrt-pcr. Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!

More information

Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids

Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Plant growth conditions The soil was a 1:1 v/v mixture of loamy soil and organic compost. Initial soil water content was determined

More information

Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering

Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering by Valverde et. Al Published in Science 2004 Presented by Boyana Grigorova CBMG 688R Feb. 12, 2007 Circadian Rhythms: The Clock Within

More information

Supplemental Data. Wang et al. (2014). Plant Cell /tpc

Supplemental Data. Wang et al. (2014). Plant Cell /tpc Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and

More information

Arabidopsis COMPASS-Like Complexes Mediate Histone H3 Lysine-4 Trimethylation to Control Floral Transition and Plant Development

Arabidopsis COMPASS-Like Complexes Mediate Histone H3 Lysine-4 Trimethylation to Control Floral Transition and Plant Development Arabidopsis COMPASS-Like Complexes Mediate Histone H3 Lysine-4 Trimethylation to Control Floral Transition and Plant Development Danhua Jiang 1,2, Nicholas C. Kong 1,2, Xiaofeng Gu 2, Zicong Li 1, Yuehui

More information

23-. Shoot and root development depend on ratio of IAA/CK

23-. Shoot and root development depend on ratio of IAA/CK Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature12791 Supplementary Figure 1 (1/3) WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 1 (2/3) 2 WWW.NATURE.COM/NATURE SUPPLEMENTARY

More information

Growth and development of Arabidopsis thaliana under single-wavelength red

Growth and development of Arabidopsis thaliana under single-wavelength red 1 Supplementary Information 2 3 4 Growth and development of Arabidopsis thaliana under single-wavelength red and blue laser light 5 6 7 8 Authors Amanda Ooi 1 *, Aloysius Wong 1 *, Tien Khee Ng 2, Claudius

More information

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and

More information

EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA

EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA Item Type text; Electronic Thesis Authors Bergstrand, Lauren Janel Publisher The University of Arizona. Rights Copyright is held by the author. Digital

More information

The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively as positive regulators of salt stress tolerance in rice

The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively as positive regulators of salt stress tolerance in rice Lou et al. BMC Plant Biology (2018) 18:203 https://doi.org/10.1186/s12870-018-1408-0 RESEARCH ARTICLE Open Access The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively

More information

Supplemental material

Supplemental material Supplemental material Table 1- Segregation analysis of sgt1a sgt1b double mutant plants Parental genotype No. of lines Normal seeds Phenotype Abnormal seeds Ratio of abnormal seeds (%) WT 3 171 2 1.16

More information

Development 143: doi: /dev : Supplementary information

Development 143: doi: /dev : Supplementary information Supplementary Materials and Methods Plant materials The mutants and transgenic plants used in the present study were as follows: E361 (from Alex Webb s laboratory); tmm-1, ptmm::tmm-gfp and flp-1 (from

More information

Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.

Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny

More information

Supporting Information

Supporting Information Supporting Information Cao et al. 10.1073/pnas.1306220110 Gram - bacteria Hemolymph Cytoplasm PGRP-LC TAK1 signalosome Imd dfadd Dredd Dnr1 Ikk signalosome P Relish Nucleus AMP and effector genes Fig.

More information

Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao

Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao New Phytologist Supporting Information Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bhlh transcription factor MtTT8 Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang

More information

Supp- Figure 2 Confocal micrograph of N. benthamiana tissues transiently expressing 35S:YFP-PDCB1. PDCB1 was targeted to plasmodesmata (twin punctate

Supp- Figure 2 Confocal micrograph of N. benthamiana tissues transiently expressing 35S:YFP-PDCB1. PDCB1 was targeted to plasmodesmata (twin punctate Supplemental Data. Simpson et al. (009). n rabidopsis GPI-anchor plasmodesmal neck protein with callosebinding activity and potential to regulate cell-to-cell trafficking. 5 0 stack Supp- Figure Confocal

More information

Supplemental Figures. Supplemental Data. Sugliani et al. Plant Cell (2016) /tpc Clades RSH1. Rsh1[HS] RSH2 RSH3. Rsh4[HS] HYD TGS ACT

Supplemental Figures. Supplemental Data. Sugliani et al. Plant Cell (2016) /tpc Clades RSH1. Rsh1[HS] RSH2 RSH3. Rsh4[HS] HYD TGS ACT Supplemental Figures Clades RSH1 TP - HYD TGS ACT Rsh1[HS] RSH2 TP HYD SYN TGS Rsh2[HS] RSH3 TP HYD SYN TGS CRSH TP - SYN EFh Rsh4[HS] Supplemental Figure 1. Arabidopsis RSH domain structure. Schematic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION PRC2 represses dedifferentiation of mature somatic cells in Arabidopsis Momoko Ikeuchi 1 *, Akira Iwase 1 *, Bart Rymen 1, Hirofumi Harashima 1, Michitaro Shibata 1, Mariko Ohnuma 1, Christian Breuer 1,

More information

Supplementary Table 1. Primers used in this study.

Supplementary Table 1. Primers used in this study. Supplementary Tale 1. Primers used in this study. Name Primer sequence (5'-3') Primers of PCR-ased molecular markers developed in this study M1 F M1 R M2 F M2 R M3 F M3 R M4 F M4 R M5 F M5 R M6 F M6 R

More information

Supplemental material

Supplemental material Supplemental material THE JOURNAL OF CELL BIOLOGY Mourier et al., http://www.jcb.org/cgi/content/full/jcb.201411100/dc1 Figure S1. Size and mitochondrial content in Mfn1 and Mfn2 knockout hearts. (A) Body

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1121356/dc1 Supporting Online Material for Polar PIN Localization Directs Auxin Flow in Plants Justyna Wiśniewska, Jian Xu, Daniela Seifertová, Philip B. Brewer, Kamil

More information

Epigenetics and Flowering Any potentially stable and heritable change in gene expression that occurs without a change in DNA sequence

Epigenetics and Flowering Any potentially stable and heritable change in gene expression that occurs without a change in DNA sequence Epigenetics and Flowering Any potentially stable and heritable change in gene expression that occurs without a change in DNA sequence www.plantcell.org/cgi/doi/10.1105/tpc.110.tt0110 Epigenetics Usually

More information

Genetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity

Genetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity Genetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity Shih-Heng Su, Maria Cristina Suarez-Rodriguez, Patrick Krysan

More information

Regulation of Phosphate Homeostasis by microrna in Plants

Regulation of Phosphate Homeostasis by microrna in Plants Regulation of Phosphate Homeostasis by microrna in Plants Tzyy-Jen Chiou 1 *, Kyaw Aung 1,2, Shu-I Lin 1,3, Chia-Chune Wu 1, Su-Fen Chiang 1, and Chun-Lin Su 1 Abstract Upon phosphate (Pi) starvation,

More information

Supplemental Table 1. Primers used for cloning and PCR amplification in this study

Supplemental Table 1. Primers used for cloning and PCR amplification in this study Supplemental Table 1. Primers used for cloning and PCR amplification in this study Target Gene Primer sequence NATA1 (At2g393) forward GGG GAC AAG TTT GTA CAA AAA AGC AGG CTT CAT GGC GCC TCC AAC CGC AGC

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplemental Methods Isolation and mapping of SPCH An EMS-mutagenized population of tmm-1 (Col);E1728 (an enhancer trap GFP marking guard cells) was created. M2 seeds were collected from M1 s planted in

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1. Haploid plant produced by centromere-mediated genome elimination Chromosomes containing altered CENH3 in their centromeres (green dots) are eliminated after fertilization in a cross to wild

More information

DOI: 10.1038/ncb2819 Gαi3 / Actin / Acetylated Tubulin Gαi3 / Actin / Acetylated Tubulin a a Gαi3 a Actin Gαi3 WT Gαi3 WT Gαi3 WT b b Gαi3 b Actin Gαi3 KO Gαi3 KO Gαi3 KO # # Figure S1 Loss of protein

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/452/ra106/dc1 Supplementary Materials for Stem-piped light activates phytochrome B to trigger light responses in Arabidopsis thaliana roots Hyo-Jun Lee, Jun-Ho

More information

Table S1. Sequence of primers used in RT-qPCR

Table S1. Sequence of primers used in RT-qPCR Table S1. Sequence of primers used in RT-qPCR Primer Name P16Ink4a-F P16Ink4a-R P15Ink4b-F P15Ink4b-R P19Arf-F P19Arf-R P53-F P53-R P21cip1-F P21cip1-R P27kip1-F P27kip1-R P18Ink4c-F P18Ink4c-R P19Ink4d-F

More information

SUPPLEMENTAL MATERIAL

SUPPLEMENTAL MATERIAL SUPPLEMENTAL MATERIAL Figure S1. Mitochondrial morphology in Fis1-null, Mff-null and Fis1/Mff-null MEF cells. (A) Western blotting of lysates from Fis1-null, Mff-null and Fis1/Mff-null cells. Lysates were

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Overexpression of YFP::GPR-1 in the germline.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Overexpression of YFP::GPR-1 in the germline. Supplementary Figure 1 Overexpression of YFP::GPR-1 in the germline. The pie-1 promoter and 3 utr were used to express yfp::gpr-1 in the germline. Expression levels from the yfp::gpr-1(cai 1.0)-expressing

More information

Last time: Obtaining information from a cloned gene

Last time: Obtaining information from a cloned gene Last time: Obtaining information from a cloned gene Objectives: 1. What is the biochemical role of the gene? 2. Where and when is the gene expressed (transcribed)? 3. Where and when is the protein made?

More information

4) Please cite Dagda et al J Biol Chem 284: , for any publications or presentations resulting from use or modification of the macro.

4) Please cite Dagda et al J Biol Chem 284: , for any publications or presentations resulting from use or modification of the macro. Supplement Figure S1. Algorithmic quantification of mitochondrial morphology in SH- SY5Y cells treated with known fission/fusion mediators. Parental SH-SY5Y cells were transiently transfected with an empty

More information

SOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent Seed Germination Downstream of PIL5 W

SOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent Seed Germination Downstream of PIL5 W The Plant Cell, Vol. 20: 1260 1277, May 2008, www.plantcell.org ª 2008 American Society of Plant Biologists SOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent

More information

Biological Roles of Cytokinins

Biological Roles of Cytokinins Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators

More information

downstream (0.8 kb) homologous sequences to the genomic locus of DIC. A DIC mutant strain (ro- 6

downstream (0.8 kb) homologous sequences to the genomic locus of DIC. A DIC mutant strain (ro- 6 A B C D ts Figure S1 Generation of DIC- mcherry expressing N.crassa strain. A. N. crassa colony morphology. When a cot1 (top, left panel) strain is grown at permissive temperature (25 C), it exhibits straight

More information

Lipid transfer proteins confer resistance to trichothecenes

Lipid transfer proteins confer resistance to trichothecenes Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance

More information

UNIVERSITY OF AGRICULTURAL SCIENCES AND VETERINARY MEDICINE

UNIVERSITY OF AGRICULTURAL SCIENCES AND VETERINARY MEDICINE UNIVERSITY OF AGRICULTURAL SCIENCES AND VETERINARY MEDICINE FACULTY OF HORTICULTURE OANA CIUZAN ROLE OF THE GLYCINE-RICH RNA-BINDING PROTEINS IN PLANT EARLY DEVELOPMENT AND ABIOTIC STRESS RESPONSE ABSTRACT

More information

Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.

Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background. Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature10534 Supplementary Fig. 1. Diagrammatic representation of the N-end rule pathway of targeted proteolysis (after Graciet and Wellmer 2010 9 ). Tertiary, secondary

More information

Mitochondrial Dynamics Is a Distinguishing Feature of Skeletal Muscle Fiber Types and Regulates Organellar Compartmentalization

Mitochondrial Dynamics Is a Distinguishing Feature of Skeletal Muscle Fiber Types and Regulates Organellar Compartmentalization Cell Metabolism Supplemental Information Mitochondrial Dynamics Is a Distinguishing Feature of Skeletal Muscle Fiber Types and Regulates Organellar Compartmentalization Prashant Mishra, Grigor Varuzhanyan,

More information

HRS1 Acts as a Negative Regulator of Abscisic Acid Signaling to Promote Timely Germination of Arabidopsis Seeds

HRS1 Acts as a Negative Regulator of Abscisic Acid Signaling to Promote Timely Germination of Arabidopsis Seeds HRS1 Acts as a Negative Regulator of Abscisic Acid Signaling to Promote Timely Germination of Arabidopsis Seeds Chongming Wu 1,2., Juanjuan Feng 1,2., Ran Wang 1,2, Hong Liu 1,2, Huixia Yang 1,2, Pedro

More information

Auxin and Light Control of Adventitious Rooting in Arabidopsis Require ARGONAUTE1 W

Auxin and Light Control of Adventitious Rooting in Arabidopsis Require ARGONAUTE1 W The Plant Cell, Vol. 17, 1343 1359, May 2005, www.plantcell.org ª 2005 American Society of Plant Biologists RESEARCH ARTICLES Auxin and Light Control of Adventitious Rooting in Arabidopsis Require ARGONAUTE1

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative

More information

PYR1 PYL1 PYL2 PYL3 PYL4 PYL5 PYL6 PYL7 PYL8 PYL9 PYL10 PYL11/12

PYR1 PYL1 PYL2 PYL3 PYL4 PYL5 PYL6 PYL7 PYL8 PYL9 PYL10 PYL11/12 Supplemental Data. Gonzalez-Guzman et al. Plant Cell. (212). 1.115/tpc.112.98574 Supplemental Figure 1. Gene expression levels of the PYR/PYL/RCAR ABA receptors in the Arabidopsis transcriptome genomic

More information

Supplemental Data. Yang et al. (2012). Plant Cell /tpc

Supplemental Data. Yang et al. (2012). Plant Cell /tpc Supplemental Figure 1. Mature flowers of P. heterotricha. (A) An inflorescence of P. heterotricha showing the front view of a zygomorphic flower characterized by two small dorsal petals and only two fertile

More information

Flowering Time Control in Plants -How plants know the time to flower?

Flowering Time Control in Plants -How plants know the time to flower? Advanced Molecular and Cell Biology II, 2015/12/04 Flowering Time Control in Plants -How plants know the time to flower? Masaki NIWA Grad. Sch. Biostudies, Kyoto Univ. Why can plants bloom every year in

More information

Slide 1 / 7. Free Response

Slide 1 / 7. Free Response Slide 1 / 7 Free Response Slide 2 / 7 Slide 3 / 7 1 The above diagrams illustrate the experiments carried out by Griffith and Hershey and Chaserespectively. Describe the hypothesis or conclusion that each

More information

7.06 Problem Set #4, Spring 2005

7.06 Problem Set #4, Spring 2005 7.06 Problem Set #4, Spring 2005 1. You re doing a mutant hunt in S. cerevisiae (budding yeast), looking for temperaturesensitive mutants that are defective in the cell cycle. You discover a mutant strain

More information

Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells

Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells By: Patrick Rutledge 1 Dr. Jennifer Lorang 2,3, Dr. Marc Curtis 2,3, Dr. Thomas Wolpert 2,3 BioResource Research 1, Botany and

More information

Arabidopsis homologs of components of the SWR1 complex regulate flowering and plant development

Arabidopsis homologs of components of the SWR1 complex regulate flowering and plant development RESEARCH ARTICLE 1931 Development 134, 1931-1941 (2007) doi:10.1242/dev.001891 Arabidopsis homologs of components of the SWR1 complex regulate flowering and plant development Kyuha Choi 1, Chulmin Park

More information

Trithorax-group proteins ARABIDOPSIS TRITHORAX4 (ATX4) and ATX5 function in abscisic acid and dehydration stress responses

Trithorax-group proteins ARABIDOPSIS TRITHORAX4 (ATX4) and ATX5 function in abscisic acid and dehydration stress responses Research Trithorax-group proteins ARABIDOPSIS TRITHORAX4 (ATX4) and ATX5 function in abscisic acid and dehydration stress responses Yutong Liu, Ai Zhang, Hao Yin, Qingxiang Meng, Xiaoming Yu, Shuangzhan

More information

Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles

Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN

More information

Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice Supplementary Figure 2.

Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice Supplementary Figure 2. Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice. Percentage of marginal zone B cells in the spleen of wild-type mice (+/+), mice homozygous for cpm or pri

More information

Supplementary Figure 1. Nature Genetics: doi: /ng.3848

Supplementary Figure 1. Nature Genetics: doi: /ng.3848 Supplementary Figure 1 Phenotypes and epigenetic properties of Fab2L flies. A- Phenotypic classification based on eye pigment levels in Fab2L male (orange bars) and female (yellow bars) flies (n>150).

More information

From network to phenotype: the dynamic wiring of an Arabidopsis transcriptional network induced by osmotic stress

From network to phenotype: the dynamic wiring of an Arabidopsis transcriptional network induced by osmotic stress Article From network to phenotype: the dynamic wiring of an Arabidopsis transcriptional network induced by osmotic stress Lisa Van den Broeck 1,,, Marieke Dubois 1,,,, Mattias Vermeersch 1,, Veronique

More information

POTASSIUM IN PLANT GROWTH AND YIELD. by Ismail Cakmak Sabanci University Istanbul, Turkey

POTASSIUM IN PLANT GROWTH AND YIELD. by Ismail Cakmak Sabanci University Istanbul, Turkey POTASSIUM IN PLANT GROWTH AND YIELD by Ismail Cakmak Sabanci University Istanbul, Turkey Low K High K High K Low K Low K High K Low K High K Control K Deficiency Cakmak et al., 1994, J. Experimental Bot.

More information

BIS &003 Answers to Assigned Problems May 23, Week /18.6 How would you distinguish between an enhancer and a promoter?

BIS &003 Answers to Assigned Problems May 23, Week /18.6 How would you distinguish between an enhancer and a promoter? Week 9 Study Questions from the textbook: 6 th Edition: Chapter 19-19.6, 19.7, 19.15, 19.17 OR 7 th Edition: Chapter 18-18.6 18.7, 18.15, 18.17 19.6/18.6 How would you distinguish between an enhancer and

More information

In order to confirm the contribution of diffusion to the FRAP recovery curves of

In order to confirm the contribution of diffusion to the FRAP recovery curves of Fonseca et al., Supplementary Information FRAP data analysis ) Contribution of Diffusion to the recovery curves In order to confirm the contribution of diffusion to the FRAP recovery curves of PH::GFP

More information

Repression of flowering under a noninductive photoperiod by the HDA9-AGL19-FT module in Arabidopsis

Repression of flowering under a noninductive photoperiod by the HDA9-AGL19-FT module in Arabidopsis Research Repression of flowering under a noninductive photoperiod by the HDA9-AGL19-FT module in Arabidopsis Min-Jeong Kang 1, Hong-Shi Jin 1, Yoo-Sun Noh 1,2 and Bosl Noh 3 1 School of Biological Sciences,

More information

Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day

Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day conditions. Photo was taken when the wild type plant started to bolt. Scale bar represents 1 cm. Supplemental Figure 2. Flowering

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1 Sns and Duf co-localise in embryonic nephrocytes a-c, Wild-type stage 11 (a),14 (b) and 16 (c) embryos stained with anti-duf (green) and anti-sns (red). Higher magnification images

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3267 Supplementary Figure 1 A group of genes required for formation or orientation of annular F-actin bundles and aecm ridges: RNAi phenotypes and their validation by standard mutations.

More information

From basic research to crop improvement. Dirk Inze VIB-UGent Center for Plant Systems Biology

From basic research to crop improvement. Dirk Inze VIB-UGent Center for Plant Systems Biology From basic research to crop improvement Dirk Inze VIB-UGent Center for Plant Systems Biology Oct 2017 The Great Challenge By 2050 70% more food on the same land area Growing world population Climate change

More information

Other funding Sources Agency Name: MSU Agricultural Experiment Station /Project GREEEN Amount requested or awarded: 30,000

Other funding Sources Agency Name: MSU Agricultural Experiment Station /Project GREEEN Amount requested or awarded: 30,000 FINAL PROJECT REPORT Project Title: Functional genomics of flowering in apple PI: Herb Aldwinckle Co-PI(2): Steve VanNocker Organization: Cornell University Organization: Michigan State University Telephone/email:

More information

Supporting Online Material

Supporting Online Material 1 Stomatal Patterning and Differentiation by Synergistic Interactions of Receptor Kinases Elena D. Shpak, Jessica Messmer McAbee, Lynn Jo Pillitteri, and Keiko U. Torii Supporting Online Material Material

More information

Stress Effects on Myosin Mutant Root Length in Arabidopsis thaliana

Stress Effects on Myosin Mutant Root Length in Arabidopsis thaliana University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange University of Tennessee Honors Thesis Projects University of Tennessee Honors Program 5-2011 Stress Effects on Myosin

More information

Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach

Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach ABSTRACT SUBMITTED TO JAMIA MILLIA ISLAMIA NEW DELHI IN PARTIAL FULFILMENT OF

More information

Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA

Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA Himber et al. Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA silencing SUPPLEMENTAL MATERIAL Supplemental material 1. Short-range movement of GFP silencing affects a nearly

More information

. Supplementary Information

. Supplementary Information . Supplementary Information Supplementary Figure S1. Mature embryo sac observations. Supplementary Figure S2. STT observations. Supplementary Figure S3. Comparison of the PTB1 cdna with that of the mutant.

More information

Arabidopsis TERMINAL FLOWER1 Is Involved in the Regulation of Flowering Time and Inflorescence Development through Transcriptional Repression C W OA

Arabidopsis TERMINAL FLOWER1 Is Involved in the Regulation of Flowering Time and Inflorescence Development through Transcriptional Repression C W OA The Plant Cell, Vol. 23: 3172 3184, September 2011, www.plantcell.org ã 2011 American Society of Plant Biologists. All rights reserved. Arabidopsis TERMINAL FLOWER1 Is Involved in the Regulation of Flowering

More information

Life Science Journal 2014;11(9) Cryptochrome 2 negatively regulates ABA-dependent seed germination in Arabidopsis

Life Science Journal 2014;11(9)   Cryptochrome 2 negatively regulates ABA-dependent seed germination in Arabidopsis Cryptochrome 2 negatively regulates ABA-dependent seed germination in Arabidopsis Sung-Il Kim 1, Sang Ik Song 3, Hak Soo Seo 1, 2, 4 * 1 Department of Plant Science and Research Institute of Agriculture

More information

Hormonal and other chemical effects on plant growth and functioning. Bill Davies Lancaster Environment Centre, UK

Hormonal and other chemical effects on plant growth and functioning. Bill Davies Lancaster Environment Centre, UK Hormonal and other chemical effects on plant growth and functioning Bill Davies Lancaster Environment Centre, UK Integrating the impacts of soil drought and atmospheric stress High radiant load Reduced

More information

Figure 18.1 Blue-light stimulated phototropism Blue light Inhibits seedling hypocotyl elongation

Figure 18.1 Blue-light stimulated phototropism Blue light Inhibits seedling hypocotyl elongation Blue Light and Photomorphogenesis Q: Figure 18.3 Blue light responses - phototropsim of growing Corn Coleoptile 1. How do we know plants respond to blue light? 2. What are the functions of multiple BL

More information

DEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA

DEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA DEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA CHASE BALLARD LINDA EAN HECTOR LOPEZ DR. JOANNA WERNER-FRACZEK IN COLLABORATION WITH DR. PATRICIA SPRINGER S LAB AT UCR AND ROBERT KOBLE PURPOSE OF RESEARCH

More information

A small multigene hydroxyproline-ogalactosyltransferase. arabinogalactan-protein glycosylation, growth and development in Arabidopsis

A small multigene hydroxyproline-ogalactosyltransferase. arabinogalactan-protein glycosylation, growth and development in Arabidopsis Basu et al. BMC Plant Biology (215) 15:295 DOI 1.1186/s1287-15-67-7 RESEARCH ARTICLE Open Access A small multigene hydroxyproline-ogalactosyltransferase family functions in arabinogalactan-protein glycosylation,

More information

Maria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner

Maria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner ABA represses the transcription of chloroplast genes Maria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner Supplementary data Supplementary tables Table

More information

Electromagenetic spectrum

Electromagenetic spectrum Light Controls of Plant Development 1 Electromagenetic spectrum 2 Light It is vital for photosynthesis and is also necessary to direct plant growth and development. It acts as a signal to initiate and

More information

The Arabidopsis Small G Protein ROP2 Is Activated by Light in Guard Cells and Inhibits Light-Induced Stomatal Opening W

The Arabidopsis Small G Protein ROP2 Is Activated by Light in Guard Cells and Inhibits Light-Induced Stomatal Opening W The Plant Cell, Vol. 20: 75 87, January 2008, www.plantcell.org ª 2008 American Society of Plant Biologists The Arabidopsis Small G Protein ROP2 Is Activated by Light in Guard Cells and Inhibits Light-Induced

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Characterisation of IHG-1 overexpressing and knockdown cell lines. (A) Total cellular RNA was prepared from HeLa cells stably overexpressing IHG-1 or mts-ihg-1. IHG-1 mrna was quantified

More information

Effect of Acetosyringone on Agrobacterium-mediated Transformation of Eustoma grandiflorum Leaf Disks

Effect of Acetosyringone on Agrobacterium-mediated Transformation of Eustoma grandiflorum Leaf Disks JARQ 51 (4), 351-355 (2017) https://www.jircas.go.jp Improvement in Agrobacterium-mediated Transformation of Eustoma grandiflorum by Acetosyringone Effect of Acetosyringone on Agrobacterium-mediated Transformation

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/301/ra98/dc1 Supplementary Materials for Regulation of Epithelial Morphogenesis by the G Protein Coupled Receptor Mist and Its Ligand Fog Alyssa J. Manning,

More information

THE ROLE OF THE PHYTOCHROME B PHOTORECEPTOR IN THE REGULATION OF PHOTOPERIODIC FLOWERING. AnitaHajdu. Thesis of the Ph.D.

THE ROLE OF THE PHYTOCHROME B PHOTORECEPTOR IN THE REGULATION OF PHOTOPERIODIC FLOWERING. AnitaHajdu. Thesis of the Ph.D. THE ROLE OF THE PHYTOCHROME B PHOTORECEPTOR IN THE REGULATION OF PHOTOPERIODIC FLOWERING AnitaHajdu Thesis of the Ph.D. dissertation Supervisor: Dr. LászlóKozma-Bognár - senior research associate Doctoral

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. NAD + -related genes expression in mouse tissues and in cells overexpressing NRK1. mrna (a) and protein (b) levels of NRK1, NRK2 and other enzymes involved

More information

Supplementary Figure 1: Mechanism of Lbx2 action on the Wnt/ -catenin signalling pathway. (a) The Wnt/ -catenin signalling pathway and its

Supplementary Figure 1: Mechanism of Lbx2 action on the Wnt/ -catenin signalling pathway. (a) The Wnt/ -catenin signalling pathway and its Supplementary Figure 1: Mechanism of Lbx2 action on the Wnt/ -catenin signalling pathway. (a) The Wnt/ -catenin signalling pathway and its transcriptional activity in wild-type embryo. A gradient of canonical

More information

Brassinosteroids Stimulate Plant Tropisms through Modulation of Polar Auxin Transport in Brassica and Arabidopsis

Brassinosteroids Stimulate Plant Tropisms through Modulation of Polar Auxin Transport in Brassica and Arabidopsis The Plant Cell, Vol. 17, 2738 2753, October 2005, www.plantcell.org ª 2005 American Society of Plant Biologists Brassinosteroids Stimulate Plant Tropisms through Modulation of Polar Auxin Transport in

More information