Last time: Obtaining information from a cloned gene

Size: px
Start display at page:

Download "Last time: Obtaining information from a cloned gene"

Transcription

1 Last time: Obtaining information from a cloned gene Objectives: 1. What is the biochemical role of the gene? 2. Where and when is the gene expressed (transcribed)? 3. Where and when is the protein made? Reference: Westhoff et al. Molecular Plant Development: from gene to plant. Chapter 3:39-65.

2 Panel 4-6, ECB p.164 Indirect Immunodetection

3 When and where is the protein made? 2. In situ protein localization (tissue or individual cells) (a) using an antibody raised against protein of interest Expression of DEF and GLO proteins is confined to the epidermis of floral organs

4 Immunofluorescence Wasteneys lab UBC Anti-tubulin primary antibodies together with fluorescently labeled secondary antibodies were used to detect microtubules in roots

5 When and where is the protein made? 2. In situ protein localization (tissue or individual cells) (b) using GFP or fluorescently labeled antibody to a protein tag

6 When and where is the protein made? Epitope tagging Immunolocalization using antibodies to protein tag Detection of GFP-protein fusion

7 When and where is the protein made? 2. In situ protein localization (tissue or individual cells) (b) using GFP or fluorescently labeled antibody to a protein tag CER5 GFP CER5 NOS CER5::GFP::CER5 CER5 CER5 GFP NOS CER5::CER5::GFP

8 When and where is the protein made? 2. In situ protein localization (tissue or individual cells) (b) using GFP or fluorescently labeled antibody to a protein tag Plant epidermal cells showing localization of the GFP-tagged surface lipid ABC transporter in the plasma membrane

9 Green Fluorescent Protein (GFP) absorbs blue light emits green

10 Dr. Andreas Nebenfuhr, U. Tenn. Fluorescent proteins (GFP, RFP, CFP) to label organelles in live cells (red) Golgi stacks, (green) mitochondria, and (blue) peroxisomes in an onion epidermis cell.

11 Plant transformation Objectives: 1. What is plant transformation? 2. What is Agrobacterium? How and why does it transform plant cells? 3. How is Agrobacterium used as a tool in molecular genetics? References: Hooykaas and Schilperoort Agrobacterium and plant genetic engineering. Plant Molecular Biology 19: Westhoff et al. Molecular Plant Development:from gene to plant. Chapter 7,

12 Plant transformation Introduction of exogenous DNA into a plant cell Transient no incorporation of exogenous DNA into the genome Stable incorporation of introduced exogenous DNA into the genome Transformation of multicellular organisms: Cannot directly transform every cell - Transformation involves one cell which then regenerates an entire organism

13 Agrobacterium tumefaciens: a natural tool for plant transformation Soil gram positive bacterium Martha Hawes Agrobacterium tumefaciens attached to a plant cell

14 Agrobacterium tumefaciens: a natural tool for plant transformation Causes Crown Gall disease - tumors (galls) form at base of stem in many dicotyledonous plants (dicots) Photographs supplied by Sharon von Broembsen, Oklahoma State University production of tumors is caused by the transfer of bacterial DNA to the plant, which integrates into the plant genome

15 Agrobacterium tumefaciens: a natural tool for plant transformation Genes involved in crown gall disease are not present on the chromosome of A. tumefaciens but on a large plasmid, called the Ti (tumor-inducing) plasmid. Circular chromosome LB Ti A. tumefaciens vir genes T-DNA Ti plasmid ~ 120 kbp ori RB

16 A. tumefaciens T-DNA Structure LB RB Shi Shi Roi Nos LB and RB 25 bp direct repeats Nos - nopaline synthase opine biosynthetic gene* Shi - shoot inducing - 2 genes for auxin synthesis* Roi - root inducing - gene for cytokinin synthesis* *have eukaryotic promoters these genes are not expressed in Agrobacterium!!!

17 T-DNA transfer into plants T-DNA transfer process is activated when Agrobacterium gets in contact with damaged plant tissue T-DNA is nicked at the RB, T-DNA gets replicated to the LB and moved into the plant cell these processes are catalyzed by products of vir genes

18 T-DNA transfer into plants T-DNA is inserted into plant nuclear genome at random sites. Transformed cell starts proliferating upon DNA integration resulting in tumor formation. Why? Transformed cells make opines = N-rich nutrients (amino acid derivatives) for bacterium ( Genetic colonization )

19 Agrobacterium tumefaciens as a tool for genetic engineering Problem: tumor How can we engineer Agrobacterium to make it useful for genetic engineering? Delete auxin, cytokinin and opine genes Retain vir genes, LB&RB, ori Ti plasmid is huge (~120 kb) need to make it smaller

20 Agrobacterium tumefaciens as a tool for genetic engineering vir genes and T-DNA can be on separate plasmids only left and right borders (LB & RB) are required for T-DNA to be transferred Cloning site for plant genes LB Selectable marker (Plants) vir genes Ti plasmid Selectable marker (Bacteria) T-DNA Binary vector RB Selectable marker (Bacteria) ori (Agrobacterium) ori (E.coli) ori (Agrobacterium)

21 Steps in plant transformation 1. Propagate binary vector in E. coli 2. Isolate binary vector from E.coli and engineer (introduce a gene of interest) 3. Re-introduce engineered binary vector into E. coli to amplify 4. Isolate engineered binary vector from E. coli and introduce into Agrobacterium already containing a modified (smaller) Ti plasmid with vir genes 5. Infect plant tissue with engineered Agrobacterium (T-DNA containing the gene of interest gets inserted into a plant cell genome at random sites)

22 Plant transformation In each cell T-DNA gets integrated at a different site in the genome Each cell is hemizygous for the insertion only one of the homologous chromosomes gets the insertion Consequences of the insertion: - Foreign DNA is inserted - Insertional mutagenesis (does not kill the cell the organism is diploid!)

23 Plant transformation Problem: We want to transform the whole organism, not one cell!!! This is done by: Transforming plant cells in culture, selecting transformed cells and regenerating the entire plant from the transformed cell (eg. tobacco)

24

25 Plant transformation Solanum chacoense

26 Plant transformation Problem: We want to transform the whole organism, not one cell!!! This is done by: Transforming plant cells in culture, selecting transformed cells and regenerating the entire plant from the transformed cell (eg. tobacco) In planta transformation of Arabidopsis - Dip flowering plants into Agrobacterium suspension

27 Plant transformation plbio.life.ku.dk In planta transformation of Arabidopsis (Floral dip method) Systemic infection in Arabidopsis is accomplished by transformation of female gametes!

28 Plant transformation Problem: We want to transform the whole organism, not one cell!!! This is done by: Transforming plant cells in culture, selecting transformed cells and regenerating the entire plant from the transformed cell (eg. tobacco) In planta transformation of Arabidopsis - Dip flowering plants into Agrobacterium suspension - Harvest seed and select for transformants (they are hemizygous!)

29 Agrobacterium tumefaciens as a tool for genetic engineering vir genes and T-DNA can be on separate plasmids only left and right borders (LB & RB) are required for T-DNA to be transferred Cloning site for plant genes LB Selectable marker (Plants) vir genes Ti plasmid Selectable marker (Bacteria) T-DNA Binary vector RB Selectable marker (Bacteria) ori (Agrobacterium) ori (E.coli) ori (Agrobacterium)

30 Selection of transformants

31 Selection of transformants DsRed selection using green light excitation

Plant transformation

Plant transformation Plant transformation Objectives: 1. What is plant transformation? 2. What is Agrobacterium? How and why does it transform plant cells? 3. How is Agrobacterium used as a tool in molecular genetics? References:

More information

Ti plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines

Ti plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines Ti plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines Mitesh Shrestha Constraints of Wild type Ti/Ri-plasmid Very large

More information

AGRO- BACTERIUM MEDIATED GENE TRANSFER IN PLANTS

AGRO- BACTERIUM MEDIATED GENE TRANSFER IN PLANTS MODULE 5- LECTURE 4 AGRO- BACTERIUM MEDIATED GENE TRANSFER IN PLANTS 5-4.1. Introduction Agrobacterium is considered as the nature s genetic engineer. Agrobacterium tumefaciens is a rod shaped, gram negative

More information

Agrobacterium tumefasciens, the Ti Plasmid, and Crown Gall Tumorigenesis

Agrobacterium tumefasciens, the Ti Plasmid, and Crown Gall Tumorigenesis Agrobacterium tumefasciens, the Ti Plasmid, and Crown Gall Tumorigenesis BOM-11: 10.9 Plasmids: General Principles (review) p. 274 10.11 Conjugation: Essential Features (review) p. 278 19.21 Agrobacterium

More information

AGROBACTERIUM. First described by Smith and Townsend (1907) Responsible for crown gall. Performed Koch's postulates

AGROBACTERIUM. First described by Smith and Townsend (1907) Responsible for crown gall. Performed Koch's postulates AGROBACTERIUM First described by Smith and Townsend (1907) Responsible for crown gall Performed Koch's postulates The disease is worldwide in distribution Speciation was based on pathogenicity Agrobacterium

More information

Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha

Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary

More information

Anatomy of Plants Student Notes

Anatomy of Plants Student Notes Directions: Fill in the blanks. Anatomy of Plants Student Notes Plant Cell Biology Segment 1. Plants Plants are organisms are incapable of movement produce food through 2. Animals Animals are multicellular

More information

CHAPTER 1 INTRODUCTION TO CELLS 2009 Garland Science Publishing 3 rd Edition

CHAPTER 1 INTRODUCTION TO CELLS 2009 Garland Science Publishing 3 rd Edition Unity and Diversity of Cells 1-1 The smallest unit of life is a(n) (a) DNA molecule. (b) cell. (c) organelle. (d) virus. (e) protein. CHAPTER 1 INTRODUCTION TO CELLS 2009 Garland Science Publishing 3 rd

More information

Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p.

Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p. READING: 14.2 Bacterial Genomes p. 481 14.3 Gene Transfer Mechanisms in Bacteria p. 486 Suggested Problems: 1, 7, 13, 14, 15, 20, 22 BACTERIAL GENETICS AND GENOMICS We still consider the E. coli genome

More information

Introduction to Molecular and Cell Biology

Introduction to Molecular and Cell Biology Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What

More information

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology 2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the

More information

The Microscopic Observation of Mitosis in Plant and Animal Cells

The Microscopic Observation of Mitosis in Plant and Animal Cells The Microscopic Observation of Mitosis in Plant and Animal Cells Prelab Assignment Before coming to lab, read carefully the introduction and the procedures for each part of the experiment, and then answer

More information

The Science of Plants in Agriculture Pl.Sci 102. Getting to Know Plants

The Science of Plants in Agriculture Pl.Sci 102. Getting to Know Plants The Science of Plants in Agriculture Pl.Sci 102 Getting to Know Plants Growth and Development of Plants Growth and Development of Plants Why it s important to have knowledge about plant development. What

More information

Unit 1 Cell Biology Topic 1: Cell Structure

Unit 1 Cell Biology Topic 1: Cell Structure Unit 1 Cell Biology Topic 1: Cell Structure Lesson 1.1.1 I will know I am successful if I can: 1. Label all parts of plant and animal cells and state their functions 2. State the differences between plant

More information

CAPE Biology Unit 1 Scheme of Work

CAPE Biology Unit 1 Scheme of Work CAPE Biology Unit 1 Scheme of Work 2011-2012 Term 1 DATE SYLLABUS OBJECTIVES TEXT PAGES ASSIGNMENTS COMMENTS Orientation Introduction to CAPE Biology syllabus content and structure of the exam Week 05-09

More information

Multiple Choice Review- Eukaryotic Gene Expression

Multiple Choice Review- Eukaryotic Gene Expression Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule

More information

Cell Division and Reproduction

Cell Division and Reproduction Cell Division and Reproduction What do you think this picture shows? If you guessed that it s a picture of two cells, you are right. In fact, the picture shows human cancer cells, and they are nearing

More information

Plant and animal cells (eukaryotic cells) have a cell membrane, cytoplasm and genetic material enclosed in a nucleus.

Plant and animal cells (eukaryotic cells) have a cell membrane, cytoplasm and genetic material enclosed in a nucleus. 4.1 Cell biology Cells are the basic unit of all forms of life. In this section we explore how structural differences between types of cells enables them to perform specific functions within the organism.

More information

Bacterial Genetics & Operons

Bacterial Genetics & Operons Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the

More information

Unit 2: Cellular Chemistry, Structure, and Physiology Module 5: Cellular Reproduction

Unit 2: Cellular Chemistry, Structure, and Physiology Module 5: Cellular Reproduction Unit 2: Cellular Chemistry, Structure, and Physiology Module 5: Cellular Reproduction NC Essential Standard: 1.2.2 Analyze how cells grow and reproduce in terms of interphase, mitosis, and cytokinesis

More information

2. Cellular and Molecular Biology

2. Cellular and Molecular Biology 2. Cellular and Molecular Biology 2.1 Cell Structure 2.2 Transport Across Cell Membranes 2.3 Cellular Metabolism 2.4 DNA Replication 2.5 Cell Division 2.6 Biosynthesis 2.1 Cell Structure What is a cell?

More information

CELL BIOLOGY. Which of the following cell structures does not have membranes? A. Ribosomes B. Mitochondria C. Chloroplasts D.

CELL BIOLOGY. Which of the following cell structures does not have membranes? A. Ribosomes B. Mitochondria C. Chloroplasts D. 1 CELL BIOLOGY PROKARYOTIC and EUKARYOTIC SP/1. SP/2. SP/4. Plant and animal cells both have A. ribosomes, cell walls and mitochondria. B. Golgi apparatus, chromosomes and mitochondria. C. Golgi apparatus,

More information

THE CELL CYCLE & MITOSIS. Asexual Reproduction: Production of genetically identical offspring from a single parent.

THE CELL CYCLE & MITOSIS. Asexual Reproduction: Production of genetically identical offspring from a single parent. THE CELL CYCLE & MITOSIS Asexual Reproduction: Production of genetically identical offspring from a single parent. Sexual Reproduction: The fusion of two separate parent cells that produce offspring with

More information

SPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES.

SPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES. THE TERMS RUN AND TUMBLE ARE GENERALLY ASSOCIATED WITH A) cell wall fluidity. B) cell membrane structures. C) taxic movements of the cell. D) clustering properties of certain rod-shaped bacteria. A MAJOR

More information

Plant and animal cells (eukaryotic cells) have a cell membrane, cytoplasm and genetic material enclosed in a nucleus.

Plant and animal cells (eukaryotic cells) have a cell membrane, cytoplasm and genetic material enclosed in a nucleus. 4.1 Cell biology Cells are the basic unit of all forms of life. In this section we explore how structural differences between types of cells enables them to perform specific functions within the organism.

More information

How many lessons is it?

How many lessons is it? Science Unit Learning Summary Content Eukaryotes and Prokaryotes Cells are the basic unit of all life forms. A eukaryotic cell contains genetic material enclosed within a nucleus. Plant and animal cells

More information

The facts about cells

The facts about cells The facts about cells By Regina Bailey, ThoughtCo.com on 10.18.17 Word Count 867 Level MAX An illustration of cells. Photo from Pixabay. Cells are the fundamental units of life. Whether they be unicellular

More information

Chapter 4. Table of Contents. Section 1 The History of Cell Biology. Section 2 Introduction to Cells. Section 3 Cell Organelles and Features

Chapter 4. Table of Contents. Section 1 The History of Cell Biology. Section 2 Introduction to Cells. Section 3 Cell Organelles and Features Cell Structure and Function Table of Contents Section 1 The History of Cell Biology Section 2 Introduction to Cells Section 3 Cell Organelles and Features Section 4 Unique Features of Plant Cells Section

More information

MONTGOMERY COUNTY COMMUNITY COLLEGE BIO 140 CHAPTER 4. Functional Anatomy of Prokaryotic and Eukaryotic Cells

MONTGOMERY COUNTY COMMUNITY COLLEGE BIO 140 CHAPTER 4. Functional Anatomy of Prokaryotic and Eukaryotic Cells MONTGOMERY COUNTY COMMUNITY COLLEGE BIO 140 CHAPTER 4 Functional Anatomy of Prokaryotic and Eukaryotic Cells I. PROKARYOTES A. Structure Of The Cell: Chemical Composition And Function 1. Cell Wall a. composition

More information

AMADEPA Association Martiniquaise pour le Developpement des Plantes Alimentaires

AMADEPA Association Martiniquaise pour le Developpement des Plantes Alimentaires AMADEPA Association Martiniquaise pour le Developpement des Plantes Alimentaires 29eme CONGRES ANNUEL ANNUAL MEETING REUNION ANNUAL Agriculture Intensive dans les Iles de la Caraibe : enjeux, contraintes

More information

CELL GROWTH AND DIVISION. Chapter 10

CELL GROWTH AND DIVISION. Chapter 10 CELL GROWTH AND DIVISION Chapter 10 Cell division = The formation of 2 daughter cells from a single parent cell Increases ratio of surface area to volume for each cell Allows for more efficient exchange

More information

(A) Heterotrophs produce some organic nutrients, and must absorb inorganic nutrients from the environment.

(A) Heterotrophs produce some organic nutrients, and must absorb inorganic nutrients from the environment. MCAT Biology - Problem Drill 09: Prokaryotes and Fungi Question No. 1 of 10 Instructions: (1) Read the problem and answer choices carefully; (2) Work the problems on paper as needed; (3) Pick the correct

More information

Chapter 27: Bacteria and Archaea

Chapter 27: Bacteria and Archaea Name Period Overview 1. The chapter opens with amazing tales of life at the extreme edge. What are the masters of adaptation? Describe the one case you thought most dramatic. Concept 27.1 Structural and

More information

The Cell Cycle. Chapter 12

The Cell Cycle. Chapter 12 The Cell Cycle Chapter 12 Why are cells small? As cells get bigger they don t work as well WHY? Difficulties Larger Cells Have: More demands on its DNA Less efficient in moving nutrients/waste across its

More information

Cell. A Montagud E Navarro P Fernández de Córdoba JF Urchueguía

Cell. A Montagud E Navarro P Fernández de Córdoba JF Urchueguía presents A Montagud E Navarro P Fernández de Córdoba JF Urchueguía definition causes classical cell theory modern cell theory Basic elements life chemistry lipids nucleic acids amino acids carbohydrates

More information

Overview of Cells. Prokaryotes vs Eukaryotes The Cell Organelles The Endosymbiotic Theory

Overview of Cells. Prokaryotes vs Eukaryotes The Cell Organelles The Endosymbiotic Theory Overview of Cells Prokaryotes vs Eukaryotes The Cell Organelles The Endosymbiotic Theory Prokaryotic Cells Archaea Bacteria Come in many different shapes and sizes.5 µm 2 µm, up to 60 µm long Have large

More information

Student Workbook BIOLOGY. for NGSS

Student Workbook BIOLOGY. for NGSS Student Workbook BIOLOGY for NGSS LS1.A Cell Specialization & Organization Key terms base-pairing rule cell DNA eukaryotic cell gene hierarchical structure nucleotide organelle organ system prokaryotic

More information

Methods of genetic transformation :

Methods of genetic transformation : Indirect transformation: Genetic transformation of plant tissues with the use of Agrobacterium, Ti-plasmid and mechanism of T-DNA transfer (different protein involved and their role, vir region and other

More information

Class XI Chapter 8 Cell The Unit of Life Biology

Class XI Chapter 8 Cell The Unit of Life Biology Question 1: Which of the following is not correct? (a) Robert Brown discovered the cell. (b) Schleiden and Schwann formulated the cell theory. (c) Virchow explained that cells are formed from pre-existing

More information

5.1 Cell Division and the Cell Cycle

5.1 Cell Division and the Cell Cycle 5.1 Cell Division and the Cell Cycle Lesson Objectives Contrast cell division in prokaryotes and eukaryotes. Identify the phases of the eukaryotic cell cycle. Explain how the cell cycle is controlled.

More information

Major Plant Hormones 1.Auxins 2.Cytokinins 3.Gibberelins 4.Ethylene 5.Abscisic acid

Major Plant Hormones 1.Auxins 2.Cytokinins 3.Gibberelins 4.Ethylene 5.Abscisic acid Plant Hormones Lecture 9: Control Systems in Plants What is a Plant Hormone? Compound produced by one part of an organism that is translocated to other parts where it triggers a response in target cells

More information

Characteristics of Life

Characteristics of Life Characteristics of Life All living things share some basic characteristics: 1. Organization 2. Movement 3. Made up of cells 4. Reproduce 5. Grow and / or develop 6. Obtain and use energy 7. Respond to

More information

Question 1: Which of the following is not correct? (a) Robert Brown discovered the cell. (b) Schleiden and Schwann formulated the cell theory. (c) Virchow explained that cells are formed from pre-existing

More information

Cells. Structural and functional units of living organisms

Cells. Structural and functional units of living organisms Cells Structural and functional units of living organisms Eukaryotic ( true nucleus ) vs. Prokaryotic ( before nucleus ) cells Proks Eukaryotic ( true nucleus ) vs. Prokaryotic ( before nucleus ) cells

More information

9/2/17. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes

9/2/17. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes Molecular and Cellular Biology Animal Cell ((eukaryotic cell) -----> compare with prokaryotic cell) ENDOPLASMIC RETICULUM (ER) Rough ER Smooth ER Flagellum Nuclear envelope Nucleolus NUCLEUS Chromatin

More information

2011 The Simple Homeschool Simple Days Unit Studies Cells

2011 The Simple Homeschool Simple Days Unit Studies Cells 1 We have a full line of high school biology units and courses at CurrClick and as online courses! Subscribe to our interactive unit study classroom and make science fun and exciting! 2 A cell is a small

More information

Name 8 Cell Cycle and Meiosis Test Date Study Guide You must know: The structure of the replicated chromosome. The stages of mitosis.

Name 8 Cell Cycle and Meiosis Test Date Study Guide You must know: The structure of the replicated chromosome. The stages of mitosis. Name 8 Cell Cycle and Meiosis Test Date Study Guide You must know: The structure of the replicated chromosome. The stages of mitosis. The role of kinases and cyclin in the regulation of the cell cycle.

More information

Chapter 6: Cell Growth and Reproduction Lesson 6.1: The Cell Cycle and Mitosis

Chapter 6: Cell Growth and Reproduction Lesson 6.1: The Cell Cycle and Mitosis Chapter 6: Cell Growth and Reproduction Lesson 6.1: The Cell Cycle and Mitosis No matter the type of cell, all cells come from preexisting cells through the process of cell division. The cell may be the

More information

Mr. Jensen/Period: 1. The diagram below illustrates the distribution of fossils in undisturbed layers of silt at the bottom of the ocean.

Mr. Jensen/Period: 1. The diagram below illustrates the distribution of fossils in undisturbed layers of silt at the bottom of the ocean. Name: 1. The diagram below illustrates the distribution of fossils in undisturbed layers of silt at the bottom of the ocean. Date: /Page#: Mr. Jensen/Period: 3. In the diagram below of undisturbed sedimentary

More information

THE NOPALINE SYNTHASE PROMOTER AS A MODEL SYSTEM FOR STUDYING PLANT RESPONSE TO UV-B

THE NOPALINE SYNTHASE PROMOTER AS A MODEL SYSTEM FOR STUDYING PLANT RESPONSE TO UV-B International Journal of Environmentally Conscious Design & Manufacturing, Vol. 10, No. 3, 2001-2002 THE NOPALINE SYNTHASE PROMOTER AS A MODEL SYSTEM FOR STUDYING PLANT RESPONSE TO UV-B GYUNG-HEE YU AND

More information

NOTE: Questions are written on both sides of the sheets of paper making up this exam booklet!

NOTE: Questions are written on both sides of the sheets of paper making up this exam booklet! Biology 1010 Section A Midterm 1 January 30, 2008 (print): ANSWER KEY Name (signature): Student I.D. #: Time: 50 minutes Read the following instructions: 1. Do not open the examination until you are instructed

More information

End of Course Biology Reporting Category 1 Cell Structure and Function

End of Course Biology Reporting Category 1 Cell Structure and Function End of Course Biology Reporting Category 1 Cell Structure and Function 1. An iodine solution is placed on the cut side of a potato. Within seconds, a blue-black color appears. What is most likely occurring?

More information

Investigation 7 Part 1: CELL DIVISION: MITOSIS

Investigation 7 Part 1: CELL DIVISION: MITOSIS Investigation 7 Part 1: CELL DIVISION: MITOSIS How do eukaryotic cells divide to produce genetically identical cells? BACKGROUND One of the characteristics of living things is the ability to replicate

More information

Questions for Biology IIB (SS 2006) Wilhelm Gruissem

Questions for Biology IIB (SS 2006) Wilhelm Gruissem Questions for Biology IIB (SS 2006) Plant biology Wilhelm Gruissem The questions for my part of Biology IIB, Plant Biology, are provided for self-study and as material for the exam. Please note that the

More information

Animal Cell Organelles. Plant Cell. Organelle. Cell Wall. Chloroplasts. Vacuole

Animal Cell Organelles. Plant Cell. Organelle. Cell Wall. Chloroplasts. Vacuole Cell Biology Higher Electron vs Light Microscope Light use light and lenses to magnify specimen Electron use a beam of electrons to form an image Electron higher magnification and higher resolution Electron

More information

Cell day 1.notebook September 01, Study the picture of a prokaryotic cell on page 162 in a textbook and the two eukaryotic cells on page 163.

Cell day 1.notebook September 01, Study the picture of a prokaryotic cell on page 162 in a textbook and the two eukaryotic cells on page 163. BellRinger: Log into a clicker! Study the picture of a prokaryotic cell on page 162 in a textbook and the two eukaryotic cells on page 163. Compare them and list similarities and differences. Sep 11 11:00

More information

Mitosis. Meiosis MP3. Why do cells divide? Why Do Cells Need To Divide? Vocab List Chapter 10 & 11. What has to happen before a cell divides? divides?

Mitosis. Meiosis MP3. Why do cells divide? Why Do Cells Need To Divide? Vocab List Chapter 10 & 11. What has to happen before a cell divides? divides? MP3 Vocab List Chapter 10 & 11 Mitosis Anaphase Mitosis Cell Cycle Telophase Cytokinesis Cell Division Metaphase 4 Daughter Cells Prophase Meiosis Diploid Somatic Cells Interphase Haploid Parent Cell Gametes

More information

= Monera. Taxonomy. Domains (3) BIO162 Page Baluch. Taxonomy: classifying and organizing life

= Monera. Taxonomy. Domains (3) BIO162 Page Baluch. Taxonomy: classifying and organizing life Taxonomy BIO162 Page Baluch Taxonomy: classifying and organizing life species Genus Family Order Class Phylum Kingdom Spaghetti Good For Over Came Phillip King Domains (3) DOMAINS 1. Bacteria 2. Archea

More information

no.1 Raya Ayman Anas Abu-Humaidan

no.1 Raya Ayman Anas Abu-Humaidan no.1 Raya Ayman Anas Abu-Humaidan Introduction to microbiology Let's start! As you might have concluded, microbiology is the study of all organisms that are too small to be seen with the naked eye, Ex:

More information

Anaphase, Telophase. Animal cells divide their cytoplasm by forming? Cleavage furrow. Bacteria, Paramecium, Amoeba, etc. reproduce by...

Anaphase, Telophase. Animal cells divide their cytoplasm by forming? Cleavage furrow. Bacteria, Paramecium, Amoeba, etc. reproduce by... The 4 phases of mitosis Animal cells divide their cytoplasm by forming? Bacteria, Paramecium, Amoeba, etc. reproduce by... Cell which after division is identical to the original is called a Prophase, Metaphase,

More information

Cell Division: the process of copying and dividing entire cells The cell grows, prepares for division, and then divides to form new daughter cells.

Cell Division: the process of copying and dividing entire cells The cell grows, prepares for division, and then divides to form new daughter cells. Mitosis & Meiosis SC.912.L.16.17 Compare and contrast mitosis and meiosis and relate to the processes of sexual and asexual reproduction and their consequences for genetic variation. 1. Students will describe

More information

Cell Theory. Cell Structure. Chapter 4. Cell is basic unit of life. Cells discovered in 1665 by Robert Hooke

Cell Theory. Cell Structure. Chapter 4. Cell is basic unit of life. Cells discovered in 1665 by Robert Hooke Cell Structure Chapter 4 Cell is basic unit of life Cell Theory Cells discovered in 1665 by Robert Hooke Early cell studies conducted by - Mathias Schleiden (1838) - Theodor Schwann (1839) Schleiden &

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1121356/dc1 Supporting Online Material for Polar PIN Localization Directs Auxin Flow in Plants Justyna Wiśniewska, Jian Xu, Daniela Seifertová, Philip B. Brewer, Kamil

More information

Chapter 4 A Tour of the Cell*

Chapter 4 A Tour of the Cell* Chapter 4 A Tour of the Cell* *Lecture notes are to be used as a study guide only and do not represent the comprehensive information you will need to know for the exams. The Fundamental Units of Life Cells

More information

Cell Division: the process of copying and dividing entire cells The cell grows, prepares for division, and then divides to form new daughter cells.

Cell Division: the process of copying and dividing entire cells The cell grows, prepares for division, and then divides to form new daughter cells. Mitosis & Meiosis SC.912.L.16.17 Compare and contrast mitosis and meiosis and relate to the processes of sexual and asexual reproduction and their consequences for genetic variation. 1. Students will describe

More information

Topic 8 Mitosis & Meiosis Ch.12 & 13. The Eukaryotic Genome. The Eukaryotic Genome. The Eukaryotic Genome

Topic 8 Mitosis & Meiosis Ch.12 & 13. The Eukaryotic Genome. The Eukaryotic Genome. The Eukaryotic Genome Topic 8 Mitosis & Meiosis Ch.12 & 13 The Eukaryotic Genome pp. 244-245,268-269 Genome All of the genes in a cell. Eukaryotic cells contain their DNA in long linear pieces. In prokaryotic cells, there is

More information

the noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB)

the noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) Biology of the the noisy gene Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) day III: noisy bacteria - Regulation of noise (B. subtilis) - Intrinsic/Extrinsic

More information

Lab tomorrow: Bacterial Diseases. Bacteria

Lab tomorrow: Bacterial Diseases. Bacteria Lab tomorrow: Bacterial Diseases Quiz: Koch s Postulates (p. 17-19), Botrytis Predisposition (p. 97)., And, intros for Bacteria (pp 67-69), Biocontrol of Crown Gall (p. 117), and Observation of Viral Movement

More information

9/11/18. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes

9/11/18. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes Molecular and Cellular Biology Animal Cell ((eukaryotic cell) -----> compare with prokaryotic cell) ENDOPLASMIC RETICULUM (ER) Rough ER Smooth ER Flagellum Nuclear envelope Nucleolus NUCLEUS Chromatin

More information

Topic 3: Cells Ch. 6. Microscopes pp Microscopes. Microscopes. Microscopes. Microscopes

Topic 3: Cells Ch. 6. Microscopes pp Microscopes. Microscopes. Microscopes. Microscopes Topic 3: Cells Ch. 6 -All life is composed of cells and all cells have a plasma membrane, cytoplasm, and DNA. pp.105-107 - The development of the microscope was the key to understanding that all living

More information

Foundation Cell Biology

Foundation Cell Biology Foundation Cell Biology Electron vs Light Microscope Light use light and lenses to magnify specimen Electron use a beam of electrons to form an image Electron higher magnification and higher resolution

More information

Towards the Ultimate Solution: Genetic Resistance to HLB in Commercial Citrus. Greening Summit Florida Citrus Growers Institute 2008

Towards the Ultimate Solution: Genetic Resistance to HLB in Commercial Citrus. Greening Summit Florida Citrus Growers Institute 2008 Towards the Ultimate Solution: Genetic Resistance to HLB in Commercial Citrus Greening Summit Florida Citrus Growers Institute 2008 Jude Grosser University of Florida, Citrus Research and Education Center,

More information

The nature of genomes. Viral genomes. Prokaryotic genome. Nonliving particle. DNA or RNA. Compact genomes with little spacer DNA

The nature of genomes. Viral genomes. Prokaryotic genome. Nonliving particle. DNA or RNA. Compact genomes with little spacer DNA The nature of genomes Genomics: study of structure and function of genomes Genome size variable, by orders of magnitude number of genes roughly proportional to genome size Plasmids symbiotic DNA molecules,

More information

Burton's Microbiology for the Health Sciences

Burton's Microbiology for the Health Sciences Burton's Microbiology for the Health Sciences Chapter 3. Cell Structure and Taxonomy Chapter 3 Outline Introduction Eucaryotic Cell Structure Procaryotic Cell Structure Summary of Structural Differences

More information

A DNA Sequence 2017/12/6 1

A DNA Sequence 2017/12/6 1 A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta

More information

National Cell structure Pupil notes. Cell Biology. Sub-topic (1.1) Cell Structure. On completion of this topic I will be able to state that:

National Cell structure Pupil notes. Cell Biology. Sub-topic (1.1) Cell Structure. On completion of this topic I will be able to state that: Cell Biology Sub-topic (1.1) Cell Structure On completion of this topic I will be able to state that: Cells differ in structure as to whether they are animal, plant, fungi or bacterial cells. The detail

More information

Topic 2: Cells (12 hours)

Topic 2: Cells (12 hours) Topic : Cells ( hours). Cell theory hours.. Outline the cell theory. Include the following. Living organisms are composed of cells. Cells are the smallest unit of life. Cells come from pre-existing cells...

More information

Complete the table by stating the function associated with each organelle. contains the genetic material.... lysosome ribosome... Table 6.

Complete the table by stating the function associated with each organelle. contains the genetic material.... lysosome ribosome... Table 6. 1 (a) Table 6.1 gives the functions of certain organelles in a eukaryotic cell. Complete the table by stating the function associated with each organelle. The first row has been completed for you. Organelle

More information

Pre-lab Homework Lab 4: The Cell

Pre-lab Homework Lab 4: The Cell Lab Section: Name: Pre-lab Homework After reading over the lab and the cell chapter in your textbook, answer these questions to be turned in at the beginning of the lab! 1. Define organelle : Two examples

More information

SOALAN ULANGKAJI BAB 5 BIOLOGI TINGKATAN 4

SOALAN ULANGKAJI BAB 5 BIOLOGI TINGKATAN 4 SOALAN ULANGKAJI BAB 5 BIOLOGI TINGKATAN 4 SECTION A: OBJECTIVES QUESTIONS. Diagram shows the phases in a cell cycle. Diagram 3 Diagram What is V? A Mitosis B Cytokinesis C Stage S D Stage G What is the

More information

#2 How do organisms grow?

#2 How do organisms grow? #2 How do organisms grow? Why doesn t a cell keep growing larger and larger? The larger a cell becomes the more demands the cell places on its DNA. The cell also has trouble moving enough nutrients and

More information

Assist. Prof. Martina Šeruga Musić acad. year 2016/17

Assist. Prof. Martina Šeruga Musić acad. year 2016/17 Assist. Prof. Martina Šeruga Musić acad. year 2016/17 PHYTOPATHOGENIC BACTERIA there are more than 100 species of known phytopathogenic bacteria genera Agrobacterium, Erwinia, Ralstonia, Pseudomonas, Xanthomonas,

More information

Cells & Cell Organelles. Doing Life s Work

Cells & Cell Organelles. Doing Life s Work Cells & Cell Organelles Doing Life s Work Types of cells bacteria cells Prokaryote Eukaryotes animal cells plant cells Cell size comparison Animal cell Bacterial cell most bacteria 1-10 microns eukaryotic

More information

10/1/2014. Chapter Explain why the cell is considered to be the basic unit of life.

10/1/2014. Chapter Explain why the cell is considered to be the basic unit of life. Chapter 4 PSAT $ by October by October 11 Test 3- Tuesday October 14 over Chapter 4 and 5 DFA- Monday October 20 over everything covered so far (Chapters 1-5) Review on Thursday and Friday before 1. Explain

More information

Why mitosis?

Why mitosis? Mitosis occurs only in eukaryotes. Prokaryotes (i.e., archaea and bacteria) divide via binary fission. Mitosis is the process by which the somatic cells of all multicellular organisms multiply. Somatic

More information

Prokaryotic and Eukaryotic Cells. Structure and Function

Prokaryotic and Eukaryotic Cells. Structure and Function Prokaryotic and Eukaryotic Cells Structure and Function In general microbes or microorganisms may be either prokaryotic (bacteria) or eukaryotic (protists, fungi, and some animals). However, there are

More information

Organisms: We will need to have some examples in mind for our spherical cows.

Organisms: We will need to have some examples in mind for our spherical cows. Lecture 4: Structure and Composition (Sept. 15) 4.1 Reading Assignment for Lectures 3-4: Phillips, Kondev, Theriot (PKT), Chapter 2 Problem Set 1 (due Sept. 24) now posted on the website. Cellular materials:

More information

Chapter 12: The Cell Cycle

Chapter 12: The Cell Cycle Name Period Chapter 12: The Cell Cycle Overview: 1. What are the three key roles of cell division? State each role, and give an example. Key Role Example 2. What is meant by the cell cycle? Concept 12.1

More information

World of The Cell. How big is a cell?

World of The Cell. How big is a cell? World of The Cell Chapter 4 How big is a cell? The smallest cell is a Mycoplasmas (very small bacteria are barely bigger) Bacteria are just bigger than a single organelle of a animal cell Plant and animal

More information

Cellular Division. copyright cmassengale

Cellular Division. copyright cmassengale Cellular Division 1 Cell Division All cells are derived from pre- existing cells New cells are produced for growth and to replace damaged or old cells Differs in prokaryotes (bacteria) and eukaryotes (protists,

More information

Honors Biology-CW/HW Cell Biology 2018

Honors Biology-CW/HW Cell Biology 2018 Class: Date: Honors Biology-CW/HW Cell Biology 2018 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Hooke s discovery of cells was made observing a. living

More information

Basic Structure of a Cell

Basic Structure of a Cell Basic Structure of a Cell Prokaryotic Cells No nucleus Archaea & Eubacteria One circular chromosome Extremely small Eukaryotic Cells Has a nucleus!!! Membrane-bound organelles Plants, Animals, Fungi, &

More information

Quiz answers. Allele. BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 17: The Quiz (and back to Eukaryotic DNA)

Quiz answers. Allele. BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 17: The Quiz (and back to Eukaryotic DNA) BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 17: The Quiz (and back to Eukaryotic DNA) http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Quiz answers Kinase: An enzyme

More information

Cell Structure. Chapter 4. Cell Theory. Cells were discovered in 1665 by Robert Hooke.

Cell Structure. Chapter 4. Cell Theory. Cells were discovered in 1665 by Robert Hooke. Cell Structure Chapter 4 Cell Theory Cells were discovered in 1665 by Robert Hooke. Early studies of cells were conducted by - Mathias Schleiden (1838) - Theodor Schwann (1839) Schleiden and Schwann proposed

More information

Basic Biology. Content Skills Learning Targets Assessment Resources & Technology

Basic Biology. Content Skills Learning Targets Assessment Resources & Technology Teacher: Lynn Dahring Basic Biology August 2014 Basic Biology CEQ (tri 1) 1. What are the parts of the biological scientific process? 2. What are the essential molecules and elements in living organisms?

More information

Dr. Mahmood S. Choudhery, PhD, Postdoc (USA) Assistant Professor Tissue Engineering & Regenerative Medicine King Edward Medical University

Dr. Mahmood S. Choudhery, PhD, Postdoc (USA) Assistant Professor Tissue Engineering & Regenerative Medicine King Edward Medical University CELL DIVISION Dr. Mahmood S. Choudhery, PhD, Postdoc (USA) Assistant Professor Tissue Engineering & Regenerative Medicine King Edward Medical University Cell Division The key roles of cell division Unicellular

More information

DNA Technology, Bacteria, Virus and Meiosis Test REVIEW

DNA Technology, Bacteria, Virus and Meiosis Test REVIEW Be prepared to turn in a completed test review before your test. In addition to the questions below you should be able to make and analyze a plasmid map. Prokaryotic Gene Regulation 1. What is meant by

More information

REVIEW 2: CELLS & CELL DIVISION UNIT. A. Top 10 If you learned anything from this unit, you should have learned:

REVIEW 2: CELLS & CELL DIVISION UNIT. A. Top 10 If you learned anything from this unit, you should have learned: Period Date REVIEW 2: CELLS & CELL DIVISION UNIT A. Top 10 If you learned anything from this unit, you should have learned: 1. Prokaryotes vs. eukaryotes No internal membranes vs. membrane-bound organelles

More information

Biology. Mrs. Michaelsen. Types of cells. Cells & Cell Organelles. Cell size comparison. The Cell. Doing Life s Work. Hooke first viewed cork 1600 s

Biology. Mrs. Michaelsen. Types of cells. Cells & Cell Organelles. Cell size comparison. The Cell. Doing Life s Work. Hooke first viewed cork 1600 s Types of cells bacteria cells Prokaryote - no organelles Cells & Cell Organelles Doing Life s Work Eukaryotes - organelles animal cells plant cells Cell size comparison Animal cell Bacterial cell most

More information

Biology I Level - 2nd Semester Final Review

Biology I Level - 2nd Semester Final Review Biology I Level - 2nd Semester Final Review The 2 nd Semester Final encompasses all material that was discussed during second semester. It s important that you review ALL notes and worksheets from the

More information