GFP GAL bp 3964 bp
|
|
- Dorcas Carpenter
- 6 years ago
- Views:
Transcription
1 Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive phenotype of salt-stressed Pro35S:AtHKT1;1 plants. Pro35S:AtHKT1;1 plants (center and bottom) are more salt-sensitive than the Col-0 wild-type plants (top) and show stunted growth and chlorosis. Plants were grown as outlined for Figure 5 with a final NaCl concentration of 50 mm.
2 J2731* LB GFP UAS GAL4 RB At1g bp 1088 bp At1g21050 E2586 LB GFP UAS GAL4 RB At1g bp 3964 bp At1g70760 Supplemental Figure 2. Position of enhancer trap T-DNA in the genome of J2731* and E2586. Diagrammatic representation of the site and orientation of insertion of the T- DNA inserts in the enhancer trap lines, as determined by TAIL-PCR. The adjacent genes are annotated as follows. At1g21040 is predicted to be a pseudogene with similarity to genes encoding mutator-like transposases. At1g21050 is expressed but has unknown function. At1g70750 is expressed but has unknown function. At1g70760 is expressed and has similarity with an inorganic carbon transport protein from cyanobacteria.
3 A B C D E F G H Supplemental Figure 3. Laser dissection of transverse root sections. Photographs illustrating the laser dissection of a transverse section of an J2731* UASGAL4:AtHKT1;1 root to separate cells in the stele and cells of the outer part of the root. (A) Fixed transverse section of a root before commencement of laser dissection. (B) Endodermal cells halfway through being removed by the laser. (C, D) The disc of cells comprising the stele was cut out and has fallen into a PCR tube below the microscope stage. (E, F) The remaining outer part of the root consisting of the epidermal and cortical cells was cut out with the laser. (G, H) The outer part has been cut out and has fallen into a PCR tube below the microscope stage. For A-C, E-G scale bars indicate 50 µm.
4 Ph Co En Pe Xy Supplemental Figure 4. Electron micrograph of transverse section of J2731*UASGAL4:AtHKT1;1 root. The anatomy of root cells of J2731* and J2731*UASGAL4:AtHKT1;1 plants was examined with transmission electron microscopy. Plants were grown under the same conditions as for x-ray microanalysis. The tissue analysed was located 20 mm from the root tip. No structural differences in terms of cell size, number and shape or degree of vacuolation were seen between genotypes (data not shown). Co, cortex; En, endodermis; Pe, pericycle; Xy, xylem; Ph, phloem. Scale bar indicates 10 µm.
5 Genotype B Na Mg P S K Ca Mn Fe Zn J2731* parents n = 93 J2731* nulls n = 71 J2731* UAS:HKT N = 285 E2586 parents n = 65 E2586 nulls n = 39 E2586 UAS:HKT N = ± ± ± ± ± ± ± ± ± ± ± ± 22 a 376 ± ± 19 a 631 ± ± 64 a 1052 ± ± ± ± ± ± 6 b 374 ± ± 8 b 590 ± ± 3 b 1090 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± 21 a 429 ± ± ± 15 a 4819 ± 96 a 1173 ± ± ± ± ± ± 4 b 372 ± ± ± 6 b 5143 ± 38 b 1101 ± ± ± ± 0.1 Supplemental Table 1. Shoot accumulation of ten elements in UAS GAL4 :HKT1;1 plants. Using ICP-AES, the content in mg. kg -1 FM of ten elements was measured in leaf tissue from five-weekold plants grown on a soil-like mix and supplemented with a nutrient solution containing 2 mm NaCl. Segregating J2731* UAS GAL4 :HKT1;1 T2 plants descending from 19 independent T1 plants and segregating E2586 UAS GAL4 :HKT1;1 T2 plants descending from 13 independent T1 plants were used in this experiment. All UAS GAL4 :HKT1;1 plants were genotyped using PCR to detect the presence or absence of the T-DNA insert. Statistical analysis was applied for the comparison of the transgenic UAS GAL4 :HKT1;1 plants with the corresponding null segregants. The data were log transformed and an F-test was performed with P < 0.05 to determine equal or unequal variance in the data for each element. Accordingly, a two-sample two-tailed Student s t-test was performed (P < 0.01) assuming equal or unequal variance. Values that were found to be significantly different using the described Student s t-test with P < 0.01 are indicated with a and b. When comparing the null segregants with the corresponding parental enhancer trap line, no elements were found to be significantly different using the same statistical analysis. Values presented are averages ± SEM.
6 Genotype Shoot [Na + ] Root [Na + ] Shoot [K + ] Root [K + ] J2731* 5133 ± ± ± ± 120 J2731* UAS:HKT 2600 ± ± ± ± 133 Supplemental Table 2. Accumulation of Na + and K + in shoot and roots of two-week-old J2731*UAS GAL4 :HKT1;1 plants. The content of Na + and K + in whole shoot and whole root tissue of two-week-old seedlings grown in hydroponics as for x-ray microanalysis was measured using ICP-AES. The tissues were separated, rinsed in MilliQ water, blotted and weighed prior to ICP-AES analysis. Three replicates, each with nine shoots or root systems, were used. Values presented are averages ± SEM.
Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2
Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2 IRT1, FRO2 and FIT expression levels in roots of the wild-type, nas4x- 1 and nas4x-2, showing that in both nas mutants
More information** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.
Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *
More informationSupplemental Data. Wang et al. (2014). Plant Cell /tpc
Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and
More informationSupplemental Data. Perrella et al. (2013). Plant Cell /tpc
Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization
More informationSupplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.
Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny
More informationEthylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis
Ethylene is critical to the maintenance of primary root growth and Fe homeostasis under Fe stress in Arabidopsis Guangjie Li, Weifeng Xu, Herbert J. Kronzucker, Weiming Shi * Supplementary Data Supplementary
More informationPOTASSIUM IN PLANT GROWTH AND YIELD. by Ismail Cakmak Sabanci University Istanbul, Turkey
POTASSIUM IN PLANT GROWTH AND YIELD by Ismail Cakmak Sabanci University Istanbul, Turkey Low K High K High K Low K Low K High K Low K High K Control K Deficiency Cakmak et al., 1994, J. Experimental Bot.
More informationNature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.
Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods
More informationDNA or RNA metabolism (1%) Signal transduction (2%) Development (2%) Other cellular processes (17%)
Fig. 35-24 Other metabolism (18%) DNA or RNA metabolism (1%) Signal transduction (2%) Development (2%) Unknown (24%) Energy pathways (3%) Cell division and organization (3%) Transport (4%) Transcription
More informationFigure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated
Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin
More informationGenetic dissection of the Arabidopsis thaliana ionome
Genetic dissection of the Arabidopsis thaliana ionome Genome Ionome Landscape distribution David E Salt Purdue University, USA What is the Ionome Environment Transcriptome Proteome Ionome The elemental
More informationTable S1 List of primers used for genotyping and qrt-pcr.
Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!
More informationMapping connections between the genome, ionome and the physical landscape. Photo by Bruce Bohm. David E Salt Purdue University, USA
Mapping connections between the genome, ionome and the physical landscape Photo by Bruce Bohm David E Salt Purdue University, USA What is the Ionome Environment Transcriptome Proteome Ionome The elemental
More informationSupplementary Figure 1. Phenotype of the HI strain.
Supplementary Figure 1. Phenotype of the HI strain. (A) Phenotype of the HI and wild type plant after flowering (~1month). Wild type plant is tall with well elongated inflorescence. All four HI plants
More informationGENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL
GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1121356/dc1 Supporting Online Material for Polar PIN Localization Directs Auxin Flow in Plants Justyna Wiśniewska, Jian Xu, Daniela Seifertová, Philip B. Brewer, Kamil
More informationSupplemental Data. Chen and Thelen (2010). Plant Cell /tpc
Supplemental Data. Chen and Thelen (2010). Plant Cell 10.1105/tpc.109.071837 1 C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector
More informationRegulation of Phosphate Homeostasis by microrna in Plants
Regulation of Phosphate Homeostasis by microrna in Plants Tzyy-Jen Chiou 1 *, Kyaw Aung 1,2, Shu-I Lin 1,3, Chia-Chune Wu 1, Su-Fen Chiang 1, and Chun-Lin Su 1 Abstract Upon phosphate (Pi) starvation,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/301/ra98/dc1 Supplementary Materials for Regulation of Epithelial Morphogenesis by the G Protein Coupled Receptor Mist and Its Ligand Fog Alyssa J. Manning,
More informationThe sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively as positive regulators of salt stress tolerance in rice
Lou et al. BMC Plant Biology (2018) 18:203 https://doi.org/10.1186/s12870-018-1408-0 RESEARCH ARTICLE Open Access The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively
More informationBiology 1030 Winter 2009
Meeting Tissue Needs II Chapter 36 (738-755) Chapter 37 (756-770) Cellular Currency Plants harvest solar energy Photosynthesis Produces sugars Proteins, nucleic acids, lipids? H 2 O CO 2 Plants cells still
More informationSESSION 6: SUPPORT AND TRANSPORT SYSTEMS IN PLANTS PART 1
SESSION 6: SUPPORT AND TRANSPORT SYSTEMS IN PLANTS PART 1 KEY CONCEPTS In this session we will focus on summarising what you need to know about: - Anatomy of dicotyledonous plants Root and stem: distribution
More informationENDODERMIS & POLARITY
https://en.wikipedia.org/wiki/casparian_strip ENDODERMIS & POLARITY Niloufar Pirayesh 13.01.2016 PCDU SEMINAR 2 What is Endodermis? It helps with Regulate the movement of water ions and hormones. (in and
More informationOutline. Leaf Development. Leaf Structure - Morphology. Leaf Structure - Morphology
Outline 1. Leaf Structure: Morphology & Anatomy 2. Leaf Development A. Anatomy B. Sector analysis C. Leaf Development Leaf Structure - Morphology Leaf Structure - Morphology 1 Leaf Structure - Morphology
More information2014 Pearson Education, Inc. 1
1 CO 2 O 2 Light Sugar O 2 and minerals CO 2 2 Buds 42 29 21 34 13 26 5 18 10 31 23 8 15 28 16 2 24 Shoot apical meristem 7 3 20 1 mm 32 11 19 12 6 4 1 25 17 14 9 40 27 22 3 Cell wall Apoplastic route
More informationHormonal and other chemical effects on plant growth and functioning. Bill Davies Lancaster Environment Centre, UK
Hormonal and other chemical effects on plant growth and functioning Bill Davies Lancaster Environment Centre, UK Integrating the impacts of soil drought and atmospheric stress High radiant load Reduced
More informationSupplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed
Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed using the Geneious software. Accession numbers of the
More informationPlants. Tissues, Organs, and Systems
Plants Tissues, Organs, and Systems Meristematic cells Specialized cells that are responsible for producing specialized cells, they produce three types of tissue in the body of a plant. Meristematic Cells
More informationPlant Tissues and Organs. Topic 13 Plant Science Subtopics , ,
Plant Tissues and Organs Topic 13 Plant Science Subtopics 13.1.2, 13.1.3, 13.1.4 Objectives: List and describe the major plant organs their structure and function List and describe the major types of plant
More informationPenghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao
New Phytologist Supporting Information Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bhlh transcription factor MtTT8 Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang
More informationHKT Transporters State of the Art
Int. J. Mol. Sci. 2013, 14, 20359-20385; doi:10.3390/ijms141020359 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms HKT Transporters State of the
More informationTransitivity-dependent and transitivity-independent cell-to-cell movement of RNA
Himber et al. Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA silencing SUPPLEMENTAL MATERIAL Supplemental material 1. Short-range movement of GFP silencing affects a nearly
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
More information23 2 Roots Slide 2 of 36
2 of 36 Types of Roots Types of Roots What are the two main types of roots? 3 of 36 Types of Roots The two main types of roots are: taproots, which are found mainly in dicots, and fibrous roots, which
More informationThe mode of development in animals and plants is different
The mode of development in animals and plants is different Outcome of animal embryogenesis is a mini edition of the adult Outcome of plant embryogenesis is a simple structure with -root apical meristem
More informationQuestion 1: State the location and function of different types of meristem. Meristems are specialised regions of plant growth. The meristems mark the regions where active cell division and rapid division
More informationBIOL 305L Laboratory One
Please print Full name clearly: BIOL 305L Laboratory One General plant anatomy a great place to start! Introduction Botany is the science of plant life. Traditionally, the science included the study of
More informationPlant Structure. Lab Exercise 24. Objectives. Introduction
Lab Exercise Plant Structure Objectives - Be able to identify plant organs and give their functions. - Learn distinguishing characteristics between monocot and dicot plants. - Understand the anatomy of
More informationBio Factsheet. Transport in Plants. Number 342
Number 342 Transport in Plants This Factsheet: Explains why plants need a transport system Describes what plants transport Describes the tissues which carry out transport Outlines the position of the xylem
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10534 Supplementary Fig. 1. Diagrammatic representation of the N-end rule pathway of targeted proteolysis (after Graciet and Wellmer 2010 9 ). Tertiary, secondary
More informationDEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA
DEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA CHASE BALLARD LINDA EAN HECTOR LOPEZ DR. JOANNA WERNER-FRACZEK IN COLLABORATION WITH DR. PATRICIA SPRINGER S LAB AT UCR AND ROBERT KOBLE PURPOSE OF RESEARCH
More informationTopic 2: Plant Structure & Growth Ch. 35 Angiosperms are the most complex plants. They are composed of cells, tissues, organs and organ systems.
Topic 2: Plant Structure & Growth Ch. 35 Angiosperms are the most complex plants. They are composed of cells, tissues, organs and organ systems. Fig. 35.8 Plant Cells pp.798-802 Types of plant cells Include:
More informationLipid transfer proteins confer resistance to trichothecenes
Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance
More informationTopic 14. The Root System. II. Anatomy of an Actively Growing Root Tip
Topic 14. The Root System Introduction. This is the first of two lab topics that focus on the three plant organs (root, stem, leaf). In these labs we want you to recognize how tissues are organized in
More informationAnatomy of dicotyledonous plants
Anatomy of dicotyledonous plants Differences between Monocotyledons and Dicotyledons All plants are classified as producing seeds or not producing seeds. Those that produce seeds are divided into flowering
More informationEXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA
EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA Item Type text; Electronic Thesis Authors Bergstrand, Lauren Janel Publisher The University of Arizona. Rights Copyright is held by the author. Digital
More informationTransport in Vascular Plants
Chapter 36 Transport in Vascular Plants PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero Vascular tissue Transports nutrients throughout a plant; such
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12791 Supplementary Figure 1 (1/3) WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 1 (2/3) 2 WWW.NATURE.COM/NATURE SUPPLEMENTARY
More informationLab 3: Transpiration. 1 Purpose. BIO124 Plant Science Lab 3 Transpiration 1
1 Purpose The goals of this lab are to (1) observe water movement against gravity from stems to leaves of plants and (2) investigate environmental factors that regulate the rate of transpiration. Introduction
More informationBiology Slide 1 of 36
Biology 1 of 36 2 of 36 Types of Roots Types of Roots What are the two main types of roots? 3 of 36 Types of Roots The two main types of roots are: taproots, which are found mainly in dicots, and fibrous
More informationVisit For All NCERT solutions, CBSE sample papers, Question papers, Notes for Class 6 to 12. Chapter-6 ANATOMY OF FLOWERING PLANTS
Chapter-6 ANATOMY OF FLOWERING PLANTS POINTS TO REMEMBER Anatomy : Anatomy is the study of internal structure of organisms. Plant anatomy includes organisation and structure of tissues. Tissue : A group
More informationChapter 36: Transport in Vascular Plants - Pathways for Survival
Chapter 36: Transport in Vascular Plants - Pathways for Survival For vascular plants, the evolutionary journey onto land involved differentiation into roots and shoots Vascular tissue transports nutrients
More informationClass XI Chapter 6 Anatomy of Flowering Plants Biology
Class XI Chapter 6 Anatomy of Flowering Plants Biology Question 1: State the location and function of different types of meristem. Meristems are specialised regions of plant growth. The meristems mark
More informationSupp- Figure 2 Confocal micrograph of N. benthamiana tissues transiently expressing 35S:YFP-PDCB1. PDCB1 was targeted to plasmodesmata (twin punctate
Supplemental Data. Simpson et al. (009). n rabidopsis GPI-anchor plasmodesmal neck protein with callosebinding activity and potential to regulate cell-to-cell trafficking. 5 0 stack Supp- Figure Confocal
More informationscrew clip air bubble Transpiration itself is not measured directly by a potometer....
1. Transpiration is the loss of water from plants by evaporation. The diagram below shows a potometer, an apparatus used to estimate transpiration rates. water reservoir leafy shoot screw clip air bubble
More informationSupplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc
Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation
More informationRoots and Soil Chapter 5
Roots and Soil Chapter 5 Plant Organs Plant organs are groups of several types of tissues that together perform a particular function. Vegetative organs roots, stems, leaves make and use food, absorb water
More informationROOT STRUCTURE: EXTERNAL ROOT
ROOT STRUCTURE: EXTERNAL ROOT Material: Botany I cards #9 - #12, #13 - #18, #19 - # 23 Presentation: 1. The external parts of the root have been introduced to the children: the root hairs, the root tips,
More informationPlant Anatomy and Tissue Structures
Plant Anatomy and Tissue Structures The Two Major Plant Systems Reproductive shoot (flower) Terminal bud Node Internode Angiosperm plants have threse major organs: Roots Stems Leaves & Flowers Terminal
More informationThe Science of Plants in Agriculture Pl.Sci 102. Getting to Know Plants
The Science of Plants in Agriculture Pl.Sci 102 Getting to Know Plants Growth and Development of Plants Growth and Development of Plants Why it s important to have knowledge about plant development. What
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Overexpression of YFP::GPR-1 in the germline.
Supplementary Figure 1 Overexpression of YFP::GPR-1 in the germline. The pie-1 promoter and 3 utr were used to express yfp::gpr-1 in the germline. Expression levels from the yfp::gpr-1(cai 1.0)-expressing
More informationSupplementary Material. stress responsive genes providing protection of wheat from salinity stress
Supplementary Material Plant growth promoting rhizobacteria Dietzia natronolimnaea modulates the expression of stress responsive genes providing protection of wheat from salinity stress Nidhi Bharti, Shiv
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/452/ra106/dc1 Supplementary Materials for Stem-piped light activates phytochrome B to trigger light responses in Arabidopsis thaliana roots Hyo-Jun Lee, Jun-Ho
More informationBring Your Text to Lab!!!
Bring Your Text to Lab!!! Vascular Plant Anatomy: Flowering Plants Objectives: 1. To observe what the basic structure of vascular plants is, and how and where this form originates. 2. To begin to understand
More informationRice OsHKT2;1 transporter mediates large Na þ influx component into K þ -starved roots for growth
The EMBO Journal (2007) 26, 3003 3014 & 2007 European Molecular Biology Organization All Rights Reserved 0261-4189/07 www.embojournal.org Rice OsHKT2;1 transporter mediates large Na þ influx component
More informationPlant Structure, Growth, and Development
Chapter 35 Plant Structure, Growth, and Development PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Overview: No two Plants Are Alike To some people The fanwort is an intrusive
More informationPlant Anatomy Lab 7 - Stems II
Plant Anatomy Lab 7 - Stems II This exercise continues the previous lab in studying primary growth in the stem. We will be looking at stems from a number of different plant species, and emphasize (1) the
More informationPlant Anatomy. By Umanga Chapagain
Plant Anatomy By Umanga Chapagain PLANT ANATOMY The science of the structure of the organized plant body learned by dissection is called Plant Anatomy. In general, Plant Anatomy refers to study of internal
More informationRon et al SUPPLEMENTAL DATA
Ron et al SUPPLEMENTAL DATA Hairy root transformation using Agrobacterium rhizogenes as a tool for exploring cell type-specific gene expression and function using tomato as a model Mily Ron, Kaisa Kajala,
More informationIntroduction to Botany. Lecture 25
Introduction to Botany. Lecture 25 Alexey Shipunov Minot State University November 2, 2015 Shipunov (MSU) Introduction to Botany. Lecture 25 November 2, 2015 1 / 33 Outline 1 Questions and answers 2 Stem
More informationGenetic and physiological approach to elucidation of Cd absorption mechanism by rice plants
Genetic and physiological approach to elucidation of Cd absorption mechanism by rice plants Satoru Ishikawa National Institute for Agro-Environmental Sciences, 3-1-3, Kannondai, Tsukuba, Ibaraki, 305-8604,
More information* ' ION UPTAKE IN RELATION TO THE '''-'"u.n v DEVELOPMENT OF A ROOT HYPODERMIS
New Phytol. (igj6) JJ, 11-14. '-^ ^^ ' '''-: ^i'i^ J i.. * ' ION UPTAKE IN RELATION TO THE '''-'"u.n v DEVELOPMENT OF A ROOT HYPODERMIS :?m::,^^ BY I. B. FERGUSON* AND D. T. CLARKSON '" ' 'I ARC Letcombe
More information2/25/2013. o Plants take up water and minerals from below ground o Plants take up CO2 and light from above ground THREE BASIC PLANT ORGANS ROOTS
o Plants take up water and minerals from below ground o Plants take up CO2 and light from above ground THREE BASIC PLANT ORGANS o Roots o Stems o Leaves ROOTS o Anchor plant o Absorb water and minerals
More informationHeterosis and inbreeding depression of epigenetic Arabidopsis hybrids
Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Plant growth conditions The soil was a 1:1 v/v mixture of loamy soil and organic compost. Initial soil water content was determined
More informationdownstream (0.8 kb) homologous sequences to the genomic locus of DIC. A DIC mutant strain (ro- 6
A B C D ts Figure S1 Generation of DIC- mcherry expressing N.crassa strain. A. N. crassa colony morphology. When a cot1 (top, left panel) strain is grown at permissive temperature (25 C), it exhibits straight
More informationSupporting Online Material
1 Stomatal Patterning and Differentiation by Synergistic Interactions of Receptor Kinases Elena D. Shpak, Jessica Messmer McAbee, Lynn Jo Pillitteri, and Keiko U. Torii Supporting Online Material Material
More informationDEPARTMENT OF LIFE AND CONSUMER SCIENCES. Plant Structure BOT1501. Semester I: Assignment no. 2 Memorandum
University Examinations DEPARTMENT OF LIFE AND CONSUMER SCIENCES Plant Structure BOT1501 Semester I: Assignment no. 2 Memorandum 2018 QUESTION 1 1.1 Primary growth is the production of new primary tissues
More informationChapter 35: Plant Structure, Growth and Development - No two Plants Are Alike Plant structure
Chapter 35: Plant Structure, Growth and Development - No two Plants Are Alike Plant structure Systems Root and Shoot system Organs Roots, Stems, Leaves Tissues Dermal, Vascular, Ground Cells parencyma,
More informationPLANT TISSUES 12 MARCH 2014
PLANT TISSUES 12 MARCH 2014 Lesson Description In this lesson we: Identify the different types of plant tissue Be able to relate the different structures with the different functions Plant Tissue Summary
More informationCOLLEGE OF THE NORTH ATLANTIC BIOLOGY Practice Final Exam
COLLEGE OF THE NORTH ATLANTIC BIOLOGY 1170 Practice Final Exam Students please take note: This exam has been produced and distributed solely as a practice exam. The questions are similar to questions that
More information(Photo Atlas: Figures 9.147, 9.148, 9.150, 9.1, 9.2, )
BIOL 221 Concepts of Botany Fall 2007 Topic 07: Primary Plant Body: The Root System (Photo Atlas: Figures 9.147, 9.148, 9.150, 9.1, 9.2, 9.5 9.23) A. Introduction The root has the primary functions of
More information1. Transpiration may be defined as the loss of water vapour by diffusion from a plant to its environment.
1. Transpiration may be defined as the loss of water vapour by diffusion from a plant to its environment. The diagram below shows apparatus that can be used to estimate transpiration rates of a leafy shoot.
More information2014 Pearson Education, Inc. 1. Light. Sugar O 2 H 2 O. and minerals CO Pearson Education, Inc.
1 CO 2 O 2 Light ugar O 2 and minerals CO 2 2 Buds 34 42 29 26 31 18 21 13 5 10 23 8 15 28 16 24 hoot apical meristem 2 7 3 20 32 11 19 12 6 4 1 25 17 14 9 40 27 22 1 mm 3 Cell wall Apoplastic route Cytosol
More information23 1 Specialized Tissues in Plants Slide 1 of 34
23 1 Specialized Tissues in Plants 1 of 34 Seed Plant Structure The three principal organs of seed plants are roots, stems, and leaves. These organs perform functions such as the transport of nutrients,
More informationLecture 4: Radial Patterning and Intercellular Communication.
Lecture 4: Radial Patterning and Intercellular Communication. Summary: Description of the structure of plasmodesmata, and the demonstration of selective movement of solutes and large molecules between
More informationAnatomy of Flowering Plants. K C Meena PGT Biology
Anatomy of Flowering Plants K C Meena PGT Biology Tissues A group of similar cells performing same function. Types of plant tissues - Meristematic tissues and permanent tissues. Meristematic tissues Have
More informationChapter 28 Active Reading Guide Plant Structure and Growth
Name: AP Biology Mr. Croft Chapter 28 Active Reading Guide Plant Structure and Growth In this unit on plants, the challenge for students will be to learn the new vocabulary. As we work through this unit,
More informationFig. 1. Longitudinal section of the girdle of a 3-year-old lateral branch in Fuyu 3 weeks after
Fig. 1. Longitudinal section of the girdle of a 3-year-old lateral branch in Fuyu 3 weeks after girdling. The left and right sides are the upper and lower cuts of the wound, respectively. The callus pads
More informationPlant Structure, Growth, and Development
Chapter 35 Plant Structure, Growth, and Development PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions
More informationtree of life phylogeny morphology gram stain chapter 28-29, other groups of organisms Bacteria
tree of life chapter 28-29, other groups of organisms phylogeny key lineages of prokaryotes Domain Archaea (sister to eukarya) 3 clades defined by genetic characters Domain Bacteria Firmicutes Spirochaetes
More informationSupporting Information
Supporting Information Cao et al. 10.1073/pnas.1306220110 Gram - bacteria Hemolymph Cytoplasm PGRP-LC TAK1 signalosome Imd dfadd Dredd Dnr1 Ikk signalosome P Relish Nucleus AMP and effector genes Fig.
More information23-. Shoot and root development depend on ratio of IAA/CK
Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal
More informationNa+ recirculation in alfalfa and phloem transfer cell structure. N?ziha Boughanmi 1, Philippe Michonneau 2 and Pierrette Fleurat-Lessard 2
Na+ recirculation in alfalfa and phloem transfer cell structure N?ziha Boughanmi 1, Philippe Michonneau 2 and Pierrette Fleurat-Lessard 2 1 D?partement des Sciences de la Vie. Facult? des Sciences de Bizerte.
More informationNOTES: CH 36 - Transport in Plants
NOTES: CH 36 - Transport in Plants Recall that transport across the cell membrane of plant cells occurs by: -diffusion -facilitated diffusion -osmosis (diffusion of water) -active transport (done by transport
More informationtree of life phylogeny gram stain morphology chapter 28-29, other groups of organisms Bacteria
tree of life chapter 28-29, other groups of organisms phylogeny key lineages of prokaryotes Domain Archaea (sister to eukarya) 3 clades defined by genetic characters Domain Bacteria Firmicutes Spirochaetes
More informationExercise 12. Procedure. Aim: To study anatomy of stem and root of monocots and dicots.
Aim: To study anatomy of stem and root of monocots and dicots. Principle: The study of internal morphology, i.e., cells of various tissues in an organ of a living body is called Anatomy. Tissue, which
More information7.06 Problem Set #4, Spring 2005
7.06 Problem Set #4, Spring 2005 1. You re doing a mutant hunt in S. cerevisiae (budding yeast), looking for temperaturesensitive mutants that are defective in the cell cycle. You discover a mutant strain
More informationArabidopsis NPCC6/NaKR1 Is a Phloem Mobile Metal Binding Protein Necessary for Phloem Function and Root Meristem Maintenance C W
This article is a Plant Cell Advance Online Publication. The date of its first appearance online is the official date of publication. The article has been edited and the authors have corrected proofs,
More informationBIOL 221 Concepts of Botany Spring Water Relations, Osmosis and Transpiration
BIOL 221 Concepts of Botany Spring 2008 Topic 07: Water Relations, Osmosis and Transpiration A. Water Relations Water plays a critical role in plants. Water is the universal solvent that allows biochemical
More informationLast time: Obtaining information from a cloned gene
Last time: Obtaining information from a cloned gene Objectives: 1. What is the biochemical role of the gene? 2. Where and when is the gene expressed (transcribed)? 3. Where and when is the protein made?
More information