Genetic dissection of the Arabidopsis thaliana ionome

Size: px
Start display at page:

Download "Genetic dissection of the Arabidopsis thaliana ionome"

Transcription

1 Genetic dissection of the Arabidopsis thaliana ionome Genome Ionome Landscape distribution David E Salt Purdue University, USA

2 What is the Ionome Environment Transcriptome Proteome Ionome The elemental composition of an organism, tissue or cell Metabolome Genome Salt et al Ann Rev Plant Biol 2008

3 High-throughput ionomic analysis of Arabidopsis thaliana Organismal networks Organismal Network Genome Ionome

4 e-laboratory controlling workflow and data acquisition Baxter et al., Plant Physiol 2007

5 e-laboratory Sample analysis and data upload Baxter et al., Plant Physiol 2007

6 e-laboratory Data visualization and download Baxter et al., Plant Physiol 2007

7 Community ionomics HUB to share data 2,746 unique visitors

8 Identification of ionomic mutants Fast neutron population (6000 M2) Lahner et al., Nat Biotech 2003 EMS Population Low Fe (2000 M2) EMS Population Low P (2000 M2)

9 Mapping of low shoot Ca ionomic mutants K = 47% Ca = -46% Fe = -39% Ni = -38% 145:01 K Ca Fe Ni Mutation mapped by DNA microarraybased BSA and deletion-mapping to At2g28670 Enhanced Suberin1 (ESB1 ) Baxter et al., PLoS Genetics 2009 Lahner et al., Nat Biotech 2003

10 ESB1 acts in the root to establish the ionomic phenotype of esb1 Grafting Grafted at 5-days PCA of ionomic phenotype Principal Com mponent Col-0 sg Col-0/esb1-2 esb1-2 sg esb1-2/col-0 Analyzed at 5 -weeks Principal Component 1 Baxter et al., PLoS Genetics (2009)

11 ESB1 expressed in the endodermis and esb1 has elevated aliphatic suberin Total suberin (µg mg -1 dw) * * Total lignin (µg mg -1 dw) Total aliphatic suberin double in esb1 but total lignin not changed ω-hydroxyacids ESB1 endodermal expression Gene expression: AREX: The Arabidopsis Gene Expression Database. Baxter et al., PLoS Genetics (2009) suberin monomers (µg mg -1 ) acids C20 C22 C24 alcohols C18 C20 C22 C16 C18 C18:1 C20 C22 C24 α,ω-diacids C16 C18 C18:1 C20 C22 Ferulic acid All aliphatic suberin components doubled in esb1 Suberin analysis performed by Rochus Benni Franke, University of Bonn

12 esb1 also shows reduced transpiration and increased resistance to wilting Increased resistance to wilting in esb1 Col-0 watered Col-0 8d drought Tra anspiration rate (mmol H 2 O m -2 s -1 ) Lights on Time (min) Reduced transpiration rates in esb1 dir10-1 8d drought dir10-2 8d drought Stomatal pore width (µm) * * Reduced stomatal aperture in esb1 Baxter et al., PLoS Genetics (2009)

13 Root suberin forms an extracellular barrier that affect water relations and mineral nutrition Reduced Ca translocation and water deficit signal Stomatal closure and reduced water loss epidermis cortex endodermis Ca 2+ H 2 O suberin suberin ROOT LEAF Baxter et al., PLoS Genetics (2009)

14 Networks connecting genes, the ionome and the landscape Genome Cellular and Organismal Network Ionome Environmental Network Landscape distribution

15 Natural variation in ionome of A. thaliana Shoot ionome in 84 accession compared to Col % difference from Col-0 84 Arabidops sis accessions Li B Na Mg P K Ca Mn Fe Co Ni Cu Zn As Se Mo Cd Ler-0/2 (red lines) cluster together Cvi-0 (blue lines) cluster together Large ionomic variation available for gene and allele discovery

16 Shoot tissue of Ler-0/2 is low in Mo Ler-0/2 Col-0 and Ler-0 grafts 7 Ler-0 84 % low in Mo Shoot Mo (µg/g dwt) shoot root Col Col Col Ler Ler Col Ler Ler Ler root drives low shoot Mo Baxter et al., PLoS Genetics (2008)

17 Ler-0 QTL for low shoot Mo Ler-0 x Col-4 RIL population Finer mapping using microarray genotyping Likelihood ratio (LA) probability QTL true/false) ( 250 Chromosome I II III IV V Shoot 50 Seed cm Low Mo RILs 81 gene interval Candidate screening QTL for low Mo in both shoot and seed on chromosome II MOT1 is annotated as a sulphate Transporter. No functional data mot1-1 is 95% Low in Mo Baxter et al., PLoS Genetics (2008)

18 Cloning of Ler low Mo QTL Genetic complementation 52 bp deletion in promoter in Ler Ler MOT1 Col-0 MOT1 TAATTTTGATAAGTTTAAGGCAAATTTTTTCTAACACACAATAAAGAAT C TAATTTTGATAAGTTTAAGGCAAATTTTTTCTAACACACAATAAAGAATC Ler MOT1 Col-0 MOT1 AGATACTGTCGCCATCAAGGTTTTGCTTTATT AGATACTGTCGCCATCAAGGTTTTGCTTTATTGTCAACGCTTTGGTTTTT Ler MOT1 Col-0 MOT TCGATACAAACCACA GATACGATATAAAGAGATACGCTTATTGCTCTGTTTCGATACAAACCACA ColxLer Colxmot1-1 Ler MOT1 Col-0 MOT1 AAACAGAAACAATGGAGTCTCAGTCTCAGAGAGGTCAACACGAAACCCCG AAACAGAAACAATGGAGTCTCAGTCTCAGAGAGGTCAACACGAAACCCCG Ler-2 Col-0 mot1-1 Lerxmot1-1 mot1-1 cannot complement low Mo in Ler Low expression of MOT1-1 in roots drives low shoot Mo in Ler Relative Expression (2 - CT ) shoot root mot1-1 Ler-2 Col-0 Baxter et al., PLoS Genetics (2008)

19 MOT1 promoter deletion is associated with reduced Mo across 92 diverse Arabidopsis accessions All accession with lowest Mo have loss-offunction MOT1 alleles including Sha and Kly-2 10 Frequency Shoot Mo (ppm) Baxter et al., PLoS Genetics (2008)

20 What is the function of MOT1? yeast MOT1 625 µm 300 µm MitoTracker vector MOT1 Increases Mo accumulation when expressed in yeast 300 µm Expressed in protodermis, epidermis, cortex and vascular 1.25 mm Merged Mitochondrial localization Baxter et al., PLoS Genetics (2008)

21 What is the function of MOT1? PM First committed step in molybdopterin biosynthesis is in the mitochondria Mo Mo MOT1 Mo Perhaps mitochondria is the site for sensing Mo levels.

22 Association of MOT1 allelic variation with soil and geographic location Does MOT1 determine the landscape distribution of Arabidopsis?

23 Acknowledgments Salt Laboratory Dr Daiyin Chao Dr Ivan Baxter Dr Ana Rus Dr Muthukumar Dr Hyeong Cheol Park Prashant Hosmani Elena Yakubov Marina Tikhonova Brett Lahner (Arabidopsis) Dr John Danku (yeast) Analytical Chemists Dr Mourad Ouzzani (Purdue University Discovery Park Cyber Center) Brad Kennedy, Gemez Marshall, Maged Zereba Dr Justin Borevitz (University of Chicago) Dr Magnus Nordborg (University Southern California) Dr Keyan Zhao Dr Olivier Loudet (INRA, France) Dr Edgar Cahoon (University of Nebraska-Lincoln) Dr Mary Lou Guerinot (Dartmouth College)

Mapping connections between the genome, ionome and the physical landscape. Photo by Bruce Bohm. David E Salt Purdue University, USA

Mapping connections between the genome, ionome and the physical landscape. Photo by Bruce Bohm. David E Salt Purdue University, USA Mapping connections between the genome, ionome and the physical landscape Photo by Bruce Bohm David E Salt Purdue University, USA What is the Ionome Environment Transcriptome Proteome Ionome The elemental

More information

GFP GAL bp 3964 bp

GFP GAL bp 3964 bp Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive

More information

** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.

** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation. Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *

More information

Should we treat the ionome as a combination of individual elements, or should we be deriving novel combined traits?

Should we treat the ionome as a combination of individual elements, or should we be deriving novel combined traits? Journal of Experimental Botany, Vol. 66, No. 8 pp. 2127 2131, 2015 doi:10.1093/jxb/erv040 Advance Access publication 24 February 2015 Opinion Paper Should we treat the ionome as a combination of individual

More information

GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL

GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,

More information

Supplementary Figure 1. Phenotype of the HI strain.

Supplementary Figure 1. Phenotype of the HI strain. Supplementary Figure 1. Phenotype of the HI strain. (A) Phenotype of the HI and wild type plant after flowering (~1month). Wild type plant is tall with well elongated inflorescence. All four HI plants

More information

POTASSIUM IN PLANT GROWTH AND YIELD. by Ismail Cakmak Sabanci University Istanbul, Turkey

POTASSIUM IN PLANT GROWTH AND YIELD. by Ismail Cakmak Sabanci University Istanbul, Turkey POTASSIUM IN PLANT GROWTH AND YIELD by Ismail Cakmak Sabanci University Istanbul, Turkey Low K High K High K Low K Low K High K Low K High K Control K Deficiency Cakmak et al., 1994, J. Experimental Bot.

More information

Identifying the molecular basis of QTLs: eqtls add a new dimension

Identifying the molecular basis of QTLs: eqtls add a new dimension Review Identifying the molecular basis of QTLs: eqtls add a new dimension Bjarne G. Hansen 1, Barbara A. Halkier 1 and Daniel J. Kliebenstein 2 1 Plant Biochemistry Laboratory, Department of Plant Biology

More information

Genetic and physiological approach to elucidation of Cd absorption mechanism by rice plants

Genetic and physiological approach to elucidation of Cd absorption mechanism by rice plants Genetic and physiological approach to elucidation of Cd absorption mechanism by rice plants Satoru Ishikawa National Institute for Agro-Environmental Sciences, 3-1-3, Kannondai, Tsukuba, Ibaraki, 305-8604,

More information

Manual: R package HTSmix

Manual: R package HTSmix Manual: R package HTSmix Olga Vitek and Danni Yu May 2, 2011 1 Overview High-throughput screens (HTS) measure phenotypes of thousands of biological samples under various conditions. The phenotypes are

More information

Transport in Vascular Plants

Transport in Vascular Plants Chapter 36 Transport in Vascular Plants PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero Vascular tissue Transports nutrients throughout a plant; such

More information

Lipid transfer proteins confer resistance to trichothecenes

Lipid transfer proteins confer resistance to trichothecenes Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance

More information

SoyBase, the USDA-ARS Soybean Genetics and Genomics Database

SoyBase, the USDA-ARS Soybean Genetics and Genomics Database SoyBase, the USDA-ARS Soybean Genetics and Genomics Database David Grant Victoria Carollo Blake Steven B. Cannon Kevin Feeley Rex T. Nelson Nathan Weeks SoyBase Site Map and Navigation Video Tutorials:

More information

Impact of genetic variation in stomatal conductance on water use efficiency in Quercus robur. Oliver Brendel. INRA Nancy France

Impact of genetic variation in stomatal conductance on water use efficiency in Quercus robur. Oliver Brendel. INRA Nancy France Impact of genetic variation in stomatal conductance on water use efficiency in Quercus robur Oliver Brendel INRA Nancy France Unit of Forest Ecology and Ecophysiology In collaboration with INRA Pierroton

More information

The Science of Plants in Agriculture Pl.Sci 102. Getting to Know Plants

The Science of Plants in Agriculture Pl.Sci 102. Getting to Know Plants The Science of Plants in Agriculture Pl.Sci 102 Getting to Know Plants Growth and Development of Plants Growth and Development of Plants Why it s important to have knowledge about plant development. What

More information

CHAPTER TRANSPORT

CHAPTER TRANSPORT CHAPTER 2 2.4 TRANSPORT Uptake of CO2 FOCUS: Uptake and transport of water and mineral salts Transport of organic substances Physical forces drive the transport of materials in plants over a range of distances

More information

Evolution of phenotypic traits

Evolution of phenotypic traits Quantitative genetics Evolution of phenotypic traits Very few phenotypic traits are controlled by one locus, as in our previous discussion of genetics and evolution Quantitative genetics considers characters

More information

Introduction to Bioinformatics. Shifra Ben-Dor Irit Orr

Introduction to Bioinformatics. Shifra Ben-Dor Irit Orr Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A

More information

Hormonal root to shoot signalling in JA deficient plants. Carlos de Ollas Ian Dodd

Hormonal root to shoot signalling in JA deficient plants. Carlos de Ollas Ian Dodd Hormonal root to shoot signalling in JA deficient plants Carlos de Ollas Ian Dodd Seventh framework Programme Food, Agriculture and Fisheries, Biotechnology Contract # 289365 Root to shoot signalling of

More information

PLB 111 Fall, 2012 FIRST MIDTERM EXAM

PLB 111 Fall, 2012 FIRST MIDTERM EXAM FIRST MIDTERM EXAM 1. (20) Complete the following table, giving reasonable estimates for the components of water potential (in MPa) at the points of a soil-tree-air-system that I have listed. Assume that

More information

Stomata and water fluxes through plants

Stomata and water fluxes through plants Stomata and water fluxes through plants Bill Davies The Lancaster Environment Centre, UK Summary Stomata and responses to the environment Conductance, a function of frequency and aperture Measuring/estimating

More information

From basic research to crop improvement. Dirk Inze VIB-UGent Center for Plant Systems Biology

From basic research to crop improvement. Dirk Inze VIB-UGent Center for Plant Systems Biology From basic research to crop improvement Dirk Inze VIB-UGent Center for Plant Systems Biology Oct 2017 The Great Challenge By 2050 70% more food on the same land area Growing world population Climate change

More information

Abiotic Stress in Crop Plants

Abiotic Stress in Crop Plants 1 Abiotic Stress in Crop Plants Mirza Hasanuzzaman, PhD Professor Department of Agronomy Sher-e-Bangla Agricultural University E-mail: mhzsauag@yahoo.com Stress Stress is usually defined as an external

More information

The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype.

The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype. Series 2: Cross Diagrams - Complementation There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:

More information

Principles of QTL Mapping. M.Imtiaz

Principles of QTL Mapping. M.Imtiaz Principles of QTL Mapping M.Imtiaz Introduction Definitions of terminology Reasons for QTL mapping Principles of QTL mapping Requirements For QTL Mapping Demonstration with experimental data Merit of QTL

More information

The geneticist s questions

The geneticist s questions The geneticist s questions a) What is consequence of reduced gene function? 1) gene knockout (deletion, RNAi) b) What is the consequence of increased gene function? 2) gene overexpression c) What does

More information

Mole_Oce Lecture # 24: Introduction to genomics

Mole_Oce Lecture # 24: Introduction to genomics Mole_Oce Lecture # 24: Introduction to genomics DEFINITION: Genomics: the study of genomes or he study of genes and their function. Genomics (1980s):The systematic generation of information about genes

More information

A dual sgrna approach for functional genomics in Arabidopsis thaliana

A dual sgrna approach for functional genomics in Arabidopsis thaliana A dual sgrna approach for functional genomics in Arabidopsis thaliana CRISPR AgBio Europe 2017 Laurens Pauwels #CRISPRAgBio @laurenspauwels Outline - Workflow for CRISPR/Cas9 in Arabidopsis thaliana -

More information

Hormonal and other chemical effects on plant growth and functioning. Bill Davies Lancaster Environment Centre, UK

Hormonal and other chemical effects on plant growth and functioning. Bill Davies Lancaster Environment Centre, UK Hormonal and other chemical effects on plant growth and functioning Bill Davies Lancaster Environment Centre, UK Integrating the impacts of soil drought and atmospheric stress High radiant load Reduced

More information

Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.

Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny

More information

Mixture models for analysing transcriptome and ChIP-chip data

Mixture models for analysing transcriptome and ChIP-chip data Mixture models for analysing transcriptome and ChIP-chip data Marie-Laure Martin-Magniette French National Institute for agricultural research (INRA) Unit of Applied Mathematics and Informatics at AgroParisTech,

More information

Model plants and their Role in genetic manipulation. Mitesh Shrestha

Model plants and their Role in genetic manipulation. Mitesh Shrestha Model plants and their Role in genetic manipulation Mitesh Shrestha Definition of Model Organism Specific species or organism Extensively studied in research laboratories Advance our understanding of Cellular

More information

Identification of quantitative trait loci that regulate Arabidopsis root system size

Identification of quantitative trait loci that regulate Arabidopsis root system size Genetics: Published Articles Ahead of Print, published on September 12, 2005 as 10.1534/genetics.105.047555 Identification of quantitative trait loci that regulate Arabidopsis root system size and plasticity

More information

Evolutionary Ecology of Senecio

Evolutionary Ecology of Senecio Evolutionary Ecology of Senecio Evolutionary ecology The primary focus of evolutionary ecology is to identify and understand the evolution of key traits, by which plants are adapted to their environment,

More information

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions. Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods

More information

Predicting Protein Functions and Domain Interactions from Protein Interactions

Predicting Protein Functions and Domain Interactions from Protein Interactions Predicting Protein Functions and Domain Interactions from Protein Interactions Fengzhu Sun, PhD Center for Computational and Experimental Genomics University of Southern California Outline High-throughput

More information

Introduction to Bioinformatics

Introduction to Bioinformatics CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics

More information

Climate Change and Plant Reproduction

Climate Change and Plant Reproduction Quantitative Trait Loci Mapping of Reproductive Traits Involved in Heat Stress Responses in Arabidopsis : Implications for Global Climate Change and Plant Reproduction Lazar Pavlovic, Greta Chiu, Jeffrey

More information

DEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA

DEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA DEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA CHASE BALLARD LINDA EAN HECTOR LOPEZ DR. JOANNA WERNER-FRACZEK IN COLLABORATION WITH DR. PATRICIA SPRINGER S LAB AT UCR AND ROBERT KOBLE PURPOSE OF RESEARCH

More information

NOTES: CH 36 - Transport in Plants

NOTES: CH 36 - Transport in Plants NOTES: CH 36 - Transport in Plants Recall that transport across the cell membrane of plant cells occurs by: -diffusion -facilitated diffusion -osmosis (diffusion of water) -active transport (done by transport

More information

Plant mitochondrial dynamics

Plant mitochondrial dynamics Plant mitochondrial dynamics Peroxisome Chloroplast Nucleus Mitochondria from Alberts et al. 1994 Living Arabidopsis leaf 10 µm Logan & Leaver (2000) Journal of Experimental Botany, 51: 865-871 5 µm S.

More information

Wheat Genetics and Molecular Genetics: Past and Future. Graham Moore

Wheat Genetics and Molecular Genetics: Past and Future. Graham Moore Wheat Genetics and Molecular Genetics: Past and Future Graham Moore 1960s onwards Wheat traits genetically dissected Chromosome pairing and exchange (Ph1) Height (Rht) Vernalisation (Vrn1) Photoperiodism

More information

GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H*" ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION

GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H* ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION FIFTH EDITION IV I ^HHk ^ttm IZTI/^Q i I II MPHBBMWBBIHB '-llwmpbi^hbwm^^pfc ' GSBHSRSBRSRRk LlML I I \l 1MB ^HP'^^MMMP" jflp^^^^^^^^st I Iv^O FROM GENES TO GENOMES %^MiM^PM^^MWi99Mi$9i0^^ ^^^^^^^^^^^^^V^^^fii^^t^i^^^^^

More information

Supplemental Data. Perrella et al. (2013). Plant Cell /tpc

Supplemental Data. Perrella et al. (2013). Plant Cell /tpc Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization

More information

Chapter 36: Transport in Vascular Plants - Pathways for Survival

Chapter 36: Transport in Vascular Plants - Pathways for Survival Chapter 36: Transport in Vascular Plants - Pathways for Survival For vascular plants, the evolutionary journey onto land involved differentiation into roots and shoots Vascular tissue transports nutrients

More information

Arabidopsis PPR40 connects abiotic stress responses to mitochondrial electron transport

Arabidopsis PPR40 connects abiotic stress responses to mitochondrial electron transport Ph.D. thesis Arabidopsis PPR40 connects abiotic stress responses to mitochondrial electron transport Zsigmond Laura Supervisor: Dr. Szabados László Arabidopsis Molecular Genetic Group Institute of Plant

More information

Proteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering

Proteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering Proteomics 2 nd semester, 2013 1 Text book Principles of Proteomics by R. M. Twyman, BIOS Scientific Publications Other Reference books 1) Proteomics by C. David O Connor and B. David Hames, Scion Publishing

More information

USDA-DOE Plant Feedstock Genomics for Bioenergy

USDA-DOE Plant Feedstock Genomics for Bioenergy USDA-DOE Plant Feedstock Genomics for Bioenergy BERAC Thursday, June 7, 2012 Cathy Ronning, DOE-BER Ed Kaleikau, USDA-NIFA Plant Feedstock Genomics for Bioenergy Joint competitive grants program initiated

More information

Mitosis. Mutations, Chimeras, and Variegation. Cells divide to form 2 identical daughter cells Mitosis division of the nucleus

Mitosis. Mutations, Chimeras, and Variegation. Cells divide to form 2 identical daughter cells Mitosis division of the nucleus Mutations, Chimeras, and Variegation Mitosis Cells divide to form 2 identical daughter cells Mitosis division of the nucleus www.dartmouth.edu/ ~cbbc/courses/ bio4/bio4-lectures/ thecell.html 1 Mutations

More information

DNA or RNA metabolism (1%) Signal transduction (2%) Development (2%) Other cellular processes (17%)

DNA or RNA metabolism (1%) Signal transduction (2%) Development (2%) Other cellular processes (17%) Fig. 35-24 Other metabolism (18%) DNA or RNA metabolism (1%) Signal transduction (2%) Development (2%) Unknown (24%) Energy pathways (3%) Cell division and organization (3%) Transport (4%) Transcription

More information

Homework for Monday: Correct potometer questions Complete transport in plants worksheet

Homework for Monday: Correct potometer questions Complete transport in plants worksheet Transport in plants Homework for Monday: Correct potometer questions Complete transport in plants worksheet Transpiration the loss of water from a plant through evaporation Did you know? A 15m maple tree

More information

Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach

Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach ABSTRACT SUBMITTED TO JAMIA MILLIA ISLAMIA NEW DELHI IN PARTIAL FULFILMENT OF

More information

Araport, a community portal for Arabidopsis. Data integration, sharing and reuse. sergio contrino University of Cambridge

Araport, a community portal for Arabidopsis. Data integration, sharing and reuse. sergio contrino University of Cambridge Araport, a community portal for Arabidopsis. Data integration, sharing and reuse sergio contrino University of Cambridge Acknowledgements J Craig Venter Institute Chris Town Agnes Chan Vivek Krishnakumar

More information

BCH 400/600 Introductory Biochemistry

BCH 400/600 Introductory Biochemistry BCH 400/600 Introductory Biochemistry Instructor: David Shintani Office: 311C Fleischmann Ag. Lab: 308 Fleischmann Ag. E-mail: shintani@unr.edu Phone: (775) 784-4631 Before BCH 400 BCH 400 is heavy on

More information

Proteomics Systems Biology

Proteomics Systems Biology Dr. Sanjeeva Srivastava IIT Bombay Proteomics Systems Biology IIT Bombay 2 1 DNA Genomics RNA Transcriptomics Global Cellular Protein Proteomics Global Cellular Metabolite Metabolomics Global Cellular

More information

Somaclonal Variation

Somaclonal Variation Tissue-culture cycle involves: dedifferentiation in culture proliferation of cells (implies sev. cell generations removed from original differentiated cell) subsequent regeneration to plants no selection

More information

Miller & Levine Biology

Miller & Levine Biology A Correlation of To the Science Biology A Correlation of, 2014 to the, Table of Contents From Molecules to Organisms: Structures and Processes... 3 Ecosystems: Interactions, Energy, and Dynamics... 4 Heredity:

More information

Ch. 36 Transport in Vascular Plants

Ch. 36 Transport in Vascular Plants Ch. 36 Transport in Vascular Plants Feb 4 1:32 PM 1 Essential Question: How does a tall tree get the water from its roots to the top of the tree? Feb 4 1:38 PM 2 Shoot architecture and Light Capture: Phyllotaxy

More information

PREFACE O-LEVEL TOPICAL SCIENCE (BIOLOGY)

PREFACE O-LEVEL TOPICAL SCIENCE (BIOLOGY) PREFACE O-LEVEL TOPICAL SCIENCE (BIOLOGY) provides a thorough revision for students taking the GCE O-Level Science (Biology) Examination. Past examination questions have been carefully classified into

More information

The geneticist s questions. Deleting yeast genes. Functional genomics. From Wikipedia, the free encyclopedia

The geneticist s questions. Deleting yeast genes. Functional genomics. From Wikipedia, the free encyclopedia From Wikipedia, the free encyclopedia Functional genomics..is a field of molecular biology that attempts to make use of the vast wealth of data produced by genomic projects (such as genome sequencing projects)

More information

Introduction to Plant Transport

Introduction to Plant Transport Introduction to Plant Transport The algal ancestors of plants were completely immersed in water and dissolved minerals. The adaptation to land involved the differentiation of the plant body into roots,

More information

Biology 1030 Winter 2009

Biology 1030 Winter 2009 Meeting Tissue Needs II Chapter 36 (738-755) Chapter 37 (756-770) Cellular Currency Plants harvest solar energy Photosynthesis Produces sugars Proteins, nucleic acids, lipids? H 2 O CO 2 Plants cells still

More information

itraq and RNA-Seq analyses provide new insights of Dendrobium officinale seeds (Orchidaceae)

itraq and RNA-Seq analyses provide new insights of Dendrobium officinale seeds (Orchidaceae) Page S-1 Supporting Information (SI) itraq and RNA-Seq analyses provide new insights into regulation mechanism of symbiotic germination of Dendrobium officinale seeds (Orchidaceae) Juan Chen 1, Si Si Liu

More information

Common Effects of Abiotic Stress Factors on Plants

Common Effects of Abiotic Stress Factors on Plants Common Effects of Abiotic Stress Factors on Plants Plants are living organisms which lack ability of locomotion. Animals can move easily from one location to other. Immovable property of plants makes it

More information

The combined use of Arabidopsis thaliana and Lepidium sativum to find conserved mechanisms of seed germination within the Brassicaceae family

The combined use of Arabidopsis thaliana and Lepidium sativum to find conserved mechanisms of seed germination within the Brassicaceae family www.seedbiology.de The combined use of Arabidopsis thaliana and Lepidium sativum to find conserved mechanisms of seed germination within the Brassicaceae family Linkies, A., Müller, K., Morris, K., Gräber,

More information

Genome-wide Association Mapping Identifies a New Arsenate Reductase Enzyme Critical for Limiting Arsenic Accumulation in Plants

Genome-wide Association Mapping Identifies a New Arsenate Reductase Enzyme Critical for Limiting Arsenic Accumulation in Plants Genome-wide Association Mapping Identifies a New Arsenate Reductase Enzyme Critical for Limiting Arsenic Accumulation in Plants Dai-Yin Chao 1,2 *,YiChen 3, Jiugeng Chen 1, Shulin Shi 4, Ziru Chen 1,5,

More information

THE ROLE OF BBSRC IN BIODIVERSITY RESEARCH

THE ROLE OF BBSRC IN BIODIVERSITY RESEARCH THE ROLE OF BBSRC IN BIODIVERSITY RESEARCH INTRODUCTION The aim of this document is to explain the role of biodiversity research in the delivery of the BBSRC mission, and thereby to provide guidance to

More information

Organs and leaf structure

Organs and leaf structure Organs and leaf structure Different types of tissues are arranged together to form organs. Structure: 2 parts (Petiole and Leaf Blade) Thin flat blade, large surface area Leaves contain all 3 types of

More information

Mixtures and Hidden Markov Models for analyzing genomic data

Mixtures and Hidden Markov Models for analyzing genomic data Mixtures and Hidden Markov Models for analyzing genomic data Marie-Laure Martin-Magniette UMR AgroParisTech/INRA Mathématique et Informatique Appliquées, Paris UMR INRA/UEVE ERL CNRS Unité de Recherche

More information

Arabidopsis NPCC6/NaKR1 Is a Phloem Mobile Metal Binding Protein Necessary for Phloem Function and Root Meristem Maintenance C W

Arabidopsis NPCC6/NaKR1 Is a Phloem Mobile Metal Binding Protein Necessary for Phloem Function and Root Meristem Maintenance C W This article is a Plant Cell Advance Online Publication. The date of its first appearance online is the official date of publication. The article has been edited and the authors have corrected proofs,

More information

NATURALLY OCCURRING GENETIC VARIATION IN ARABIDOPSIS THALIANA

NATURALLY OCCURRING GENETIC VARIATION IN ARABIDOPSIS THALIANA Annu. Rev. Plant Biol. 2004. 55:141 72 doi: 10.1146/annurev.arplant.55.031903.141605 Copyright c 2004 by Annual Reviews. All rights reserved First published online as a Review in Advance on December 12,

More information

Maternal control of seed development mediated by the flavonoid biosynthesis pathway

Maternal control of seed development mediated by the flavonoid biosynthesis pathway P- END1 Maternal control of seed development mediated by the flavonoid biosynthesis pathway Maha Aljabri, James Doughty, and Rod Scott University of Bath, UK Many plants exhibit post-zygotic barriers to

More information

Cadmium uptake and partitioning in durum wheat during grain filling

Cadmium uptake and partitioning in durum wheat during grain filling Harris and Taylor BMC Plant Biology, : http://www.biomedcentral.com/7-9// RESEARCH ARTICLE Open Access Cadmium uptake and partitioning in durum wheat during grain filling Neil S Harris * and Gregory J

More information

Plant Structure And Function Workbook Answers Key File Type

Plant Structure And Function Workbook Answers Key File Type Plant Structure And Function Workbook Answers Key File Type We have made it easy for you to find a PDF Ebooks without any digging. And by having access to our ebooks online or by storing it on your computer,

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/331/6019/876/dc1 Supporting Online Material for Synthetic Clonal Reproduction Through Seeds Mohan P. A. Marimuthu, Sylvie Jolivet, Maruthachalam Ravi, Lucie Pereira,

More information

Resource Acquisition and Transport in Vascular Plants

Resource Acquisition and Transport in Vascular Plants Chapter 36 Resource Acquisition and Transport in Vascular Plants PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley

More information

Chapter 29: Plant Tissues

Chapter 29: Plant Tissues Chapter 29: Plant Tissues Shoots and Roots Shoots (Leaves and Stem) Produce food by photosynthesis Carry out reproductive functions Roots Anchor the plant Penetrate the soil and absorb water and dissolved

More information

Supplemental material

Supplemental material Supplemental material Table 1- Segregation analysis of sgt1a sgt1b double mutant plants Parental genotype No. of lines Normal seeds Phenotype Abnormal seeds Ratio of abnormal seeds (%) WT 3 171 2 1.16

More information

Expression QTLs and Mapping of Complex Trait Loci. Paul Schliekelman Statistics Department University of Georgia

Expression QTLs and Mapping of Complex Trait Loci. Paul Schliekelman Statistics Department University of Georgia Expression QTLs and Mapping of Complex Trait Loci Paul Schliekelman Statistics Department University of Georgia Definitions: Genes, Loci and Alleles A gene codes for a protein. Proteins due everything.

More information

Water use efficiency in agriculture

Water use efficiency in agriculture Water use efficiency in agriculture Bill Davies The Lancaster Environment Centre, UK Summary Introduction and definitions Impacts of stomata, environment and leaf metabolism on WUE Estimating WUE and modifications

More information

Quantitative Genetics & Evolutionary Genetics

Quantitative Genetics & Evolutionary Genetics Quantitative Genetics & Evolutionary Genetics (CHAPTER 24 & 26- Brooker Text) May 14, 2007 BIO 184 Dr. Tom Peavy Quantitative genetics (the study of traits that can be described numerically) is important

More information

Plant transformation

Plant transformation Plant transformation Objectives: 1. What is plant transformation? 2. What is Agrobacterium? How and why does it transform plant cells? 3. How is Agrobacterium used as a tool in molecular genetics? References:

More information

OCR (A) Biology A-level

OCR (A) Biology A-level OCR (A) Biology A-level Topic 3.3: Transport in plants Notes Plants require a transport system to ensure that all the cells of a plant receive a sufficient amount of nutrients. This is achieved through

More information

Resource Acquisition and Transport in Vascular Plants

Resource Acquisition and Transport in Vascular Plants Chapter 36 Resource Acquisition and Transport in Vascular Plants PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley

More information

A DNA Sequence 2017/12/6 1

A DNA Sequence 2017/12/6 1 A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta

More information

2014 Pearson Education, Inc. 1

2014 Pearson Education, Inc. 1 1 CO 2 O 2 Light Sugar O 2 and minerals CO 2 2 Buds 42 29 21 34 13 26 5 18 10 31 23 8 15 28 16 2 24 Shoot apical meristem 7 3 20 1 mm 32 11 19 12 6 4 1 25 17 14 9 40 27 22 3 Cell wall Apoplastic route

More information

COLLEGE OF THE NORTH ATLANTIC BIOLOGY Practice Final Exam

COLLEGE OF THE NORTH ATLANTIC BIOLOGY Practice Final Exam COLLEGE OF THE NORTH ATLANTIC BIOLOGY 1170 Practice Final Exam Students please take note: This exam has been produced and distributed solely as a practice exam. The questions are similar to questions that

More information

Cell biology traditionally identifies proteins based on their individual actions as catalysts, signaling

Cell biology traditionally identifies proteins based on their individual actions as catalysts, signaling Lethality and centrality in protein networks Cell biology traditionally identifies proteins based on their individual actions as catalysts, signaling molecules, or building blocks of cells and microorganisms.

More information

Question 1: What are the factors affecting the rate of diffusion? Diffusion is the passive movement of substances from a region of higher concentration to a region of lower concentration. Diffusion of

More information

Cytokinin. Fig Cytokinin needed for growth of shoot apical meristem. F Cytokinin stimulates chloroplast development in the dark

Cytokinin. Fig Cytokinin needed for growth of shoot apical meristem. F Cytokinin stimulates chloroplast development in the dark Cytokinin Abundant in young, dividing cells Shoot apical meristem Root apical meristem Synthesized in root tip, developing embryos, young leaves, fruits Transported passively via xylem into shoots from

More information

2014 Pearson Education, Inc. 1. Light. Sugar O 2 H 2 O. and minerals CO Pearson Education, Inc.

2014 Pearson Education, Inc. 1. Light. Sugar O 2 H 2 O. and minerals CO Pearson Education, Inc. 1 CO 2 O 2 Light ugar O 2 and minerals CO 2 2 Buds 34 42 29 26 31 18 21 13 5 10 23 8 15 28 16 24 hoot apical meristem 2 7 3 20 32 11 19 12 6 4 1 25 17 14 9 40 27 22 1 mm 3 Cell wall Apoplastic route Cytosol

More information

Genotyping By Sequencing (GBS) Method Overview

Genotyping By Sequencing (GBS) Method Overview enotyping By Sequencing (BS) Method Overview Sharon E Mitchell Institute for enomic Diversity Cornell University http://wwwmaizegeneticsnet/ Topics Presented Background/oals BS lab protocol Illumina sequencing

More information

Formative/Summative Assessments (Tests, Quizzes, reflective writing, Journals, Presentations)

Formative/Summative Assessments (Tests, Quizzes, reflective writing, Journals, Presentations) Biology Curriculum Map 2017-18 2 Weeks- Introduction to Biology: Scientific method, lab safety, organizing and analyzing data, and psuedoscience. This unit establishes the fundamental nature of scientific

More information

Utilizing Illumina high-throughput sequencing technology to gain insights into small RNA biogenesis and function

Utilizing Illumina high-throughput sequencing technology to gain insights into small RNA biogenesis and function Utilizing Illumina high-throughput sequencing technology to gain insights into small RNA biogenesis and function Brian D. Gregory Department of Biology Penn Genome Frontiers Institute University of Pennsylvania

More information

SBI lab Jou-hyun Jeon Jae-seong Yang Solip Park Yonghwan Choi Yoonsup Choi Jinho Kim HyunJun Nam JiHye Hwang Inhae Kim Youngeun Shin Sung gyu Han

SBI lab Jou-hyun Jeon Jae-seong Yang Solip Park Yonghwan Choi Yoonsup Choi Jinho Kim HyunJun Nam JiHye Hwang Inhae Kim Youngeun Shin Sung gyu Han POSTECH 생명과학과김상욱 Structural Bioinformatics Laboratory Pohang University of Science and Technology Acknowledgement SBI lab Jou-hyun Jeon Jae-seong Yang Solip Park Yonghwan Choi Yoonsup Choi Jinho Kim HyunJun

More information

Stems and Transport in Vascular Plants. Herbaceous Stems. Herbaceous Dicot Stem 3/12/2012. Chapter 34. Basic Tissues in Herbaceous Stems.

Stems and Transport in Vascular Plants. Herbaceous Stems. Herbaceous Dicot Stem 3/12/2012. Chapter 34. Basic Tissues in Herbaceous Stems. Bud scale Terminal bud Stems and Transport in Plants One year's growth Terminal bud scale scars Axillary bud Leaf scar Node Internode Node Chapter 34 Lenticels Terminal bud scale scars Bundle scars A Woody

More information

Bio Factsheet. Transport in Plants. Number 342

Bio Factsheet. Transport in Plants.   Number 342 Number 342 Transport in Plants This Factsheet: Explains why plants need a transport system Describes what plants transport Describes the tissues which carry out transport Outlines the position of the xylem

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplemental Methods Isolation and mapping of SPCH An EMS-mutagenized population of tmm-1 (Col);E1728 (an enhancer trap GFP marking guard cells) was created. M2 seeds were collected from M1 s planted in

More information

Bio 102 Chapter 32 Transport in Plants

Bio 102 Chapter 32 Transport in Plants Bio 102 Chapter 32 Transport in Plants 2006-2007 Passive Water & Mineral Absorption Water absorption from soil OSMOSIS = transport of WATER across cell membrane WATER POTENTIAL determines direction of

More information

Effect of light and the cer10 mutation on the growth rate of Arabidopsis thaliana

Effect of light and the cer10 mutation on the growth rate of Arabidopsis thaliana Effect of light and the cer10 mutation on the growth rate of Arabidopsis thaliana Jenna K. Bains, Selam Joseph, Shayan Shokoohi, Ian A. Villamin Abstract The presence of light and the presence of a mutation

More information