The geneticist s questions. Deleting yeast genes. Functional genomics. From Wikipedia, the free encyclopedia

Transcription

1 From Wikipedia, the free encyclopedia Functional genomics..is a field of molecular biology that attempts to make use of the vast wealth of data produced by genomic projects (such as genome sequencing projects) to describe gene (and protein) functions and interactions. Unlike genomics, functional genomics focuses on the dynamic aspects such as gene transcription, translation, and protein protein interactions, as opposed to the static aspects of the genomic information such as DNA sequence or structures. Functional genomics attempts to answer questions about the function of DNA at the levels of genes, RNA transcripts, and protein products. A key characteristic of functional genomics studies is their genome-wide approach to these questions, generally involving high-throughput methods rather than a more traditional gene-by-gene approach. Functional genomics..is like Chinese food: it looks great and tastes great, but you re hungry 30 minutes after eating it.. The geneticist s questions a) What is consequence of reduced gene function? 1) gene knockout (deletion, RNAi) b) What is the consequence of increased gene function? 2) gene overexpression c) What does the gene (protein) interact with? 3) genetic interactions enhancers ( synthetic lethal ) suppressors 4) protein interaction 2-hybrid pull-down d) When and where is the gene (protein) expressed? 5) measure gene expression microarrays RNA-Seq Deleting yeast genes kan R YFG kan R 1

2 Deletion cassette can be made in a PCR kan R PCR 40 bp 40 bp kan R YFG kan R Surveying the S.cerevisiae genome for genes required for methylation of lysine 4 of histone H3. Dover J et al. J. Biol. Chem. 2002;277: Each deletion strain tagged with two unique 20mers kanmx4 Tag 1 PCR Tag 2 kanmx4 ATCGGATTCATAACTGATAG GCTTACTGAAACTGAAACTC 2002 by American Society for Biochemistry and Molecular Biology Ron Davis et al., Stanford University 2

3 Bar-coding gene deletions ATCGGATTCATAACTGATAG Bar-coded gene deletions GCTTACTGAAACTGAAACTC kanmx4 Hybridize labeled tags to oligonucleotide array containing tag complements YFG TAG KAN R TAG TAG TAG TAG TAG kanmx4 Each tag has unique location Ron Davis et al., Stanford University One tag One Deletion Strain GATTCGATAGCCGGCAAGG 1 CGATTTAGGAATGTCATAG 2... AGCTCATACCTAGTAACTA AGCTCATACCTAGTAACTA Ron Davis et al., Stanford University Parallel analysis of deletion strains Apply Selection Determine who is missing. Determine who is here. 6,200 Ron Davis et al., Stanford 3

4 Before selection Parallel Analysis of Gene Function Strains are present in equal abundance in the population and produce signals of equal intensity on the chip Growth of deletion strains exhibiting reduced fitness in galactose media. gal2 After multiple population doublings under selection Strains with a growth defect are underrepresented in the population and produce a lower intensity signal Ron Davis et al., Stanford University G3 4: (2014) Genetics 187: (2011) Genome Biol. 11: R60 (2010) Genome Res. 19: (2009 gal1 gal4 gal3 Guri Giaever et al. (2002) Nature 418, 387 Growth of deletion strains exhibiting reduced fitness in galactose media. ykl037 Verified putative protein of unknown function YKL037w UDP-glucose pyrophosphorylase Guri Giaever et al. (2002) Nature 418, 387 4

5 Growth of deletion strains exhibiting reduced fitness in galactose media. yml090 Dubious open reading frame; unlikely to encode a functional protein Guri Giaever et al. (2002) Nature 418, 387 Growth of deletion strains exhibiting reduced fitness in galactose media. APJ1 1/YNL077W Chaperone with a role in SUMO-mediated protein degradation; member of the DnaJlike family; OE interferes with propagation of the prion; protein is detected in highly purified mitochondria in high-throughput studies; forms nuclear foci upon DNA replication stress Growth of deletion strains exhibiting reduced fitness in galactose media. gef1 Voltage-gated chloride channel; involved in cation homeostasis fet3 Ferro-O2-oxidoreductase; oxidizes Fe2+ to Fe3+ for uptake by Ftr1p ftr1 iron permease Giaever et al. (2002) Nature 418, 387 Giaever et al. (2002) Nature 418, 387 5

6 Results Conventional analysis ~25% have growth defect 17.6% dead (~1100 essential genes) Fitness profiling of yeast deletion strains in rich media. Deutschbauer A M et al. Genetics 2005;169: haploinsufficient genes 53% essential ~ 8% slow growth Parallel analysis ~40% have growth defect (<98% of wt growth rate) Many new genes implicated in key biological processes 881 slow-growing homozygotes > ~1/3 of genes required for growth on rich media Gene regulation poorly predicts mutant phenotype Haploinsufficient genes are enriched for metabolic functions. Haploinsufficient genes are enriched for metabolic functions. metabolism Deutschbauer A M et al. Genetics 2005;169: Genetics Society of America Genetics Society of America Deutschbauer A M et al. Genetics 2005;169:

7 Haploinsufficient genes are highly expressed. CRISPR-Cas9 nuclease Clustered Regularly Interspaced Short Palindromic Repeats Deutschbauer A M et al. Genetics 2005;169: Genetics Society of America Copyright 2013 by the Genetics Society of America Frøkjær-Jensen C Genetics 2013;195: T Wang et al. Science 2014;343:80-84 MMR - is 6-TG sensitive sgrna Resistance to topoisomerase inhibitor Published by AAAS Published by AAAS T Wang et al. Science 2014;343:

8 Published by AAAS T Wang et al. Science 2014;343:80-84 The geneticist s questions a) What is consequence of reduced gene function? 1) gene knockout (deletion, RNAi) b) What is the consequence of increased gene function? 2) gene overexpression c) What does the gene (protein) interact with? 3) genetic interactions enhancers ( synthetic lethal ) suppressors 4) protein interaction 2-hybrid pull-down d) When and where is the gene (protein) expressed? 5) measure gene expression microarrays RNA-Seq Sopko et al., (2006) Molecular Cell 21, Mapping Pathways and Phenotypes by Systematic Gene Overexpression Sopko et al., (2006) Molecular Cell 21,

9 Sopko et al., (2006) Molecular Cell 21, Mapping Pathways and Phenotypes by Systematic Gene Overexpression The geneticist s questions 1) What is consequence of reduced gene function? a) gene knockout (deletion, RNAi) 2) What is the consequence of increased gene function? a) gene overexpression 3) What does the gene (protein) interact with? a) genetic interactions enhancers ( synthetic lethal ) suppressors b) protein interaction 2-hybrid pull-down 4) When and where is the gene (protein) expressed? a) measure gene expression microarrays RNA-Seq Parallel pathways revealed in double mutants X X X X Mutations in 1, 2, 3 are synthetic lethal with mutations in 4,5 9

10 bni1::nat R yxx::kan R S S R S S R R R Boone, Bussey, Andrews (2007) Nature Reviews Genetics 8, 437 Exploring genetic interactions and networks with yeast 10

11 Parallel pathways revealed in double mutants Mutations in 1, 2, 3 are synthetic lethal with mutations in 4,5 The number of genetic interactions averaged 34 in each screen for nonessential genes, with screens that were focused on essential genes exhibiting fivefold more interactions. dense local neighbourhoods: the immediate neighbours of a gene its genetic-interaction partners also tend to interact with one another ~20% of the immediate neighbours of each of three test genes interacted with one another, vs. ~1% for any two genes chosen at random Published by AAAS A H Y Tong et al. Science 2004;303: Fig. 4. (A) The degree distribution of SGA array genes not also used as query genes. The fit to a straight line in the log-log plot indicates a power-law degree distribution, a characteristic of a scale-free network. # of interaction partners Short path between any two nodes Genetic interactions tend to occur among functionally related genes small-world connectivity distribution follows a power-law distribution: many genes with few interactions and a few genes with many interactions Published by AAAS A H Y Tong et al. Science 2004;303: A few hubs many spokes 11

12 Fig. 1 A correlation-based network connecting genes with similar genetic interaction profiles. M Costanzo et al. Science 2010;327: Published by AAAS 12