itraq and RNA-Seq analyses provide new insights of Dendrobium officinale seeds (Orchidaceae)
|
|
- Austin Poole
- 5 years ago
- Views:
Transcription
1 Page S-1 Supporting Information (SI) itraq and RNA-Seq analyses provide new insights into regulation mechanism of symbiotic germination of Dendrobium officinale seeds (Orchidaceae) Juan Chen 1, Si Si Liu 1, Annegret Kohler 2, Bo Yan 1, Hong Mei Luo 1, Xiao Mei Chen 1, Shun Xing Guo 1 * 1 Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing , P. R. China 2 UMR 1136 INRA/Université de Lorraine, Interactions Arbres/Micro-organismes, INRA, Institut National de la Recherche Agronomique, Centre INRA de Nancy, Champenoux, France. Figure S-1. Examples of tandem mass spectra of itraq for the differentially expressed proteins (DEPs) with low number of peptide. Five DEPs during seed germination of D. officinale were selected from Table S9 and Table S10 in Supporting Information (marked **), including Dendrobium_GLEAN_ , Dendrobium_GLEAN_ , Dendrobium_GLEAN_ , Dendrobium_GLEAN_ and Dendrobium_GLEAN_ Left column is the tandem mass spectra of the proteins and S1
2 right column is the region containing the reporter ions of spectra (m/z: ) associated with the spectrum of proteins. Figure S-2. RNA-Seq and itraq 8-plex workflow of asymbiotic and symbiotic germination of D. officinale seeds. Stage2: early germination; Stage3: protocorm stage; Stage4: seedling stage; A1, A2, A3 represent developmental stage 2, stage3, stage4 in asymbiotic germination and S1, S2, S3 represent stage2, stage 3, and stage 4 in symbiotic germination, C0 represent ungermination seed. Figure S-3. Comparative analysis of seed germination at all stages over 12 weeks time of D. officinale. A. Seed development in symbiotic condition. B. Seed development in asymbiotic conditions. C. A quantitive proportion of seeds at all stage compared total germination seed in 12 th week. AG: asymbiotic germination; SG: symbiotic germination. Figure S-4. Comparison of expression ratios from transcriptomic (y-axis) and protomic (x-axis) profiling based on differentially expressed proteins and correlated genes at each compared group. Log2 expression ratios were calculated in adjacent development stage during asymbiotic (left columns) and symbiotic germination (middle columns) and at the same stage between symbiotic and asymbiotic germination (right columns). Red point represents both proteins and genes are differentially expressed. AG: asymbiotic germination; SG: symbiotic germination. Figure S-5. Summary of correlation coefficient of quantitative correlation results (6 types) in each compared group. 6 types: correlation result of all quantitative protein and the mrna (blue); the differentially expressed proteins and genes with the same trend (green); the differentially expressed proteins and genes with the opposite trend (yellow); both proteins and S2
3 RNA no change (orange); proteins no change but genes differentially expressed (red); proteins differentially expressed but genes no change (pale red). A1, A2, A3 represent developmental stage 2, stage 3, stage 4 in asymbiotic germination and S1, S2, S3 represent stage 2, stage 3, and stage 4 in symbiotic germination, C0 represent ungerminated seed. Table S-1. Labeling samples information of Dendrobium officinale seeds in our itraq experiments. Table S-2. Mascot search parameters used in protein identification by itraq analysis of D. officinale seeds. Table S-3. Quantification parameters used in our relative quantification of protein by itraq analysis of D. officinale seeds. Table S-4. Detailed information of 2256 plant proteins identified by itraq during seed germination of D. officinale. Table S differentially expressed proteins (DEPs) in at least one more germination stage during asymbiotic and symbiotic germination of D. officinale. A protein was considered to be DEP if it met fold change 1.2 or 0.83 and Q value < A1, A2, A3 represent developmental stage 2, stage3, stage4 in asymbiotic germination and S1, S2, S3 represent stage2, stage 3, and stage 4 in symbiotic germination, C0 represents ungerminated seed. AG: asymbiotic germination; SG: symbiotic germination. Red color: A protein was up-regulated expression in the given compared group; green color, a protein was down-regulated and gray color: protein no significant expression change at the given compared group. Table S differentially expressed proteins (DEPs) in at one more development stage during symbiotic germination compared to asymbiotic germination of D. officinale. A protein was considered to be DEP if it met fold change 1.2 or 0.83 and Q value < Red S3
4 color means up-regulated proteins, green color means down-regulated protein and gray color means no significant change in the given compared group, respectively. Table S-7. Key parameters used for correlation analysis between transcriptome and proteome of seed germination of D. officinale. Table S-8. Correlation analysis of the transcriptome and proteome reveals the number relationship of proteins and genes on identification, quantitative and differentially expressed aspects. Table S co-up-regulated proteins at transcriptomic and proteomic level across at least one more adjunct developmental stage during asymbiotic or symbiotic germination of D. officinale. A protein was identified as co-up-regulated protein if it met: i) fold change 1.2 (itraq) and 2.0 (RNA-Seq); ii) Q value < 0.05(iTRAQ) and FDR < 0.001(RNA-Seq). Yellow color: co-up-regulated proteins; red color: up-regulated proteins only in itraq; orange color: up-regulated genes only in RNA-Seq; gray color: proteins and genes without significant expression change. ** The tandem mass spectra were showed in Figure S1 in Supporting Information. Table S Co-up-regulated proteins at transcriptomic and proteomic level during symbiotic germination compared to asymbiotic germination of D. officinale. A protein was identified as co-up-regulated protein if it met: i) fold change 1.2 (itraq) and 2.0 (RNA-Seq); ii) Q value < 0.05(iTRAQ) and FDR < 0.001(RNA-Seq). Yellow color: co-up-regulated proteins; red color: up-regulated proteins only in itraq; orange color: up-regulated genes only in RNA-Seq; gray color: proteins and genes without significant expression change. * gene expression was validated by qpcrgenes for RT-PCR. **The tandem mass spectra were showed in Figure S1 in Supporting Information. S4
5 S5
6 Figure S-1. Examples of tandem mass spectra of itraq for the differentially expressed proteins (DEPs) with low number of peptide. Five DEPs during seed germination of D. officinale were selected from Table S9 and Table S10 in Supporting Information (marked **), including Dendrobium_GLEAN_ , Dendrobium_GLEAN_ , Dendrobium_GLEAN_ , Dendrobium_GLEAN_ and Dendrobium_GLEAN_ Left column is the tandem mass spectra of the proteins and right column is the region containing the reporter ions of spectra (m/z: ) associated with the spectrum of proteins. Figure S-2. RNA-Seq and itraq 8-plex workflow of asymbiotic and symbiotic germination of D. officinale seeds. Stage2: early germination; Stage3: protocorm stage; Stage4: seedling stage; A1, A2, A3 represent developmental stage 2, stage3, stage4 in asymbiotic S6
7 germination and S1, S2, S3 represent stage2, stage 3, and stage 4 in symbiotic germination, C0 represent ungermination seed. Figure S-3. Comparative analysis of seed germination at all stages over 12 weeks time of D. officinale. A. Seed development in symbiotic condition. B. Seed development in asymbiotic conditions. C. A quantitive proportion of seeds at all stage compared total germination seed in 12 th week. AG: asymbiotic germination; SG: symbiotic germination. S7
8 Figure S-4. Comparison of expression ratios from transcriptomic (y-axis) and protomic (x-axis) profiling based on differentially expressed proteins and correlated genes at each compared group. Log2 expression ratios were calculated in adjacent development stage during asymbiotic (left columns) and symbiotic germination (middle columns) and at the same stage between symbiotic and asymbiotic germination (right columns). Red point represents both proteins and genes are differentially expressed. AG: asymbiotic germination; SG: symbiotic germination. S8
9 Figure S-5. Summary of correlation coefficient of quantitative correlation results (6 types) in each compared group. 6 types: correlation result of all quantitative protein and the mrna (blue); the differentially expressed proteins and genes with the same trend (green); the differentially expressed proteins and genes with the opposite trend (yellow); both proteins and RNA no change (orange); proteins no change but genes differentially expressed (red); proteins differentially expressed but genes no change (pale red). A1, A2, A3 represent developmental stage 2, stage 3, stage 4 in asymbiotic germination and S1, S2, S3 represent stage 2, stage 3, and stage 4 in symbiotic germination, C0 represent ungerminated seed. S9
Workflow concept. Data goes through the workflow. A Node contains an operation An edge represents data flow The results are brought together in tables
PROTEOME DISCOVERER Workflow concept Data goes through the workflow Spectra Peptides Quantitation A Node contains an operation An edge represents data flow The results are brought together in tables Protein
More informationIsotopic-Labeling and Mass Spectrometry-Based Quantitative Proteomics
Isotopic-Labeling and Mass Spectrometry-Based Quantitative Proteomics Xiao-jun Li, Ph.D. Current address: Homestead Clinical Day 4 October 19, 2006 Protein Quantification LC-MS/MS Data XLink mzxml file
More informationLast updated: Copyright
Last updated: 2012-08-20 Copyright 2004-2012 plabel (v2.4) User s Manual by Bioinformatics Group, Institute of Computing Technology, Chinese Academy of Sciences Tel: 86-10-62601016 Email: zhangkun01@ict.ac.cn,
More informationCaspase-1 Specific Light-up Probe with Aggregation-Induced Emission. Characteristics for Inhibitor Screening of Coumarin-Originated Natural.
Supporting Information Caspase-1 Specific Light-up Probe with Aggregation-Induced Emission Characteristics for Inhibitor Screening of Coumarin-Originated Natural Products Hao Lin, ^ Haitao Yang, ^ Shuai
More informationSeqAn and OpenMS Integration Workshop. Temesgen Dadi, Julianus Pfeuffer, Alexander Fillbrunn The Center for Integrative Bioinformatics (CIBI)
SeqAn and OpenMS Integration Workshop Temesgen Dadi, Julianus Pfeuffer, Alexander Fillbrunn The Center for Integrative Bioinformatics (CIBI) Mass-spectrometry data analysis in KNIME Julianus Pfeuffer,
More informationA NEW STILBENOID FROM ARUNDINA GRAMINIFOLIA
Journal of Asian Natural Products Research, September 2004, Vol. 6 (3), pp. 229 232 A NEW STILBENOID FROM ARUNDINA GRAMINIFOLIA MEI-FENG LIU a, YUN HAN b, DONG-MING XING a, YUE SHI a, LI-ZHEN XU c, LI-JUN
More informationOverview - MS Proteomics in One Slide. MS masses of peptides. MS/MS fragments of a peptide. Results! Match to sequence database
Overview - MS Proteomics in One Slide Obtain protein Digest into peptides Acquire spectra in mass spectrometer MS masses of peptides MS/MS fragments of a peptide Results! Match to sequence database 2 But
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2014 For submission to Analyst Identification and Discrimination of Binding Sites of an Organoruthenium
More informationMS Based Proteomics: Recent Case Studies Using Advanced Instrumentation
MS Based Proteomics: Recent Case Studies Using Advanced Instrumentation Chris Adams, PH.D. Stanford University Mass Spectrometry http://mass-spec.stanford.edu/ For personal use only. Please do not reuse
More informationSupplementary Figure 1
Supplementary Figure 1 The correlation of n-score cutoff and FDR in both CID-only and CID-ETD fragmentation strategies. A bar diagram of different n-score thresholds applied in the search, plotted against
More informationarxiv: v1 [astro-ph.im] 25 Apr 2014
CPC(HEP & NP), 9, 33(X): 5 Chinese Physics C Vol. 33, No. X, Xxx, 9 A linear calibration method on DNL error for energy spectrum * arxiv:44.633v [astro-ph.im] 5 Apr 4 LU Bo() ;) FU Yan-Hong(), CHEN Yong()
More informationGenome wide analysis of protein and mrna half lives reveals dynamic properties of mammalian gene expression
Genome wide analysis of protein and mrna half lives reveals dynamic properties of mammalian gene expression Matthias Selbach Cell Signaling and Mass Spectrometry Max Delbrück Center for Molecular Medicine
More informationUtilizing Illumina high-throughput sequencing technology to gain insights into small RNA biogenesis and function
Utilizing Illumina high-throughput sequencing technology to gain insights into small RNA biogenesis and function Brian D. Gregory Department of Biology Penn Genome Frontiers Institute University of Pennsylvania
More information** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.
Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *
More informationSupplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc
Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and
More informationIncreasing the Multiplexing of Protein Quantitation from 6- to 10-Plex with Reporter Ion Isotopologues
Increasing the Multiplexing of Protein Quantitation from 6- to 1-Plex with Reporter Ion Isotopologues Rosa Viner, 1 Ryan Bomgarden, 2 Michael Blank, 1 John Rogers 2 1 Thermo Fisher Scientific, San Jose,
More informationProteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering
Proteomics 2 nd semester, 2013 1 Text book Principles of Proteomics by R. M. Twyman, BIOS Scientific Publications Other Reference books 1) Proteomics by C. David O Connor and B. David Hames, Scion Publishing
More informationNPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
LECTURE-25 Quantitative proteomics: itraq and TMT TRANSCRIPT Welcome to the proteomics course. Today we will talk about quantitative proteomics and discuss about itraq and TMT techniques. The quantitative
More informationThe Developmental Transcriptome of the Mosquito Aedes aegypti, an invasive species and major arbovirus vector.
The Developmental Transcriptome of the Mosquito Aedes aegypti, an invasive species and major arbovirus vector. Omar S. Akbari*, Igor Antoshechkin*, Henry Amrhein, Brian Williams, Race Diloreto, Jeremy
More informationSmall RNA in rice genome
Vol. 45 No. 5 SCIENCE IN CHINA (Series C) October 2002 Small RNA in rice genome WANG Kai ( 1, ZHU Xiaopeng ( 2, ZHONG Lan ( 1,3 & CHEN Runsheng ( 1,2 1. Beijing Genomics Institute/Center of Genomics and
More informationHeterosis and inbreeding depression of epigenetic Arabidopsis hybrids
Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Plant growth conditions The soil was a 1:1 v/v mixture of loamy soil and organic compost. Initial soil water content was determined
More informationProteomics. Areas of Interest
Introduction to BioMEMS & Medical Microdevices Proteomics and Protein Microarrays Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationMass Spectrometry and Proteomics - Lecture 5 - Matthias Trost Newcastle University
Mass Spectrometry and Proteomics - Lecture 5 - Matthias Trost Newcastle University matthias.trost@ncl.ac.uk Previously Proteomics Sample prep 144 Lecture 5 Quantitation techniques Search Algorithms Proteomics
More informationSUPPLEMENTARY INFORMATION
reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative
More informationExpression Differences in the Caste Development of Honeybee Using Solexa Sequencing Method
Expression Differences in the Caste Development of Honeybee Using Solexa Sequencing Method Songkun Su1, Xiangqian Guo2,3, Aung Si4, Fang Liu1, Yi Zhan1, Shuanjin Dai1, Shenglu Chen1, Shaowu Zhang4,1, and
More informationSynthesis of ethanol from paraformaldehyde, CO 2 and H 2
Electronic Supplementary Material (ESI) for Green Chemistry. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Synthesis of ethanol from paraformaldehyde, CO 2 and
More informationDIA-Umpire: comprehensive computational framework for data independent acquisition proteomics
DIA-Umpire: comprehensive computational framework for data independent acquisition proteomics Chih-Chiang Tsou 1,2, Dmitry Avtonomov 2, Brett Larsen 3, Monika Tucholska 3, Hyungwon Choi 4 Anne-Claude Gingras
More informationChapter 11. Development: Differentiation and Determination
KAP Biology Dept Kenyon College Differential gene expression and development Mechanisms of cellular determination Induction Pattern formation Chapter 11. Development: Differentiation and Determination
More informationThree new xanthones from the roots of Polygala japonica Houtt.
Journal of Asian Natural Products Research Vol. 11, No. 5, May 2009, 465 469 Three new xanthones from the roots of Polygala japonica Houtt. Qing-Chun Xue, Chuang-Jun Li, Li Zuo, Jing-Zhi Yang and Dong-Ming
More informationSupporting information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry C. This journal is The Royal Society of Chemistry 2017 Supporting information High-quality single-layer nanosheets of MS 2 (M=
More informationBismuthoxyiodide Nanoflakes/Titania Nanotubes. Arrayed p-n Heterojunction and Its Application for. Photoelectrochemical Bioanalysis
Supplementary Information Bismuthoxyiodide Nanoflakes/Titania Nanotubes Arrayed p-n Heterojunction and Its Application for Photoelectrochemical Bioanalysis Wei-Wei Zhao 1, Zhao Liu 2, Shu Shan 1, Wen-Wen
More informationrobustness: revisting the significance of mirna-mediated regulation
: revisting the significance of mirna-mediated regulation Hervé Seitz IGH (CNRS), Montpellier, France October 13, 2012 microrna target identification .. microrna target identification mir: target: 2 7
More informationBayesian Clustering of Multi-Omics
Bayesian Clustering of Multi-Omics for Cardiovascular Diseases Nils Strelow 22./23.01.2019 Final Presentation Trends in Bioinformatics WS18/19 Recap Intermediate presentation Precision Medicine Multi-Omics
More informationSupporting Information. for A Water-Soluble Switching on Fluorescent Chemosensor of. Selectivity to Cd 2+
Supporting Information for A Water-Soluble Switching on Fluorescent Chemosensor of Selectivity to Cd 2+ Weimin Liu, a Liwei Xu, a Ruilong Sheng, a Pengfei Wang,*,a Huaping Li*,b and Shikang Wu a a Laboratory
More informationChapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype.
Chapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype. please read pages 38-47; 49-55;57-63. Slide 1 of Chapter 2 1 Extension sot Mendelian Behavior of Genes Single gene inheritance
More informationHighly doped and exposed Cu(I)-N active sites within graphene towards. efficient oxygen reduction for zinc-air battery
Electronic Supplementary Material (ESI) for Energy & Environmental Science. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information (ESI) for Energy & Environmental Science.
More informationComprehensive support for quantitation
Comprehensive support for quantitation One of the major new features in the current release of Mascot is support for quantitation. This is still work in progress. Our goal is to support all of the popular
More informationChemical Labeling Strategy for Generation of Internal Standards for Targeted Quantitative Proteomics
Chemical Labeling Strategy for Generation of Internal Standards for Targeted Quantitative Proteomics mtraq Reagents Triplex Christie Hunter, Brian Williamson, Marjorie Minkoff AB SCIEX, USA The utility
More informationGenomic expression catalogue of a global collection of BCG vaccine strains. show evidence for highly diverged metabolic and cell-wall adaptations.
Genomic expression catalogue of a global collection of BCG vaccine strains show evidence for highly diverged metabolic and cell-wall adaptations. Abdallah M. Abdallah 1 *, Grant A. Hill-Cawthorne 1,2,
More informationDeveloping Algorithms for the Determination of Relative Abundances of Peptides from LC/MS Data
Developing Algorithms for the Determination of Relative Abundances of Peptides from LC/MS Data RIPS Team Jake Marcus (Project Manager) Anne Eaton Melanie Kanter Aru Ray Faculty Mentors Shawn Cokus Matteo
More informationSupplementary Information. Characteristics of Long Non-coding RNAs in the Brown Norway Rat and. Alterations in the Dahl Salt-Sensitive Rat
Supplementary Information Characteristics of Long Non-coding RNAs in the Brown Norway Rat and Alterations in the Dahl Salt-Sensitive Rat Feng Wang 1,2,3,*, Liping Li 5,*, Haiming Xu 5, Yong Liu 2,3, Chun
More informationProteome-wide label-free quantification with MaxQuant. Jürgen Cox Max Planck Institute of Biochemistry July 2011
Proteome-wide label-free quantification with MaxQuant Jürgen Cox Max Planck Institute of Biochemistry July 2011 MaxQuant MaxQuant Feature detection Data acquisition Initial Andromeda search Statistics
More informationVCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design
VCE BIOLOGY 2006 2014 Relationship between the key knowledge and key skills of the 2000 2005 Study Design and the 2006 2014 Study Design The following table provides a comparison of the key knowledge (and
More informationSupplementary Material. Overexpression of a cytochrome P450 and a UDP-glycosyltransferase is associated with
Supplementary Material Overexpression of a cytochrome P450 and a UDP-glycosyltransferase is associated with imidacloprid resistance in the Colorado potato beetle, Leptinotarsa decemlineata Emine Kaplanoglu
More informationQuantitative Proteomics
Quantitative Proteomics Quantitation AND Mass Spectrometry Condition A Condition B Identify and quantify differently expressed proteins resulting from a change in the environment (stimulus, disease) Lyse
More informationSUPPLEMENTARY INFORMATION
Supplementary Discussion Rationale for using maternal ythdf2 -/- mutants as study subject To study the genetic basis of the embryonic developmental delay that we observed, we crossed fish with different
More informationStudy on form distribution of soil iron in western Jilin and its correlation with soil properties
35 2 2016 6 GLOBAL GEOLOGY Vol. 35 No. 2 Jun. 2016 1004 5589 2016 02 0593 08 1 1 2 1 1 1. 130061 2. 130012 50 A > B > C > D > E > F > G A A CEC B ph C E A C D G B C D P595 S151. 9 A doi 10. 3969 /j. issn.
More informationThe Chinese University of Hong Kong Department of Chemistry
Prof. Benjamin Chu Stony Brook University Use of Nanofibers for Biomedical and Environmental Applications June 3, 2016 (Friday) 10:30 a.m. Room LG23 Prof. Chi Wu Prof. Lu Bai Department of Physics The
More informationStatistical analysis of isobaric-labeled mass spectrometry data
Statistical analysis of isobaric-labeled mass spectrometry data Farhad Shakeri July 3, 2018 Core Unit for Bioinformatics Analyses Institute for Genomic Statistics and Bioinformatics University Hospital
More informationA Study on the Purification of the Flavonoids from Aloe Leaf Powder with Macroporous Resin
2010 32 1 0169-0174 Acta Agriculturae Universitatis Jiangxiensis http / /xuebao. jxau. edu. cn E - mail ndxb7775@ sina. com 330045 H1020 ph 3. 0 φ = 80% 12 mg /ml φ = 80% 2. 0 ml /min S567. 23 + 9 Q946.
More informationA Description of the CPTAC Common Data Analysis Pipeline (CDAP)
A Description of the CPTAC Common Data Analysis Pipeline (CDAP) v. 01/14/2014 Summary The purpose of this document is to describe the software programs and output files of the Common Data Analysis Pipeline
More informationCoordination-enabled one-step assembly of. ultrathin, hybrid microcapsules with. weak ph-response
Supporting Information Coordination-enabled one-step assembly of ultrathin, hybrid microcapsules with weak ph-response Chen Yang,, Hong Wu,, Xiao Yang,, Jiafu Shi*,,, Xiaoli Wang,, Shaohua Zhang, and Zhongyi
More informationTable of contents. Ling-Yan Chen, a,b Stéphane Guillarme, a and Christine Saluzzo a *
Supplementary Material Dianhydrohexitols: new tools for organocatalysis. Application in enantioselective Friedel-Crafts alkylation of indoles with nitroalkenes Ling-Yan Chen, a,b Stéphane Guillarme, a
More informationQ Exactive TM : A True Qual-Quan HR/AM Mass Spectrometer for Routine Proteomics Applications. Yi Zhang, Ph.D. ThermoFisher Scientific
Q Exactive TM : A True Qual-Quan HR/AM Mass Spectrometer for Routine Proteomics Applications Yi Zhang, Ph.D. ThermoFisher Scientific Outline Introduction of Q Exactive Performance in Discovery Proteomics
More informationSupplementary Table 1. Primers used in this study.
Supplementary Tale 1. Primers used in this study. Name Primer sequence (5'-3') Primers of PCR-ased molecular markers developed in this study M1 F M1 R M2 F M2 R M3 F M3 R M4 F M4 R M5 F M5 R M6 F M6 R
More informationSupporting Information for Publication
Supporting Information for Publication Title of Paper Comparisons of Protein and Peptide Complexity in Poneroid and Formicoid Ant Venoms Authors Samira R. Aili, Axel Touchard, Jennifer M. S. Koh, Alain
More informationName: Period: Date: Photosynthesis Practice Questions
Name: Date: Photosynthesis Practice Questions 1. The diagram below represents events associated with a biochemical process that occurs in some organisms. 2. The diagram below represents the setup for an
More informationarxiv: v1 [physics.ins-det] 19 Apr 2014
Sub to Chinese Physics C Vol. 33, No. X, Xxx, 9 Proton irradiation effect on SCDs * arxiv:144.4931v1 [physics.ins-det] 19 Apr 14 YANG Yan-Ji() 1,;1) LU Jing-Bin() 1 WANG Yu-Sa() CHEN Yong() XU Yu-Peng()
More informationSupplemental Data. Chen and Thelen (2010). Plant Cell /tpc
Supplemental Data. Chen and Thelen (2010). Plant Cell 10.1105/tpc.109.071837 1 C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector
More informationTranslation Part 2 of Protein Synthesis
Translation Part 2 of Protein Synthesis IN: How is transcription like making a jello mold? (be specific) What process does this diagram represent? A. Mutation B. Replication C.Transcription D.Translation
More informationThe combined use of Arabidopsis thaliana and Lepidium sativum to find conserved mechanisms of seed germination within the Brassicaceae family
www.seedbiology.de The combined use of Arabidopsis thaliana and Lepidium sativum to find conserved mechanisms of seed germination within the Brassicaceae family Linkies, A., Müller, K., Morris, K., Gräber,
More informationSchool of Nuclear Science and Engineering, East China University of Technology,
Large-pore Layered Networks, Polycatenated Frameworks and Three-dimensional Frameworks of Uranyl Tri(biphenyl)amine/Tri(phenyl)amine Tricarboxylate: Solvent/Ligand-dependent Dual Regulation Shuai Wang,,,#
More informationCorrelation Networks
QuickTime decompressor and a are needed to see this picture. Correlation Networks Analysis of Biological Networks April 24, 2010 Correlation Networks - Analysis of Biological Networks 1 Review We have
More informationSupplemental Information
Molecular Cell, Volume 52 Supplemental Information The Translational Landscape of the Mammalian Cell Cycle Craig R. Stumpf, Melissa V. Moreno, Adam B. Olshen, Barry S. Taylor, and Davide Ruggero Supplemental
More informationSupplementary Information
Supplementary Information Cytotoxicity, Hemolytic Toxicity and Mechanism of Action of Pulsatilla Saponin D and Its Synthetic Derivatives Zhong Chen a,b, Huaqing Duan a, Xiaohang Tong a, Peiling Hsu b,
More informationComparative Genomics II
Comparative Genomics II Advances in Bioinformatics and Genomics GEN 240B Jason Stajich May 19 Comparative Genomics II Slide 1/31 Outline Introduction Gene Families Pairwise Methods Phylogenetic Methods
More informationAnalysis of MALDI-TOF Data: from Data Preprocessing to Model Validation for Survival Outcome
Analysis of MALDI-TOF Data: from Data Preprocessing to Model Validation for Survival Outcome Heidi Chen, Ph.D. Cancer Biostatistics Center Vanderbilt University School of Medicine March 20, 2009 Outline
More informationSupplementary Tables and Figures
Supplementary Tables Supplementary Tables and Figures Supplementary Table 1: Tumor types and samples analyzed. Supplementary Table 2: Genes analyzed here. Supplementary Table 3: Statistically significant
More informationSupplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1
Supplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1 F/F ;mir-17~92 F/F (Pkd1-miR-17~92KO) mice. (A) Q-PCR
More informationWeyl semimetal phase in the non-centrosymmetric compound TaAs
Weyl semimetal phase in the non-centrosymmetric compound TaAs L. X. Yang 1,2,3, Z. K. Liu 4,5, Y. Sun 6, H. Peng 2, H. F. Yang 2,7, T. Zhang 1,2, B. Zhou 2,3, Y. Zhang 3, Y. F. Guo 2, M. Rahn 2, P. Dharmalingam
More informationSupporting Information
Supporting Information Repeated Growth Etching Regrowth for Large-Area Defect-Free Single-Crystal Graphene by Chemical Vapor Deposition Teng Ma, 1 Wencai Ren, 1 * Zhibo Liu, 1 Le Huang, 2 Lai-Peng Ma,
More informationLight-Controlled Shrinkage of Large-Area Gold Nanoparticles Monolayer Film for Tunable SERS Activity
Light-Controlled Shrinkage of Large-Area Gold Nanoparticles Monolayer Film for Tunable SERS Activity Xuefei Lu a,b, Youju Huang b,c,d, *, Baoqing Liu a,b, Lei Zhang b,c, Liping Song b,c, Jiawei Zhang b,c,
More informationBiological Roles of Cytokinins
Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators
More informationThe Design and Synthesis of 60 Dendritic Donor Ligands and Their. Coordination-Driven Self-Assembly into Supramolecular. Rhomboidal Metallodendrimers
The Design and Synthesis of 60 Dendritic Donor Ligands and Their Coordination-Driven Self-ssembly into Supramolecular Rhomboidal Metallodendrimers Qing Han, Quan-Jie Li, Jiuming He &, ingjie Hu #, Hongwei
More informationState Forest Research Institute, Post Box No. 159, Itanagar , India 1 Department of Botany, Rajiv Gandhi University, Itanagar , India
Indian Journal of Biotechnology Vol 6, April 2007, pp. 256-261 Effects of different culture media on seed germination and subsequent in vitro development of protocorms of Hygrochilus parishii (Veith &
More informationIdentifying and Visualizing the Edge Terminations of Single-Layer MoSe2 Island Epitaxially Grown on Au(111)
Supporting Information Identifying and Visualizing the Edge Terminations of Single-Layer MoSe2 Island Epitaxially Grown on Au(111) Jianchen Lu, De-Liang Bao, Kai Qian, Shuai Zhang, Hui Chen, Xiao Lin*,
More informationThe Effect of Pollination Time and Gibberellic Acid (GA3) on the Production and Seed Germination of Phalaenopsis Orchids
The Effect of Pollination Time and Gibberellic Acid (GA3) on the Production and Seed Germination of Phalaenopsis Orchids Hassan Kia Heirati 1*, Rasoul Onsinejad 2 and Fattaneh Yari 3 1 M.S. Student, Department
More informationHongda Wang Guohui Li Editors. Membrane Biophysics. New Insights and Methods
Membrane Biophysics Hongda Wang Guohui Li Editors Membrane Biophysics New Insights and Methods 123 Editors Hongda Wang Changchun Institute of Applied Chemistry Chinese Academy of Sciences Changchun Guohui
More informationAsperolides A C, Tetranorlabdane Diterpenoids from the Marine
Supporting Information Asperolides A C, Tetranorlabdane Diterpenoids from the Marine Alga-derived Endophytic Fungus Aspergillus wentii EN-48 Hao-Fen Sun,, Xiao-Ming Li, Li Meng, Chuan-Ming Cui,, Shu-Shan
More informationTRANSCRIPTOMICS. (or the analysis of the transcriptome) Mario Cáceres. Main objectives of genomics. Determine the entire DNA sequence of an organism
TRANSCRIPTOMICS (or the analysis of the transcriptome) Mario Cáceres Main objectives of genomics Determine the entire DNA sequence of an organism Identify and annotate the complete set of genes encoded
More informationTable S1 List of primers used for genotyping and qrt-pcr.
Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!
More informationMS-based proteomics to investigate proteins and their modifications
MS-based proteomics to investigate proteins and their modifications Francis Impens VIB Proteomics Core October th 217 Overview Mass spectrometry-based proteomics: general workflow Identification of protein
More informationBIOINF 4120 Bioinformatics 2 - Structures and Systems - Oliver Kohlbacher Summer Systems Biology Exp. Methods
BIOINF 4120 Bioinformatics 2 - Structures and Systems - Oliver Kohlbacher Summer 2013 14. Systems Biology Exp. Methods Overview Transcriptomics Basics of microarrays Comparative analysis Interactomics:
More informationPC235: 2008 Lecture 5: Quantitation. Arnold Falick
PC235: 2008 Lecture 5: Quantitation Arnold Falick falickam@berkeley.edu Summary What you will learn from this lecture: There are many methods to perform quantitation using mass spectrometry (any method
More informationmicrorna pseudo-targets
microrna pseudo-targets Natalia Pinzón Restrepo Institut de Génétique Humaine (CNRS), Montpellier, France August, 2012 microrna target identification mir: target: 2 7 5 N NNNNNNNNNNNNNN NNNNNN 3 the seed
More informationHOWTO, example workflow and data files. (Version )
HOWTO, example workflow and data files. (Version 20 09 2017) 1 Introduction: SugarQb is a collection of software tools (Nodes) which enable the automated identification of intact glycopeptides from HCD
More informationProteomics. November 13, 2007
Proteomics November 13, 2007 Acknowledgement Slides presented here have been borrowed from presentations by : Dr. Mark A. Knepper (LKEM, NHLBI, NIH) Dr. Nathan Edwards (Center for Bioinformatics and Computational
More informationAmine specific Labeling Reagents for Multiplexed Relative and Absolute Protein Quantitation
Product Bulletin itraq Reagents itraq Reagents Amine specific Labeling Reagents for Multiplexed Relative and Absolute Protein Quantitation Background Proteomics research includes the characterization of
More informationPromotion of quality standard of herbal medicine by constituent removing and adding
Supporting Information Promotion of quality standard of herbal medicine by constituent removing and adding Dan Yan 1,2,7, Junxian Li 1,7, Yin Xiong 1,3,7, Congen Zhang 1, Jiaoyang Luo 4, Yumei Han 5, Ruiling
More informationKey questions of proteomics. Bioinformatics 2. Proteomics. Foundation of proteomics. What proteins are there? Protein digestion
s s Key questions of proteomics What proteins are there? Bioinformatics 2 Lecture 2 roteomics How much is there of each of the proteins? - Absolute quantitation - Stoichiometry What (modification/splice)
More informationAnti-Inflammatory Isoquinoline with Bis-seco-aporphine Skeleton from Dactylicapnos scandens
Anti-Inflammatory Isoquinoline with Bis-seco-aporphine Skeleton from Dactylicapnos scandens Bei Wang,,, Zi-Feng Yang,, Yun-Li Zhao, Ya-Ping Liu, Jun Deng, Wan-Yi Huang, Xiao-Nian Li, Xin-Hua Wang *, and
More informationLecture 15: Realities of Genome Assembly Protein Sequencing
Lecture 15: Realities of Genome Assembly Protein Sequencing Study Chapter 8.10-8.15 1 Euler s Theorems A graph is balanced if for every vertex the number of incoming edges equals to the number of outgoing
More informationProtein Quantitation II: Multiple Reaction Monitoring. Kelly Ruggles New York University
Protein Quantitation II: Multiple Reaction Monitoring Kelly Ruggles kelly@fenyolab.org New York University Traditional Affinity-based proteomics Use antibodies to quantify proteins Western Blot RPPA Immunohistochemistry
More informationTutorial 2: Analysis of DIA data in Skyline
Tutorial 2: Analysis of DIA data in Skyline In this tutorial we will learn how to use Skyline to perform targeted post-acquisition analysis for peptide and inferred protein detection and quantitation using
More informationFigure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated
Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin
More informationWavelet-Based Preprocessing Methods for Mass Spectrometry Data
Wavelet-Based Preprocessing Methods for Mass Spectrometry Data Jeffrey S. Morris Department of Biostatistics and Applied Mathematics UT M.D. Anderson Cancer Center Overview Background and Motivation Preprocessing
More informationSupplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.
Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny
More informationMaternal control of seed development mediated by the flavonoid biosynthesis pathway
P- END1 Maternal control of seed development mediated by the flavonoid biosynthesis pathway Maha Aljabri, James Doughty, and Rod Scott University of Bath, UK Many plants exhibit post-zygotic barriers to
More informationSERS and NMR Studies of Typical Aggregation-induced. Emission Molecules
Supplemental information SERS and NMR Studies of Typical Aggregation-induced Emission Molecules Cheng Fang, Yujun Xie, Martin R. Johnston, Yinlan Ruan, Ben Zhong Tang 5, *, Qian Peng, *, Youhong Tang 6,
More informationA TMT-labeled Spectral Library for Peptide Sequencing
A TMT-labeled Spectral Library for Peptide Sequencing by Jianqiao Shen A thesis presented to the University of Waterloo in fulfillment of the thesis requirement for the degree of Master of Mathematics
More information