microrna pseudo-targets
|
|
- Oswin Shaw
- 5 years ago
- Views:
Transcription
1 microrna pseudo-targets Natalia Pinzón Restrepo Institut de Génétique Humaine (CNRS), Montpellier, France August, 2012
2 microrna target identification mir: target: N NNNNNNNNNNNNNN NNNNNN 3 the seed
3 Most Identification of mirna targets computational programs for target prediction: search seed matches in 3 UTRs, select the ones that were conserved in evolution
4 Most Identification of mirna targets computational programs for target prediction: search seed matches in 3 UTRs, select the ones that were conserved in evolution Such short matches are very frequent (60 % of human coding genes seem to be targeted: Friedman et al, 2009)
5 Most Identification of mirna targets computational programs for target prediction: search seed matches in 3 UTRs, select the ones that were conserved in evolution Such short matches are very frequent (60 % of human coding genes seem to be targeted: Friedman et al, 2009) = mirnas are implicated in every physiological process in animals
6 Paradox mirna-mediated repression is very modest (usually < 2-fold) (Baek et al, 2008, Selbach et al, 2008), but biological processes are robust: they can tolerate considerable fluctuations in parameters (such as genetic variation) and still generate invariant phenotypic outputs
7 Paradox mirna-mediated repression is very modest (usually < 2-fold) (Baek et al, 2008, Selbach et al, 2008), but biological processes are robust: they can tolerate considerable fluctuations in parameters (such as genetic variation) and still generate invariant phenotypic outputs = how mirnas accomplish any significant regulation (a small change in gene expression triggers a physiological effect)?
8 An alternative hypothesis
9 An alternative hypothesis Most computationally predicted targets are not functionally targeted (not repressed enough) Their phylogenetic conservation means that these binding sites have a function pseudo-target (insensitive)
10 An alternative hypothesis Most computationally predicted targets are not functionally targeted (not repressed enough) Their phylogenetic conservation means that these binding sites have a function That function could be to repress the mirna by titrating it pseudo-target (insensitive) real target (sensitive)
11 Discriminative prediction 1 mrna microrna mrna According to the new hypothesis: mirna binding sites should be better conserved in abundantly expressed pseudo-targets
12 Discriminative prediction 1 mrna microrna mrna According to the new hypothesis: mirna binding sites should be better conserved in abundantly expressed pseudo-targets According to the current theory: mirna binding sites conservation is not expected to correlate with gene expression
13 Are seed match conservation and mrna abundance correlated?
14 Are seed match conservation and mrna abundance correlated? mirna binding site conservation: measured by TargetScan s P CT score (Friedman et al, 2009) Quantification of mrna abundance: extracted from published microarray experiments (Mackiewicz et al, 2007, Thorrez et al, 2008)
15 Are seed match conservation and mrna abundance correlated? Kendall's τ = (p-value = ) Conservation score (P CT ) of binding sites to mir Gene expression in hypothalamus
16 Are seed match conservation and mrna abundance correlated? Kendall's τ = (p-value = ) Conservation score (P CT ) of binding sites to mir Gene expression in hypothalamus abundantly expressed mir-17 targets tend to bear highly conserved binding sites
17 Are seed match conservation and mrna abundance correlated? hypothalamus Adjusted p value 1e 16 1e 12 1e 08 1e 04 1 mir Kendall s τ
18 Are seed match conservation and mrna abundance correlated? hypothalamus kidney Adjusted p value 1e 16 1e 12 1e 08 1e 04 1 mir-17 Adjusted p value 1e 16 1e 12 1e 08 1e Kendall s τ Kendall s τ +34 other mouse tissues, same results: Supplementary data +33 fly tissues, same results: Supplementary data
19 Discriminative prediction 2 According to the current theory: mirna targets are tightly regulated (inter-individual fluctuation should not exceed mirna-guided repression)
20 Discriminative prediction 2 According to the current theory: mirna targets are tightly regulated (inter-individual fluctuation should not exceed mirna-guided repression) According to the new hypothesis: Pseudo-target expression levels can fluctuate between individuals in a natural population (phenotype is robust)
21 Natural variability vs mirna-guided repression
22 Natural variability vs mirna-guided repression Baek et al, 2008: quantification of mir-223-mediated repression in mouse neutrophils
23 Natural variability vs mirna-guided repression Baek et al, 2008: quantification of mir-223-mediated repression in mouse neutrophils Blood collection Neutrophil isolation RNA extraction cdna labeling, array hybridization
24 Natural variability vs mirna-guided repression Baek et al, 2008: quantification of mir-223-mediated repression in mouse neutrophils Blood collection Neutrophil isolation Blood collection Pooled blood Split in 5 replicates Neutrophil isolation RNA extraction RNA extraction cdna labeling, array hybridization cdna labeling, array hybridization
25 Natural variability vs mirna-guided repression
26 Natural variability vs mirna-guided repression
27 Natural variability vs mirna-guided repression
28 Natural variability vs mirna-guided repression p: probability that the difference between two individual mice is smaller than mirna-guided repression
29 Natural variability vs mirna-guided repression For 168 predicted targets out of 189: inter-individual fluctuations across 5 wild-type mice exceeds mirna-mediated regulation (p-value < 005)
30 Natural variability vs mirna-guided repression For 168 predicted targets out of 189: inter-individual fluctuations across 5 wild-type mice exceeds mirna-mediated regulation (p-value < 005) the remaining 21 targets:
31 Conclusion: revisiting mirna target definition
32 Conclusion: revisiting mirna target definition Every measurable change in gene expression does not translate into a macroscopic, evolutionarily selectable phenotype gene expression phenotype
33 Acknowledgements Hervé Seitz, Anna Sergeeva, and Laura Martinez Jessy Presumey and Florence Apparailly (INM, Montpellier, France)
34 Supplementary data Alternative interpretations of properties of predicted mirna targets Conservative approximations in the assessment of abundance/conservation correlation Positive correlation between gene expression and conservation of mirna binding sites Dose-sensitivity and seed match conservation
35 Alternative interpretations of properties of predicted mirna targets mrna for gene 1 mrna for gene 1 mrna for gene 2 mrna for gene 2 mirna mirna mrna for gene 3 mrna for gene 3 mrna for gene 4 mrna for gene 4 Return
36 Alternative interpretations of properties of predicted mirna targets mirna mrna mirna and mrna expression mrna sharp boundary of mrna activity domain mirna and mrna expression mirna sharp boundary of mirna activity domain spatial or temporal axis spatial or temporal axis Return
37 Alternative interpretations of properties of predicted mirna targets mirna mrna for tissue specific gene mirna mrna for tissue specific gene avoidance avoidance cell type 1 mrna for house keeping gene cell type 1 mrna for house keeping gene mirna mrna for tissue specific gene mirna mrna for tissue specific gene avoidance avoidance cell type 2 mrna for house keeping gene cell type 2 mrna for house keeping gene Return
38 mrna abundance and seed match conservation Most predicted targets are expected to be pseudo-targets (conservative approximation: we will consider every predicted target) mirna binding site should correlate with that mrna s abundance in the cells where mirna titration is beneficial (conservative approximation: we will consider whole tissues and organs) Poorly abundant mrnas (without a real titration effect on the mirna) should not exhibit such correlation (conservative approximation: we will consider every mrna) Return
39 mrna abundance and seed match conservation splenic B cells spleen naive B cells Adjusted p value 1e 16 1e 12 1e 08 1e 04 1 Adjusted p value 1e 16 1e 12 1e 08 1e 04 1 Adjusted p value 1e 16 1e 12 1e 08 1e Kendall s τ Kendall s τ Kendall s τ testis ES cells ovary Adjusted p value 1e 16 1e 12 1e 08 1e 04 1 Adjusted p value 1e 16 1e 12 1e 08 1e 04 1 Adjusted p value 1e 16 1e 12 1e 08 1e Kendall s τ Kendall s τ Kendall s τ Return
40 mrna abundance and seed match conservation adult ovary adult eye adult heart Adjusted p value 1e 16 1e 12 1e 08 1e 04 1 Adjusted p value 1e 16 1e 12 1e 08 1e 04 1 Adjusted p value 1e 16 1e 12 1e 08 1e Expression of deeply conserved/expression of poorly conserved Expression of deeply conserved/expression of poorly conserved Expression of deeply conserved/expression of poorly conserved adult hind gut adult salivary gland larval feeding fatbody Adjusted p value 1e 16 1e 12 1e 08 1e 04 1 Adjusted p value 1e 16 1e 12 1e 08 1e 04 1 Adjusted p value 1e 16 1e 12 1e 08 1e Expression of deeply conserved/expression of poorly conserved Expression of deeply conserved/expression of poorly conserved Expression of deeply conserved/expression of poorly conserved Return
41 mrna abundance ans seed match conservation hypothalamus Adjusted p value 1e 16 1e 12 1e 08 1e 04 1 mir-122 mir-150 mir-124 mir-138 mir-9 mir-181a mir-1a mir-133 neuron-specific micrornas non neuron-specific micrornas Kendall s τ Return
42 Return Dose-sensitivity and seed match conservation
robustness: revisting the significance of mirna-mediated regulation
: revisting the significance of mirna-mediated regulation Hervé Seitz IGH (CNRS), Montpellier, France October 13, 2012 microrna target identification .. microrna target identification mir: target: 2 7
More informationSupplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1
Supplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1 F/F ;mir-17~92 F/F (Pkd1-miR-17~92KO) mice. (A) Q-PCR
More informationGene Autoregulation via Intronic micrornas and its Functions
Gene Autoregulation via Intronic micrornas and its Functions Carla Bosia Department of Theoretical Physics University of Torino and INFN, Italy cbosia@to.infn.it Annecy-le-Vieux 20-22/10/2010 OUTLINE microrna
More informationTRANSCRIPTOMICS. (or the analysis of the transcriptome) Mario Cáceres. Main objectives of genomics. Determine the entire DNA sequence of an organism
TRANSCRIPTOMICS (or the analysis of the transcriptome) Mario Cáceres Main objectives of genomics Determine the entire DNA sequence of an organism Identify and annotate the complete set of genes encoded
More information10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison
10-810: Advanced Algorithms and Models for Computational Biology microrna and Whole Genome Comparison Central Dogma: 90s Transcription factors DNA transcription mrna translation Proteins Central Dogma:
More informationLesson Overview. Gene Regulation and Expression. Lesson Overview Gene Regulation and Expression
13.4 Gene Regulation and Expression THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium
More informationComplete all warm up questions Focus on operon functioning we will be creating operon models on Monday
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA
More information13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
More informationGene Regulation and Expression
THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium that contains more than 4000 genes.
More informationSupplementary Figure 1. Nature Genetics: doi: /ng.3848
Supplementary Figure 1 Phenotypes and epigenetic properties of Fab2L flies. A- Phenotypic classification based on eye pigment levels in Fab2L male (orange bars) and female (yellow bars) flies (n>150).
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
More informationthe noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB)
Biology of the the noisy gene Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) day III: noisy bacteria - Regulation of noise (B. subtilis) - Intrinsic/Extrinsic
More informationEdward M. Golenberg Wayne State University Detroit, MI
Edward M. Golenberg Wayne State University Detroit, MI Targeting Phragmites Success As Invasive Species Phragmites displays multiple life history parameters High seed output and small seed size Rapid growth
More informationHairpin Database: Why and How?
Hairpin Database: Why and How? Clark Jeffries Research Professor Renaissance Computing Institute and School of Pharmacy University of North Carolina at Chapel Hill, United States Why should a database
More informationGLOBEX Bioinformatics (Summer 2015) Genetic networks and gene expression data
GLOBEX Bioinformatics (Summer 2015) Genetic networks and gene expression data 1 Gene Networks Definition: A gene network is a set of molecular components, such as genes and proteins, and interactions between
More informationUpstream Elements Regulating mir-241 and mir-48 Abstract Introduction
Upstream Elements Regulating mir-241 and mir-48 Hanna Vollbrecht, Tamar Resnick, and Ann Rougvie University of Minnesota: Twin Cities Undergraduate Research Scholarship 2012-2013 Abstract Caenorhabditis
More informationAP Biology Essential Knowledge Cards BIG IDEA 1
AP Biology Essential Knowledge Cards BIG IDEA 1 Essential knowledge 1.A.1: Natural selection is a major mechanism of evolution. Essential knowledge 1.A.4: Biological evolution is supported by scientific
More informationMIR-237 is Likely a Developmental Timing Gene that Regulates the L2-to-L3 Transition in C. Elegans
Marquette University e-publications@marquette Master's Theses (2009 -) Dissertations, Theses, and Professional Projects MIR-237 is Likely a Developmental Timing Gene that Regulates the L2-to-L3 Transition
More informationControl of Gene Expression
Control of Gene Expression Mechanisms of Gene Control Gene Control in Eukaryotes Master Genes Gene Control In Prokaryotes Epigenetics Gene Expression The overall process by which information flows from
More informationEssential knowledge 1.A.2: Natural selection
Appendix C AP Biology Concepts at a Glance Big Idea 1: The process of evolution drives the diversity and unity of life. Enduring understanding 1.A: Change in the genetic makeup of a population over time
More informationTAC1 TAC4 TAC7 TAC14 TAC21
Table S1 Gene qrt-pcr primer sequence Amplification efficiency α-sma (FW) 5 - GCCAGTCGCTGTCAGGAACCC -3 (RV) 5 - AGCCGGCCTAGAGCCCA -3 Procollagen-I (FW) 5 - AAGACGGGAGGGCGAGTGCT -3 (RV) 5 - AACGGGTCCCCTTGGGCCTT
More informationLecture 7. Development of the Fruit Fly Drosophila
BIOLOGY 205/SECTION 7 DEVELOPMENT- LILJEGREN Lecture 7 Development of the Fruit Fly Drosophila 1. The fruit fly- a highly successful, specialized organism a. Quick life cycle includes three larval stages
More informationDesign of Microarray Experiments. Xiangqin Cui
Design of Microarray Experiments Xiangqin Cui Experimental design Experimental design: is a term used about efficient methods for planning the collection of data, in order to obtain the maximum amount
More informationGenome wide analysis of protein and mrna half lives reveals dynamic properties of mammalian gene expression
Genome wide analysis of protein and mrna half lives reveals dynamic properties of mammalian gene expression Matthias Selbach Cell Signaling and Mass Spectrometry Max Delbrück Center for Molecular Medicine
More informationMatteo Figliuzzi
Supervisors: Prof. Andrea De Martino, Prof. Enzo Marinari Dottorato in sica, XXVI ciclo (N,1) model (N,M) model 25-10-2013 Systems Biology & Networks (N,1) model (N,M) model Arabidopsis regulatory network
More information1 Calculating the likelihood. 1.1 Partition function
1 Supplementary Note to: A biophysical mirna-mrna interaction model infers canonical and non-canonical targets Mohsen Khorshid 1, Jean Hausser 1, Mihaela Zavolan 1,, Erik van Nimwegen 1, 1 Biozentrum,
More informationSingle gene analysis of differential expression. Giorgio Valentini
Single gene analysis of differential expression Giorgio Valentini valenti@disi.unige.it Comparing two conditions Each condition may be represented by one or more RNA samples. Using cdna microarrays, samples
More informationPredicting Protein Functions and Domain Interactions from Protein Interactions
Predicting Protein Functions and Domain Interactions from Protein Interactions Fengzhu Sun, PhD Center for Computational and Experimental Genomics University of Southern California Outline High-throughput
More informationSUPPLEMENTARY INFORMATION
Supplementary Discussion Rationale for using maternal ythdf2 -/- mutants as study subject To study the genetic basis of the embryonic developmental delay that we observed, we crossed fish with different
More informationMOLECULAR CONTROL OF EMBRYONIC PATTERN FORMATION
MOLECULAR CONTROL OF EMBRYONIC PATTERN FORMATION Drosophila is the best understood of all developmental systems, especially at the genetic level, and although it is an invertebrate it has had an enormous
More informationS A T T A I T ST S I T CA C L A L DAT A A T
Microarray Center STATISTICAL DATA ANALYSIS IN EXCEL Lecture 5 Linear Regression dr. Petr Nazarov 31-10-2011 petr.nazarov@crp-sante.lu Statistical data analysis in Excel. 5. Linear regression OUTLINE Lecture
More informationTwo-Color Microarray Experimental Design Notation. Simple Examples of Analysis for a Single Gene. Microarray Experimental Design Notation
Simple Examples of Analysis for a Single Gene wo-olor Microarray Experimental Design Notation /3/0 opyright 0 Dan Nettleton Microarray Experimental Design Notation Microarray Experimental Design Notation
More informationInferring disease-associated lncrnas using expression data and disease-associated protein coding genes
Inferring disease-associated lncrnas using expression data and disease-associated protein coding genes Xiaoyong Pan Center for non-coding RNA in Technology and Health, Department of Clinical Veterinary
More informationBIOMED Programming & Modeling for BME Final Exam, , Instructor: Ahmet Sacan
BIOMED 201 - Programming & Modeling for BME Final Exam, 2011.12.01, Instructor: Ahmet Sacan Sign the honor code below. No credit will be given for the exam without a signed pledge. I have neither given
More informationBiology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 26 Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 2 of 26 Gene Regulation: An Example Gene Regulation: An Example
More informationCorrespondence of D. melanogaster and C. elegans developmental stages revealed by alternative splicing characteristics of conserved exons
Gao and Li BMC Genomics (2017) 18:234 DOI 10.1186/s12864-017-3600-2 RESEARCH ARTICLE Open Access Correspondence of D. melanogaster and C. elegans developmental stages revealed by alternative splicing characteristics
More informationGenomic Medicine HT 512. Data representation, transformation & modeling in genomics
Harvard-MIT Division of Health Sciences and Technology HST.512: Genomic Medicine Prof. Alvin T.Kho Genomic Medicine HT 512 Data representation, transformation & modeling in genomics Lecture 11, Mar 18,
More informationVCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design
VCE BIOLOGY 2006 2014 Relationship between the key knowledge and key skills of the 2000 2005 Study Design and the 2006 2014 Study Design The following table provides a comparison of the key knowledge (and
More informationAP Biology Curriculum Framework
AP Biology Curriculum Framework This chart correlates the College Board s Advanced Placement Biology Curriculum Framework to the corresponding chapters and Key Concept numbers in Campbell BIOLOGY IN FOCUS,
More informationCONJOINT 541. Translating a Transcriptome at Specific Times and Places. David Morris. Department of Biochemistry
CONJOINT 541 Translating a Transcriptome at Specific Times and Places David Morris Department of Biochemistry http://faculty.washington.edu/dmorris/ Lecture 1 The Biology and Experimental Analysis of mrna
More informationValley Central School District 944 State Route 17K Montgomery, NY Telephone Number: (845) ext Fax Number: (845)
Valley Central School District 944 State Route 17K Montgomery, NY 12549 Telephone Number: (845)457-2400 ext. 18121 Fax Number: (845)457-4254 Advance Placement Biology Presented to the Board of Education
More information12-5 Gene Regulation
12-5 Gene Regulation Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 1 of 26 12-5 Gene Regulation Gene Regulation: An Example Gene
More informationMicroRNA mir-34 provides robustness to environmental stress response via
MicroRNA mir-34 provides robustness to environmental stress respoe via the DAF-16 network in C. elega Meltem Isik 1,2, T. Keith Blackwell 2, and Eugene Berezikov 1,3 1 Hubrecht Ititute-KNAW and University
More informationLecture 18 June 2 nd, Gene Expression Regulation Mutations
Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase
More informationBME 5742 Biosystems Modeling and Control
BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various
More informationComputational Genomics. Reconstructing dynamic regulatory networks in multiple species
02-710 Computational Genomics Reconstructing dynamic regulatory networks in multiple species Methods for reconstructing networks in cells CRH1 SLT2 SLR3 YPS3 YPS1 Amit et al Science 2009 Pe er et al Recomb
More informationDiscordance between replicate qpcr reactions. Jan M Ruijter Department of Medical Biology Academic Medical Center Amsterdam, the Netherlands
Discordance between replicate qpcr reactions Jan M Ruijter Department of Academic Medical Center Amsterdam, the Netherlands qpcr data etc. 0 2 2 4 3 8 cycles N 2 0 2 2 2 2 3 PCR product after n cycles
More informationGeert Geeven. April 14, 2010
iction of Gene Regulatory Interactions NDNS+ Workshop April 14, 2010 Today s talk - Outline Outline Biological Background Construction of Predictors The main aim of my project is to better understand the
More information1 GO: regulation of cell size E-04 2 GO: negative regulation of cell growth GO:
Table S2: The biological modulated by mir-5701 Sr. No Term Id 1 Term Name 2 Hit Gene Number 3 P-Value 4 1 GO:0008361 regulation of cell size 9 4.37E-04 2 GO:0030308 negative regulation of cell growth 8
More informationUnderstanding Science Through the Lens of Computation. Richard M. Karp Nov. 3, 2007
Understanding Science Through the Lens of Computation Richard M. Karp Nov. 3, 2007 The Computational Lens Exposes the computational nature of natural processes and provides a language for their description.
More informationmicrorna Studies Chen-Hanson Ting SVFIG June 23, 2018
microrna Studies Chen-Hanson Ting SVFIG June 23, 2018 Summary MicroRNA (mirna) Species and organisms studied mirna in mitocondria Huge genome files mirna in human Chromosome 1 mirna in bacteria Tools used
More informationActinobacteria Relative abundance (%) Co-housed CD300f WT. CD300f KO. Colon length (cm) Day 9. Microscopic inflammation score
y groups y individuals 9 Actinobacteria Relative abundance (%) acteroidetes Cyanobacteria Deferribacteres Firmicutes Proteobacteria TM Tenericutes Unclassified CDf CDf Co-housed CDf Co-housed CDf CDf CDf
More informationThe combined use of Arabidopsis thaliana and Lepidium sativum to find conserved mechanisms of seed germination within the Brassicaceae family
www.seedbiology.de The combined use of Arabidopsis thaliana and Lepidium sativum to find conserved mechanisms of seed germination within the Brassicaceae family Linkies, A., Müller, K., Morris, K., Gräber,
More informationEnduring understanding 1.A: Change in the genetic makeup of a population over time is evolution.
The AP Biology course is designed to enable you to develop advanced inquiry and reasoning skills, such as designing a plan for collecting data, analyzing data, applying mathematical routines, and connecting
More informationA A A A B B1
LEARNING OBJECTIVES FOR EACH BIG IDEA WITH ASSOCIATED SCIENCE PRACTICES AND ESSENTIAL KNOWLEDGE Learning Objectives will be the target for AP Biology exam questions Learning Objectives Sci Prac Es Knowl
More informationSCOTCAT Credits: 20 SCQF Level 7 Semester 1 Academic year: 2018/ am, Practical classes one per week pm Mon, Tue, or Wed
Biology (BL) modules BL1101 Biology 1 SCOTCAT Credits: 20 SCQF Level 7 Semester 1 10.00 am; Practical classes one per week 2.00-5.00 pm Mon, Tue, or Wed This module is an introduction to molecular and
More informationBIOLOGY Grades Summer Units: 10 high school credits UC Requirement Category: d. General Description:
Summer 2015 Units: 10 high school credits UC Requirement Category: d General Description: BIOLOGY Grades 9-12 Summer session biology will be an intense, fast paced course. Students will gain an understanding
More informationIntroduction to Bioinformatics
CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics
More informationCST and FINAL EXAM REVIEW
Name Date Period CST and FINAL EXAM REVIEW Directions: Both your final exam and the CST (STAR) test are based on the California Standards. There are five major categories and they include: Investigation
More informationSPOTTED cdna MICROARRAYS
SPOTTED cdna MICROARRAYS Spot size: 50um - 150um SPOTTED cdna MICROARRAYS Compare the genetic expression in two samples of cells PRINT cdna from one gene on each spot SAMPLES cdna labelled red/green e.g.
More informationBig Idea 1: The process of evolution drives the diversity and unity of life.
Big Idea 1: The process of evolution drives the diversity and unity of life. understanding 1.A: Change in the genetic makeup of a population over time is evolution. 1.A.1: Natural selection is a major
More informationAP Curriculum Framework with Learning Objectives
Big Ideas Big Idea 1: The process of evolution drives the diversity and unity of life. AP Curriculum Framework with Learning Objectives Understanding 1.A: Change in the genetic makeup of a population over
More informationBi 1x Spring 2014: LacI Titration
Bi 1x Spring 2014: LacI Titration 1 Overview In this experiment, you will measure the effect of various mutated LacI repressor ribosome binding sites in an E. coli cell by measuring the expression of a
More informationChapter 18 Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression Differential gene expression Every somatic cell in an individual organism contains the same genetic information and replicated from the same original fertilized
More informationof 2-Phenoxyethanol in B6D2F1 Mice
Summary of Drinking Water Carcinogenicity Study of 2-Phenoxyethanol in B6D2F1 Mice June 2007 Japan Bioassay Research Center Japan Industrial Safety and Health Association PREFACE The tests were contracted
More informationASSESSING TRANSLATIONAL EFFICIACY THROUGH POLY(A)- TAIL PROFILING AND IN VIVO RNA SECONDARY STRUCTURE DETERMINATION
ASSESSING TRANSLATIONAL EFFICIACY THROUGH POLY(A)- TAIL PROFILING AND IN VIVO RNA SECONDARY STRUCTURE DETERMINATION Journal Club, April 15th 2014 Karl Frontzek, Institute of Neuropathology POLY(A)-TAIL
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/345/ra91/dc1 Supplementary Materials for TGF-β induced epithelial-to-mesenchymal transition proceeds through stepwise activation of multiple feedback loops Jingyu
More information1 of 13 8/11/2014 10:32 AM Units: Teacher: APBiology, CORE Course: APBiology Year: 2012-13 Chemistry of Life Chapters 1-4 Big Idea 1, 2 & 4 Change in the genetic population over time is feedback mechanisms
More informationProteomics. Areas of Interest
Introduction to BioMEMS & Medical Microdevices Proteomics and Protein Microarrays Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationNetwork Biology-part II
Network Biology-part II Jun Zhu, Ph. D. Professor of Genomics and Genetic Sciences Icahn Institute of Genomics and Multi-scale Biology The Tisch Cancer Institute Icahn Medical School at Mount Sinai New
More information16 CONTROL OF GENE EXPRESSION
16 CONTROL OF GENE EXPRESSION Chapter Outline 16.1 REGULATION OF GENE EXPRESSION IN PROKARYOTES The operon is the unit of transcription in prokaryotes The lac operon for lactose metabolism is transcribed
More informationChapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
More informationVariation in the genetic response to high temperature in Montastraea faveolata from the Florida Keys & Mexico
Variation in the genetic response to high temperature in Montastraea faveolata from the Florida Keys & Mexico Nicholas R. Polato 1, Christian R. Voolstra 2, Julia Schnetzer 3, Michael K. DeSalvo 4, Carly
More informationClustering and Network
Clustering and Network Jing-Dong Jackie Han jdhan@picb.ac.cn http://www.picb.ac.cn/~jdhan Copy Right: Jing-Dong Jackie Han What is clustering? A way of grouping together data samples that are similar in
More informationMolecular Developmental Physiology and Signal Transduction
Prof. Dr. J. Vanden Broeck (Animal Physiology and Neurobiology - Dept. of Biology - KU Leuven) Molecular Developmental Physiology and Signal Transduction My Research Team Insect species under study +
More informationChapters AP Biology Objectives. Objectives: You should know...
Objectives: You should know... Notes 1. Scientific evidence supports the idea that evolution has occurred in all species. 2. Scientific evidence supports the idea that evolution continues to occur. 3.
More informationBioconductor Project Working Papers
Bioconductor Project Working Papers Bioconductor Project Year 2004 Paper 6 Error models for microarray intensities Wolfgang Huber Anja von Heydebreck Martin Vingron Department of Molecular Genome Analysis,
More informationPhysiology. Organization of the Body. Assumptions in Physiology. Chapter 1. Physiology is the study of how living organisms function
Introduction to Physiology and Homeostasis Chapter 1 Physiology Physiology is the study of how living organisms function On the street explanations are in terms of meeting a bodily need Physiologic explanations
More informationIntroduction to molecular biology. Mitesh Shrestha
Introduction to molecular biology Mitesh Shrestha Molecular biology: definition Molecular biology is the study of molecular underpinnings of the process of replication, transcription and translation of
More informationRegulation and signaling. Overview. Control of gene expression. Cells need to regulate the amounts of different proteins they express, depending on
Regulation and signaling Overview Cells need to regulate the amounts of different proteins they express, depending on cell development (skin vs liver cell) cell stage environmental conditions (food, temperature,
More informationWhere Do Bat Wings Come From?
Where o at Wings ome From? 1 ats are the only mammals that have evolved the power of flight. They can avoid obstacles and slip through tight spaces. Many species are nocturnal and use echolocation to guide
More informationDynamical Modeling in Biology: a semiotic perspective. Junior Barrera BIOINFO-USP
Dynamical Modeling in Biology: a semiotic perspective Junior Barrera BIOINFO-USP Layout Introduction Dynamical Systems System Families System Identification Genetic networks design Cell Cycle Modeling
More informationIdentifying Signaling Pathways
These slides, excluding third-party material, are licensed under CC BY-NC 4.0 by Anthony Gitter, Mark Craven, Colin Dewey Identifying Signaling Pathways BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018
More information1. Draw, label and describe the structure of DNA and RNA including bonding mechanisms.
Practicing Biology BIG IDEA 3.A 1. Draw, label and describe the structure of DNA and RNA including bonding mechanisms. 2. Using at least 2 well-known experiments, describe which features of DNA and RNA
More informationGenetic controls of apple fruit-specific auxin metabolism. PI: Yanmin Zhu Co-PI(2): James Mattheis
FINAL PROJECT REPORT Project Title: Genetic controls of apple fruit-specific auxin metabolism PI: Yanmin Zhu Co-PI(2): James Mattheis Organization: TFRL-ARS-USDA Organization: TFRL-ARS-USDA Telephone:
More informationSupplementary Figure 1: Mechanism of Lbx2 action on the Wnt/ -catenin signalling pathway. (a) The Wnt/ -catenin signalling pathway and its
Supplementary Figure 1: Mechanism of Lbx2 action on the Wnt/ -catenin signalling pathway. (a) The Wnt/ -catenin signalling pathway and its transcriptional activity in wild-type embryo. A gradient of canonical
More informationExample 1: Two-Treatment CRD
Introduction to Mixed Linear Models in Microarray Experiments //0 Copyright 0 Dan Nettleton Statistical Models A statistical model describes a formal mathematical data generation mechanism from which an
More informationDevelopmental genetics: finding the genes that regulate development
Developmental Biology BY1101 P. Murphy Lecture 9 Developmental genetics: finding the genes that regulate development Introduction The application of genetic analysis and DNA technology to the study of
More informationCHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON
PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter
More informationInferring Transcriptional Regulatory Networks from Gene Expression Data II
Inferring Transcriptional Regulatory Networks from Gene Expression Data II Lectures 9 Oct 26, 2011 CSE 527 Computational Biology, Fall 2011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday
More informationIntroduction Biology before Systems Biology: Reductionism Reduce the study from the whole organism to inner most details like protein or the DNA.
Systems Biology-Models and Approaches Introduction Biology before Systems Biology: Reductionism Reduce the study from the whole organism to inner most details like protein or the DNA. Taxonomy Study external
More informationSupplementary information
Supplementary information October 27, 23 Contents Supplementary Figures 3 2 Supplementary Tables 9 3 Supplementary Methods and Results 3. Modeling Ago loading following sirna micro-injection........................
More informationD.C.H.S BIOLOGY DEPARTMENT
D.C.H.S BIOLOGY DEPARTMENT NAT 5 Homework Booklet Unit 2 Multicellular Organisms 1 HOMEWORK 1- Cells, Tissues and Organs 1. (a) Multicellular organisms are composed of different types of cells which are
More informationReview. MicroRNAs: Target Recognition and Regulatory Functions. Leading Edge
Leading Edge Review MicroRNAs: Target Recognition and Regulatory Functions David P. Bartel 1,2,3, * 1 Howard Hughes Medical Institute 2 Department of Biology, Massachusetts Institute of Technology, Cambridge,
More informationRANK. Alternative names. Discovery. Structure. William J. Boyle* SUMMARY BACKGROUND
RANK William J. Boyle* Department of Cell Biology, Amgen, Inc., One Amgen Center Drive, Thousand Oaks, CA 91320-1799, USA * corresponding author tel: 805-447-4304, fax: 805-447-1982, e-mail: bboyle@amgen.com
More informationBiology I Level - 2nd Semester Final Review
Biology I Level - 2nd Semester Final Review The 2 nd Semester Final encompasses all material that was discussed during second semester. It s important that you review ALL notes and worksheets from the
More informationCAPE Biology Unit 1 Scheme of Work
CAPE Biology Unit 1 Scheme of Work 2011-2012 Term 1 DATE SYLLABUS OBJECTIVES TEXT PAGES ASSIGNMENTS COMMENTS Orientation Introduction to CAPE Biology syllabus content and structure of the exam Week 05-09
More informationInferring Transcriptional Regulatory Networks from High-throughput Data
Inferring Transcriptional Regulatory Networks from High-throughput Data Lectures 9 Oct 26, 2011 CSE 527 Computational Biology, Fall 2011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday 12:00-1:20
More informationReading Assignments. A. Genes and the Synthesis of Polypeptides. Lecture Series 7 From DNA to Protein: Genotype to Phenotype
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
More information