Network Biology-part II
|
|
- Gillian Grant
- 5 years ago
- Views:
Transcription
1 Network Biology-part II Jun Zhu, Ph. D. Professor of Genomics and Genetic Sciences Icahn Institute of Genomics and Multi-scale Biology The Tisch Cancer Institute Icahn Medical School at Mount Sinai New York, NY
2 Why it is so hard to model biological systems? The more we learn, the more complicated it becomes! Epigenetic regulation : heritable changes in gene function that cannot be explained by changes in DNA sequence DNA methylation Chromotin structure Junk DNA? Post transcriptional regulation Splicing (1981) RNA editing (1986) mirna mediated regulation (1993) It is not one gene to one protein anymore! Post translational regulation Phosphorylation Glycosaltion acetylation
3 How to model biological systems: Types of Network models time-dependent networks discrete, continuous Differential equations Prediction vs explanation Phenomenologically predictive networks correlation based, dependency nets, Explanatory pictorial Deterministic vs. Stochastic (probabilistic) Concentration vs. Bayesian nets for up/down/nc
4 Biological networks/pathways Observation-> description-> explanation-> prediction Data required to train models Gene sets Association networks Probabilistic causal networks Mechanism based models Biological details revealed
5 Theory of network biology: how biological processes are regulated? Observation-> description-> explanation-> prediction Transcription factor Multiple genes
6 Micorarray: revolutionized the way we query a biological system 1995: Patrick Brown reported a proof of concept study
7 Microarray: two channel system vs one channel system Short term cost, long tem cost, accuracy
8 Microarray: what are the assumptions and limitations? Late 1990s, many EST libraries were sequenced and human and mouse genomes were closed to finished; Assuming all gene transcripts were known; Assuming all gene isoforms were known; There were no SNPs within probes Outdated and will be replaced by RNAseq mrnas (isoforms, allele specific expression ) mirnas Long non-coding RNAs
9 Gene set enrichment analysis Transcription factor Multiple genes
10 Gene set enrichment Fisher s exact Test hypergeometric distribution cdf Foreground k x Observed Signature N p F( x 1 M, K, N ) x 1 i 0 K M K i N i M N background M Problem: have to define a cutoff
11 Gene set enrichment: a non-parametric test Kolmogorov-Smirnov test: Order genes by fold changes or p-value Test whether genes involved in a Pathway are randomly distributed. pathway background Observed pathway
12 Gene set enrichment Analysis (GSEA) Difference from Kolmogorov-Smirnov test: using weighted sum Subramanian et al, PNAS, 2005
13 Gene set enrichment analysis What are assumptions and limitations? Can only analyze known pathways Don t know how genes involved in a pathway are regulated What are direction interactions and secondary interactions? Don t know how multiple pathways interact with each other if multiple pathways involve. Transcription factor Multiple genes
14 Biological networks/pathways Observation-> description-> explanation-> prediction Data required to train models Gene sets Association networks Probabilistic causal networks Mechanism based models Biological details revealed
15 How to define association? Association of two genes is context dependent protein-protein interaction by Y2H experiments co-cited in literature Protein-DNA interaction: ChIP-on-chip, ChIPseq correlation of mrna expression levels
16 Yeast-2-hybrid system Gene fusion Gene fusion reporter gene Limitations: High false positive and negative Only for soluble proteins not in a physiological condition Lodish, et al., Molecular Cell Biology
17 Protein-protein interaction networks Stelzl et al, Cell, 2005 Genes in a pathway interact with each other; discover new members in the pathway
18 Are all genes equally important? Degree distribution: how many connections a gene has? the majority of genes connect with a small number of genes, while a smaller number of genes connect to a large number of genes? Scale-free: Log-log linear p ( k) ~ k log( p( k)) ~ *log( k) Clustering coefficient: CC p k p 2n ( k 1) p
19 Different types of Complex Networks Degree distribution Clustering coefficient Barabasi and Oltvai, 2004
20 Protein-DNA interaction: chromatin immunoprecipitation (ChIP): To find transcription factor binding targets
21 Association by gene expression correlation How strong the correlation of mrna expression levels should be? the p-value cutoff for correlation Assuming two expression levels are independent FDR (False Discover Rate) by permutation No explicit assumption Data set specific FDR total false positives positives detected
22 Selecting threshold for Gene-Gene Correlation (GGC) of 25,000 genes on a microarray chip p-value < total positive false positive FDR (from data) (from permuted data) 1e e-5 1e e-6 1e e-6 At p value <1e-20, there are only 38 false positives so that no module was detected for the permuted data Pvalue<1e-20 was chosen as threshold
23 Association by gene expression correlation Can two expression levels correlate because they both correlate to noise? Guilt by association is noise prone Stuart et al Two gene expression levels correlate because they respond to common perturbation F2 intercross setting QTL overlap
24 Scale-free property is robust
25 Genetics filter makes the network closer to scale-free Chen*, Zhu*, et al. Nature, 2008
26 Genetics: eqtl overlapping enhances correlation signals Problem: a cutoff threshold is needed Chen Y*, Zhu J* et al. Nature 452: (2008)
27
28
29 Causality vs. association Smoking and disease risks
30 Causality vs. association Fat dogs and fat masters Stephen Friend
31 Biological networks/pathways Observation-> description-> explanation-> prediction Data required to train models Gene sets Association networks Probabilistic causal networks Mechanism based models Biological details revealed
32 A simple biological question: are there causal/reactive relationships?
33 A Bayesian network approach: Best model
34 Biological networks/pathways Observation-> description-> explanation-> prediction Data required to train models Gene sets Association networks Probabilistic causal networks Mechanism based models Biological details revealed
35 Differential equations explain why different dg dt dc dt correlations can be observed n g n n c g c v( g, c) u( g, c) Chen*, Zhu*, et al Nature (2008)
36 Model a signaling pathway
37 Aknowledgements Zhu lab Seungyeul Yoo Eunjee Lee Li Wang Luan Lin Quan Long Supported by: Mount Sinai Genomics Institute Eric Schadt Bin Zhang Zhidong Tu Charles Powell Patrizia Casaccia Boston University Avrum Spira Joshua Campbell U Washington Roger Baumgarner Berkerley Rachel Brem Princeton Lenoid Kruglyak Icahn Institute of Genomics and Multiscale Biology, Icahn School of Medicine at Mount Sinai Janssen Canary Foundation Prostate Cancer Foundation NIH NCI
Introduction to Bioinformatics
CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics
More informationChapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
More informationIntegrative causal networks for understanding complex human diseases
Integrative causal networks for understanding complex human diseases Jun Zhu, Ph. D. Professor of Genomics and Genetic Sciences Icahn Institute of Genomics and Multi-scale Biology The Tisch Cancer Institute
More informationComputational Genomics. Systems biology. Putting it together: Data integration using graphical models
02-710 Computational Genomics Systems biology Putting it together: Data integration using graphical models High throughput data So far in this class we discussed several different types of high throughput
More informationComplete all warm up questions Focus on operon functioning we will be creating operon models on Monday
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA
More informationPredicting Protein Functions and Domain Interactions from Protein Interactions
Predicting Protein Functions and Domain Interactions from Protein Interactions Fengzhu Sun, PhD Center for Computational and Experimental Genomics University of Southern California Outline High-throughput
More informationClustering and Network
Clustering and Network Jing-Dong Jackie Han jdhan@picb.ac.cn http://www.picb.ac.cn/~jdhan Copy Right: Jing-Dong Jackie Han What is clustering? A way of grouping together data samples that are similar in
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationCausal Discovery by Computer
Causal Discovery by Computer Clark Glymour Carnegie Mellon University 1 Outline 1. A century of mistakes about causation and discovery: 1. Fisher 2. Yule 3. Spearman/Thurstone 2. Search for causes is statistical
More informationExpression QTLs and Mapping of Complex Trait Loci. Paul Schliekelman Statistics Department University of Georgia
Expression QTLs and Mapping of Complex Trait Loci Paul Schliekelman Statistics Department University of Georgia Definitions: Genes, Loci and Alleles A gene codes for a protein. Proteins due everything.
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
More informationLatent Variable models for GWAs
Latent Variable models for GWAs Oliver Stegle Machine Learning and Computational Biology Research Group Max-Planck-Institutes Tübingen, Germany September 2011 O. Stegle Latent variable models for GWAs
More informationRelated Courses He who asks is a fool for five minutes, but he who does not ask remains a fool forever.
CSE 527 Computational Biology http://www.cs.washington.edu/527 Lecture 1: Overview & Bio Review Autumn 2004 Larry Ruzzo Related Courses He who asks is a fool for five minutes, but he who does not ask remains
More informationResearch Article Sample Size Calculation for Controlling False Discovery Proportion
Probability and Statistics Volume 2012, Article ID 817948, 13 pages doi:10.1155/2012/817948 Research Article Sample Size Calculation for Controlling False Discovery Proportion Shulian Shang, 1 Qianhe Zhou,
More informationDiscovering Correlation in Data. Vinh Nguyen Research Fellow in Data Science Computing and Information Systems DMD 7.
Discovering Correlation in Data Vinh Nguyen (vinh.nguyen@unimelb.edu.au) Research Fellow in Data Science Computing and Information Systems DMD 7.14 Discovering Correlation Why is correlation important?
More informationMeasuring TF-DNA interactions
Measuring TF-DNA interactions How is Biological Complexity Achieved? Mediated by Transcription Factors (TFs) 2 Regulation of Gene Expression by Transcription Factors TF trans-acting factors TF TF TF TF
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More information10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison
10-810: Advanced Algorithms and Models for Computational Biology microrna and Whole Genome Comparison Central Dogma: 90s Transcription factors DNA transcription mrna translation Proteins Central Dogma:
More informationMathematics, Genomics, and Cancer
School of Informatics IUB April 6, 2009 Outline Introduction Class Comparison Class Discovery Class Prediction Example Biological states and state modulation Software Tools Research directions Math & Biology
More informationInferring Transcriptional Regulatory Networks from High-throughput Data
Inferring Transcriptional Regulatory Networks from High-throughput Data Lectures 9 Oct 26, 2011 CSE 527 Computational Biology, Fall 2011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday 12:00-1:20
More informationCausal Graphical Models in Systems Genetics
1 Causal Graphical Models in Systems Genetics 2013 Network Analysis Short Course - UCLA Human Genetics Elias Chaibub Neto and Brian S Yandell July 17, 2013 Motivation and basic concepts 2 3 Motivation
More informationnetworks in molecular biology Wolfgang Huber
networks in molecular biology Wolfgang Huber networks in molecular biology Regulatory networks: components = gene products interactions = regulation of transcription, translation, phosphorylation... Metabolic
More informationInferring Transcriptional Regulatory Networks from Gene Expression Data II
Inferring Transcriptional Regulatory Networks from Gene Expression Data II Lectures 9 Oct 26, 2011 CSE 527 Computational Biology, Fall 2011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday
More informationProteomics. Areas of Interest
Introduction to BioMEMS & Medical Microdevices Proteomics and Protein Microarrays Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationSystems biology and biological networks
Systems Biology Workshop Systems biology and biological networks Center for Biological Sequence Analysis Networks in electronics Radio kindly provided by Lazebnik, Cancer Cell, 2002 Systems Biology Workshop,
More informationInferring Genetic Architecture of Complex Biological Processes
Inferring Genetic Architecture of Complex Biological Processes BioPharmaceutical Technology Center Institute (BTCI) Brian S. Yandell University of Wisconsin-Madison http://www.stat.wisc.edu/~yandell/statgen
More informationDiscovering MultipleLevels of Regulatory Networks
Discovering MultipleLevels of Regulatory Networks IAS EXTENDED WORKSHOP ON GENOMES, CELLS, AND MATHEMATICS Hong Kong, July 25, 2018 Gary D. Stormo Department of Genetics Outline of the talk 1. Transcriptional
More informationTypes of biological networks. I. Intra-cellurar networks
Types of biological networks I. Intra-cellurar networks 1 Some intra-cellular networks: 1. Metabolic networks 2. Transcriptional regulation networks 3. Cell signalling networks 4. Protein-protein interaction
More informationRegulation of gene expression. Premedical - Biology
Regulation of gene expression Premedical - Biology Regulation of gene expression in prokaryotic cell Operon units system of negative feedback positive and negative regulation in eukaryotic cell - at any
More informationComputational Systems Biology
Computational Systems Biology Vasant Honavar Artificial Intelligence Research Laboratory Bioinformatics and Computational Biology Graduate Program Center for Computational Intelligence, Learning, & Discovery
More informationLecture Notes for Fall Network Modeling. Ernest Fraenkel
Lecture Notes for 20.320 Fall 2012 Network Modeling Ernest Fraenkel In this lecture we will explore ways in which network models can help us to understand better biological data. We will explore how networks
More informationProteomics. Yeast two hybrid. Proteomics - PAGE techniques. Data obtained. What is it?
Proteomics What is it? Reveal protein interactions Protein profiling in a sample Yeast two hybrid screening High throughput 2D PAGE Automatic analysis of 2D Page Yeast two hybrid Use two mating strains
More informationLesson 11. Functional Genomics I: Microarray Analysis
Lesson 11 Functional Genomics I: Microarray Analysis Transcription of DNA and translation of RNA vary with biological conditions 3 kinds of microarray platforms Spotted Array - 2 color - Pat Brown (Stanford)
More informationWritten Exam 15 December Course name: Introduction to Systems Biology Course no
Technical University of Denmark Written Exam 15 December 2008 Course name: Introduction to Systems Biology Course no. 27041 Aids allowed: Open book exam Provide your answers and calculations on separate
More informationGLOBEX Bioinformatics (Summer 2015) Genetic networks and gene expression data
GLOBEX Bioinformatics (Summer 2015) Genetic networks and gene expression data 1 Gene Networks Definition: A gene network is a set of molecular components, such as genes and proteins, and interactions between
More informationBioControl - Week 6, Lecture 1
BioControl - Week 6, Lecture 1 Goals of this lecture Large metabolic networks organization Design principles for small genetic modules - Rules based on gene demand - Rules based on error minimization Suggested
More information6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008
MIT OpenCourseWare http://ocw.mit.edu 6.047 / 6.878 Computational Biology: Genomes, Networks, Evolution Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
More informationProteomics Systems Biology
Dr. Sanjeeva Srivastava IIT Bombay Proteomics Systems Biology IIT Bombay 2 1 DNA Genomics RNA Transcriptomics Global Cellular Protein Proteomics Global Cellular Metabolite Metabolomics Global Cellular
More informationLesson Overview. Gene Regulation and Expression. Lesson Overview Gene Regulation and Expression
13.4 Gene Regulation and Expression THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium
More informationThematic review series: Systems Biology Approaches to Metabolic and Cardiovascular Disorders
thematic review Thematic review series: Systems Biology Approaches to Metabolic and Cardiovascular Disorders Reverse engineering gene networks to identify key drivers of complex disease phenotypes Eric
More informationBias in RNA sequencing and what to do about it
Bias in RNA sequencing and what to do about it Walter L. (Larry) Ruzzo Computer Science and Engineering Genome Sciences University of Washington Fred Hutchinson Cancer Research Center Seattle, WA, USA
More informationComparative Network Analysis
Comparative Network Analysis BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2016 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under CC BY-NC 4.0 by
More informationGSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H*" ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION
FIFTH EDITION IV I ^HHk ^ttm IZTI/^Q i I II MPHBBMWBBIHB '-llwmpbi^hbwm^^pfc ' GSBHSRSBRSRRk LlML I I \l 1MB ^HP'^^MMMP" jflp^^^^^^^^st I Iv^O FROM GENES TO GENOMES %^MiM^PM^^MWi99Mi$9i0^^ ^^^^^^^^^^^^^V^^^fii^^t^i^^^^^
More informationComputational methods for predicting protein-protein interactions
Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational
More informationGene Autoregulation via Intronic micrornas and its Functions
Gene Autoregulation via Intronic micrornas and its Functions Carla Bosia Department of Theoretical Physics University of Torino and INFN, Italy cbosia@to.infn.it Annecy-le-Vieux 20-22/10/2010 OUTLINE microrna
More informationMultiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
More informationBioinformatics 2. Yeast two hybrid. Proteomics. Proteomics
GENOME Bioinformatics 2 Proteomics protein-gene PROTEOME protein-protein METABOLISM Slide from http://www.nd.edu/~networks/ Citrate Cycle Bio-chemical reactions What is it? Proteomics Reveal protein Protein
More informationWelcome to Class 21!
Welcome to Class 21! Introductory Biochemistry! Lecture 21: Outline and Objectives l Regulation of Gene Expression in Prokaryotes! l transcriptional regulation! l principles! l lac operon! l trp attenuation!
More informationBTRY 7210: Topics in Quantitative Genomics and Genetics
BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu February 12, 2015 Lecture 3:
More informationUnderstanding Science Through the Lens of Computation. Richard M. Karp Nov. 3, 2007
Understanding Science Through the Lens of Computation Richard M. Karp Nov. 3, 2007 The Computational Lens Exposes the computational nature of natural processes and provides a language for their description.
More informationBiological Networks. Gavin Conant 163B ASRC
Biological Networks Gavin Conant 163B ASRC conantg@missouri.edu 882-2931 Types of Network Regulatory Protein-interaction Metabolic Signaling Co-expressing General principle Relationship between genes Gene/protein/enzyme
More informationCONJOINT 541. Translating a Transcriptome at Specific Times and Places. David Morris. Department of Biochemistry
CONJOINT 541 Translating a Transcriptome at Specific Times and Places David Morris Department of Biochemistry http://faculty.washington.edu/dmorris/ Lecture 1 The Biology and Experimental Analysis of mrna
More informationProteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering
Proteomics 2 nd semester, 2013 1 Text book Principles of Proteomics by R. M. Twyman, BIOS Scientific Publications Other Reference books 1) Proteomics by C. David O Connor and B. David Hames, Scion Publishing
More information13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
More information27: Case study with popular GM III. 1 Introduction: Gene association mapping for complex diseases 1
10-708: Probabilistic Graphical Models, Spring 2015 27: Case study with popular GM III Lecturer: Eric P. Xing Scribes: Hyun Ah Song & Elizabeth Silver 1 Introduction: Gene association mapping for complex
More informationIntroduction to Bioinformatics. Shifra Ben-Dor Irit Orr
Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A
More informationLearning in Bayesian Networks
Learning in Bayesian Networks Florian Markowetz Max-Planck-Institute for Molecular Genetics Computational Molecular Biology Berlin Berlin: 20.06.2002 1 Overview 1. Bayesian Networks Stochastic Networks
More informationEvidence for dynamically organized modularity in the yeast protein-protein interaction network
Evidence for dynamically organized modularity in the yeast protein-protein interaction network Sari Bombino Helsinki 27.3.2007 UNIVERSITY OF HELSINKI Department of Computer Science Seminar on Computational
More informationL3.1: Circuits: Introduction to Transcription Networks. Cellular Design Principles Prof. Jenna Rickus
L3.1: Circuits: Introduction to Transcription Networks Cellular Design Principles Prof. Jenna Rickus In this lecture Cognitive problem of the Cell Introduce transcription networks Key processing network
More informationComputational Biology From The Perspective Of A Physical Scientist
Computational Biology From The Perspective Of A Physical Scientist Dr. Arthur Dong PP1@TUM 26 November 2013 Bioinformatics Education Curriculum Math, Physics, Computer Science (Statistics and Programming)
More informationIntroduction Biology before Systems Biology: Reductionism Reduce the study from the whole organism to inner most details like protein or the DNA.
Systems Biology-Models and Approaches Introduction Biology before Systems Biology: Reductionism Reduce the study from the whole organism to inner most details like protein or the DNA. Taxonomy Study external
More informationGCD3033:Cell Biology. Transcription
Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors
More informationHonors Biology Reading Guide Chapter 11
Honors Biology Reading Guide Chapter 11 v Promoter a specific nucleotide sequence in DNA located near the start of a gene that is the binding site for RNA polymerase and the place where transcription begins
More informationDNA. Recombinant DNA Technology. (Gene deletion, replacement, site directed mutagenesis) (Genetically modified organisms)
Recombinant Technology PCR PCR PCR (Gene deletion, replacement, site directed mutagenesis) (Genetically modified organisms) 1- T. Primrose and J. Old, Principle of Gene Manipulation. Blackwell sciences
More informationControl of Gene Expression
Control of Gene Expression Mechanisms of Gene Control Gene Control in Eukaryotes Master Genes Gene Control In Prokaryotes Epigenetics Gene Expression The overall process by which information flows from
More informationGene Expression as a Stochastic Process: From Gene Number Distributions to Protein Statistics and Back
Gene Expression as a Stochastic Process: From Gene Number Distributions to Protein Statistics and Back June 19, 2007 Motivation & Basics A Stochastic Approach to Gene Expression Application to Experimental
More informationSelf Similar (Scale Free, Power Law) Networks (I)
Self Similar (Scale Free, Power Law) Networks (I) E6083: lecture 4 Prof. Predrag R. Jelenković Dept. of Electrical Engineering Columbia University, NY 10027, USA {predrag}@ee.columbia.edu February 7, 2007
More informationHairpin Database: Why and How?
Hairpin Database: Why and How? Clark Jeffries Research Professor Renaissance Computing Institute and School of Pharmacy University of North Carolina at Chapel Hill, United States Why should a database
More informationREVIEW SESSION. Wednesday, September 15 5:30 PM SHANTZ 242 E
REVIEW SESSION Wednesday, September 15 5:30 PM SHANTZ 242 E Gene Regulation Gene Regulation Gene expression can be turned on, turned off, turned up or turned down! For example, as test time approaches,
More informationCoding sequence array Office hours Wednesday 3-4pm 304A Stanley Hall
Coding sequence array Office hours Wednesday 3-4pm 304A Stanley Hall Review session 5pm Thursday, Dec. 11 GPB100 Fig. 1.13 RNA-seq Expression effects of cancer AAAAA AAAAA AAAAA Solexa sequencing counts
More informationCausal Model Selection Hypothesis Tests in Systems Genetics
1 Causal Model Selection Hypothesis Tests in Systems Genetics Elias Chaibub Neto and Brian S Yandell SISG 2012 July 13, 2012 2 Correlation and Causation The old view of cause and effect... could only fail;
More informationIntrinsic Noise in Nonlinear Gene Regulation Inference
Intrinsic Noise in Nonlinear Gene Regulation Inference Chao Du Department of Statistics, University of Virginia Joint Work with Wing H. Wong, Department of Statistics, Stanford University Transcription
More informationFuzzy Clustering of Gene Expression Data
Fuzzy Clustering of Gene Data Matthias E. Futschik and Nikola K. Kasabov Department of Information Science, University of Otago P.O. Box 56, Dunedin, New Zealand email: mfutschik@infoscience.otago.ac.nz,
More informationGene Regulation and Expression
THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium that contains more than 4000 genes.
More informationRegulation of gene Expression in Prokaryotes & Eukaryotes
Regulation of gene Expression in Prokaryotes & Eukaryotes 1 The trp Operon Contains 5 genes coding for proteins (enzymes) required for the synthesis of the amino acid tryptophan. Also contains a promoter
More informationMatteo Figliuzzi
Supervisors: Prof. Andrea De Martino, Prof. Enzo Marinari Dottorato in sica, XXVI ciclo (N,1) model (N,M) model 25-10-2013 Systems Biology & Networks (N,1) model (N,M) model Arabidopsis regulatory network
More information#33 - Genomics 11/09/07
BCB 444/544 Required Reading (before lecture) Lecture 33 Mon Nov 5 - Lecture 31 Phylogenetics Parsimony and ML Chp 11 - pp 142 169 Genomics Wed Nov 7 - Lecture 32 Machine Learning Fri Nov 9 - Lecture 33
More information1.1. KEY CONCEPT Biologists study life in all its forms. 4 Reinforcement Unit 1 Resource Book. Biology in the 21st Century CHAPTER 1
1.1 THE STUDY OF LIFE KEY CONCEPT Biologists study life in all its forms. Biology is the scientific study of all forms of life. Living things are found almost everywhere on Earth, from very hot environments
More informationZhiguang Huo 1, Chi Song 2, George Tseng 3. July 30, 2018
Bayesian latent hierarchical model for transcriptomic meta-analysis to detect biomarkers with clustered meta-patterns of differential expression signals BayesMP Zhiguang Huo 1, Chi Song 2, George Tseng
More informationThe geneticist s questions. Deleting yeast genes. Functional genomics. From Wikipedia, the free encyclopedia
From Wikipedia, the free encyclopedia Functional genomics..is a field of molecular biology that attempts to make use of the vast wealth of data produced by genomic projects (such as genome sequencing projects)
More informationIntroduction. Gene expression is the combined process of :
1 To know and explain: Regulation of Bacterial Gene Expression Constitutive ( house keeping) vs. Controllable genes OPERON structure and its role in gene regulation Regulation of Eukaryotic Gene Expression
More informationBMD645. Integration of Omics
BMD645 Integration of Omics Shu-Jen Chen, Chang Gung University Dec. 11, 2009 1 Traditional Biology vs. Systems Biology Traditional biology : Single genes or proteins Systems biology: Simultaneously study
More informationBi 1x Spring 2014: LacI Titration
Bi 1x Spring 2014: LacI Titration 1 Overview In this experiment, you will measure the effect of various mutated LacI repressor ribosome binding sites in an E. coli cell by measuring the expression of a
More informationComputational Genomics. Reconstructing dynamic regulatory networks in multiple species
02-710 Computational Genomics Reconstructing dynamic regulatory networks in multiple species Methods for reconstructing networks in cells CRH1 SLT2 SLR3 YPS3 YPS1 Amit et al Science 2009 Pe er et al Recomb
More informationProkaryotic Regulation
Prokaryotic Regulation Control of transcription initiation can be: Positive control increases transcription when activators bind DNA Negative control reduces transcription when repressors bind to DNA regulatory
More informationIntroduction to clustering methods for gene expression data analysis
Introduction to clustering methods for gene expression data analysis Giorgio Valentini e-mail: valentini@dsi.unimi.it Outline Levels of analysis of DNA microarray data Clustering methods for functional
More informationBig Idea 3: Living systems store, retrieve, transmit, and respond to information essential to life processes.
Big Idea 3: Living systems store, retrieve, transmit, and respond to information essential to life processes. Enduring understanding 3.A: Heritable information provides for continuity of life. Essential
More informationProkaryotic Gene Expression (Learning Objectives)
Prokaryotic Gene Expression (Learning Objectives) 1. Learn how bacteria respond to changes of metabolites in their environment: short-term and longer-term. 2. Compare and contrast transcriptional control
More information2. Mathematical descriptions. (i) the master equation (ii) Langevin theory. 3. Single cell measurements
1. Why stochastic?. Mathematical descriptions (i) the master equation (ii) Langevin theory 3. Single cell measurements 4. Consequences Any chemical reaction is stochastic. k P d φ dp dt = k d P deterministic
More informationSUPPLEMENTARY INFORMATION
Supplementary Discussion Rationale for using maternal ythdf2 -/- mutants as study subject To study the genetic basis of the embryonic developmental delay that we observed, we crossed fish with different
More informationGene Regula*on, ChIP- X and DNA Mo*fs. Statistics in Genomics Hongkai Ji
Gene Regula*on, ChIP- X and DNA Mo*fs Statistics in Genomics Hongkai Ji (hji@jhsph.edu) Genetic information is stored in DNA TCAGTTGGAGCTGCTCCCCCACGGCCTCTCCTCACATTCCACGTCCTGTAGCTCTATGACCTCCACCTTTGAGTCCCTCCTC
More informationDifferential Modeling for Cancer Microarray Data
Differential Modeling for Cancer Microarray Data Omar Odibat Department of Computer Science Feb, 01, 2011 1 Outline Introduction Cancer Microarray data Problem Definition Differential analysis Existing
More informationPrinciples of Genetics
Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics
More informationrobustness: revisting the significance of mirna-mediated regulation
: revisting the significance of mirna-mediated regulation Hervé Seitz IGH (CNRS), Montpellier, France October 13, 2012 microrna target identification .. microrna target identification mir: target: 2 7
More informationGeert Geeven. April 14, 2010
iction of Gene Regulatory Interactions NDNS+ Workshop April 14, 2010 Today s talk - Outline Outline Biological Background Construction of Predictors The main aim of my project is to better understand the
More informationIntroduction to clustering methods for gene expression data analysis
Introduction to clustering methods for gene expression data analysis Giorgio Valentini e-mail: valentini@dsi.unimi.it Outline Levels of analysis of DNA microarray data Clustering methods for functional
More informationEvolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites
Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites Paper by: James P. Balhoff and Gregory A. Wray Presentation by: Stephanie Lucas Reviewed
More informationGene Control Mechanisms at Transcription and Translation Levels
Gene Control Mechanisms at Transcription and Translation Levels Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 9
More informationGoing Beyond SNPs with Next Genera5on Sequencing Technology Personalized Medicine: Understanding Your Own Genome Fall 2014
Going Beyond SNPs with Next Genera5on Sequencing Technology 02-223 Personalized Medicine: Understanding Your Own Genome Fall 2014 Next Genera5on Sequencing Technology (NGS) NGS technology Discover more
More informationMIP543 RNA Biology Fall 2015
MIP543 RNA Biology Fall 2015 Credits: 3 Term Offered: Day and Time: Fall (odd years) Mondays and Wednesdays, 4:00-5:15 pm Classroom: MRB 123 Course Instructor: Dr. Jeffrey Wilusz, Professor, MIP Office:
More information