microrna Studies Chen-Hanson Ting SVFIG June 23, 2018
|
|
|
- Barnaby Pitts
- 5 years ago
- Views:
Transcription
1 microrna Studies Chen-Hanson Ting SVFIG June 23, 2018
2 Summary MicroRNA (mirna) Species and organisms studied mirna in mitocondria Huge genome files mirna in human Chromosome 1 mirna in bacteria Tools used
3 MicroRNA MicroRNA (mirna) are small RNA molecule (~22 nucleotides) found in plants, animals and some viruses, that functions in RNA silencing and post-transcriptional regulation of gene expression.
4 MicroRNA mirbase Database 48,885 mirna s 27,790 unique mirna s 5312 human mirna s
5 Species and Organisms Mitochondrion (human) Nasuia (Nasuia deltocephalinicola) Ruddii (Candidatus Carsonella ruddii) Mgen (Mycoplasma genitalium) Ecoli (Escherichia coli) Nematode (Caenorhabditis elegans) Mouse (Mus musculus) Human (Homo sapiens)
6 Species and Organisms
7 mirna in Mitochondrion Mitochondrion is an independent organism supplying energy to cells. Cell controls mitochondrion by sending mirna to it. There must be sites in mitochondrion genome to receive mirna signal.
8 mirna in Human Mitochondrion Location mirna Bases 624 hsa-mir-4284 GGGCTCACATCACCCCAT 2538 hsa-mir p ACCGCCTGCCCAGTGA 2562 hsa-mir p TAACGGCCGCGGTACCCTAA 2581 hsa-mir-1973 ACCGTGCAAAGGTAGCATA 5747 ppy-mir-4484 AAAAAGGCGGGAGAAGCCCCG
9 mirna in All Mitochondria Many mirnas appear in human mitochondrion. mirnas generally appear in mitochondria of all species. They must serve important (yet to be found) functions in mitochondria.
10 mirna in All Mitochondria mirna Freq mirna Name Code Sequence M cgr-mir-1973 Cricetulus griseus TGACCGTGCAAAGGTAGC M ppy-mir-4484 Pongo pygmaeus AAAAAGGCGGGAGAAGCCCCG L hsa-mir-1973 Homo sapiens TATGCTACCTTTGCACGGT L hsa-mir-4463 Homo sapiens GGCCCCACCCCAGTCTC M mmu-mir-6481 Mus musculus CACTGAAAATGCTTAGATG M hsa-mir-1973 Homo sapiens ACCGTGCAAAGGTAGCATA M hsa-mir p Homo sapiens ACCGCCTGCCCAGTGA L rgl-mir5141 Rehmannia glutinosa TTATCTGTCAGTCGCGTCGGGTCT M osa-mir5539a Oryza sativa AAGAAAACGGATGCGCGTGCTA M hsa-mir p Homo sapiens TAACGGCCGCGGTACCCTAA L gma-mir4995 Glycine max CCCTTAACCAAGCCACTGCCT M rgl-mir5141 Rehmannia glutinosa AGACCCGACGCGACTGACAGATAA L osa-mir5539a Oryza sativa TAGCACGCGCATCCGTTTTCTT M gma-mir4995 Glycine max AGGCAGTGGCTTGGTTAAGGG M osa-mir5538 Oryza sativa ACTGAACTCAATCACTTGCTGC L osa-mir5538 Oryza sativa GCAGCAAGTGATTGAGTTCAGT L cgr-mir-1973 Cricetulus griseus GCTACCTTTGCACGGTCA M mmu-mir-466i-5p Mus musculus TGTGTGTGTGTGTGTGTGTG L pla-mir11602 Paeonia lactiflora GATCCAATAGCGTTCCGTTAGA L hbr-mir6173 Hevea brasiliensis AGTATCCATCGTTTACGGC
11 Huge Genome Files Human genome is 3.2 Gb long. Mouse genome is 2.7 Gb long. I had the privilege to traverse both, looking for micrornas in them.
12 Huge Genome Files A typical genome file, of human Chromosome 1, is 233 Mb long mirnas are found in Chromosome 1. Prevailing mirnas are identified.
13 mirna in Chromosome 1 Two mirnas appear most frequently in Chromosome 1, similarly in other chromosomes: mir 916-5p and mir 466i-5p. They look like the prevailing CALL and RET instructions in a real computer.
14 mirna in Human Chromosome 1
15 No mirna in Bacteria No mirna was found in single cell bacteria like ruddii, nasuia, and ecoli. If it is true, my hypothesis of cell computers based on mirnas as tokens would fail.
16 20-b Patterns in Bacterial Genomes There are 156 recurring 20 base patterns in nasuia genome. There are 498 recurring 20 base patterns in ruddii genome.
17 Tools Used F# eforth under Windows 7 Microsoft Words Microsoft Excel Microsoft Notepad Python
18 Tools Used F# works well for files up to 300MB. It cannot read bigger files. All genome files are smaller than 300MB, except the RNA files in human and mouse genome. I split big files into 200MB pieces with Python. Then F# works fine. Python is too slow to do anything significant.
19 Conclusion I believe each cell is a computer. I believe the genome contains the complete code of the cell computer. I believe mrnas are primitive code to produce proteins. I believe mirnas are high level code to activate mrnas and mirnas.
20 Questions?
21 Thank You!
Computational Structural Bioinformatics
Computational Structural Bioinformatics ECS129 Instructor: Patrice Koehl http://koehllab.genomecenter.ucdavis.edu/teaching/ecs129 koehl@cs.ucdavis.edu Learning curve Math / CS Biology/ Chemistry Pre-requisite
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
11/24/13. Science, then, and now. Computational Structural Bioinformatics. Learning curve. ECS129 Instructor: Patrice Koehl
Computational Structural Bioinformatics ECS129 Instructor: Patrice Koehl http://www.cs.ucdavis.edu/~koehl/teaching/ecs129/index.html koehl@cs.ucdavis.edu Learning curve Math / CS Biology/ Chemistry Pre-requisite
Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p.
READING: 14.2 Bacterial Genomes p. 481 14.3 Gene Transfer Mechanisms in Bacteria p. 486 Suggested Problems: 1, 7, 13, 14, 15, 20, 22 BACTERIAL GENETICS AND GENOMICS We still consider the E. coli genome
10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison
10-810: Advanced Algorithms and Models for Computational Biology microrna and Whole Genome Comparison Central Dogma: 90s Transcription factors DNA transcription mrna translation Proteins Central Dogma:
Warm Up. What are some examples of living things? Describe the characteristics of living things
Warm Up What are some examples of living things? Describe the characteristics of living things Objectives Identify the levels of biological organization and explain their relationships Describe cell structure
Test 2: Cell Structure and Function
Name Test 2: Cell Structure and Function Date 1. Our bodies are made of, which are made up of many different parts and are the basic units of life. 1. a. cells b. organelles c. molecules d. proteins 2.
Introduction to Bioinformatics Integrated Science, 11/9/05
1 Introduction to Bioinformatics Integrated Science, 11/9/05 Morris Levy Biological Sciences Research: Evolutionary Ecology, Plant- Fungal Pathogen Interactions Coordinator: BIOL 495S/CS490B/STAT490B Introduction
Lesson Overview. Gene Regulation and Expression. Lesson Overview Gene Regulation and Expression
13.4 Gene Regulation and Expression THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium
Giri Narasimhan. CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Evaluation. Course Homepage.
CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 389; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs06.html 1/12/06 CAP5510/CGS5166 1 Evaluation
CGS 5991 (2 Credits) Bioinformatics Tools
CAP 5991 (3 Credits) Introduction to Bioinformatics CGS 5991 (2 Credits) Bioinformatics Tools Giri Narasimhan 8/26/03 CAP/CGS 5991: Lecture 1 1 Course Schedules CAP 5991 (3 credit) will meet every Tue
Bacterial Genetics & Operons
Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the
Controlling Gene Expression
Controlling Gene Expression Control Mechanisms Gene regulation involves turning on or off specific genes as required by the cell Determine when to make more proteins and when to stop making more Housekeeping
Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.
Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:
Introduction Biology before Systems Biology: Reductionism Reduce the study from the whole organism to inner most details like protein or the DNA.
Systems Biology-Models and Approaches Introduction Biology before Systems Biology: Reductionism Reduce the study from the whole organism to inner most details like protein or the DNA. Taxonomy Study external
Small RNA in rice genome
Vol. 45 No. 5 SCIENCE IN CHINA (Series C) October 2002 Small RNA in rice genome WANG Kai ( 1, ZHU Xiaopeng ( 2, ZHONG Lan ( 1,3 & CHEN Runsheng ( 1,2 1. Beijing Genomics Institute/Center of Genomics and
Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
Introduction to molecular biology. Mitesh Shrestha
Introduction to molecular biology Mitesh Shrestha Molecular biology: definition Molecular biology is the study of molecular underpinnings of the process of replication, transcription and translation of
Computational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
UNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular microbiology Time Allowed: 1 hour 30 minutes Marking
Supplemental Figure 1.
Supplemental Material: Annu. Rev. Genet. 2015. 49:213 42 doi: 10.1146/annurev-genet-120213-092023 A Uniform System for the Annotation of Vertebrate microrna Genes and the Evolution of the Human micrornaome
the cell history cell theory basic properties of cells chapter 1
history the cell chapter 1 invention of the microscope hans and zacharias janssen - 1590 galileo galilei - 1609 giovanni faber robert hooke -1665 - Micrographia anton van leewenhoek - 1676 schleiden &
Supplemental Materials
JOURNAL OF MICROBIOLOGY & BIOLOGY EDUCATION, May 2013, p. 107-109 DOI: http://dx.doi.org/10.1128/jmbe.v14i1.496 Supplemental Materials for Engaging Students in a Bioinformatics Activity to Introduce Gene
BSC 4934: QʼBIC Capstone Workshop" Giri Narasimhan. ECS 254A; Phone: x3748
BSC 4934: QʼBIC Capstone Workshop" Giri Narasimhan ECS 254A; Phone: x3748 giri@cs.fiu.edu http://www.cs.fiu.edu/~giri/teach/bsc4934_su10.html July 2010 7/12/10 Q'BIC Bioinformatics 1 Overview of Course"
GCD3033:Cell Biology. Transcription
Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors
Pyrobayes: an improved base caller for SNP discovery in pyrosequences
Pyrobayes: an improved base caller for SNP discovery in pyrosequences Aaron R Quinlan, Donald A Stewart, Michael P Strömberg & Gábor T Marth Supplementary figures and text: Supplementary Figure 1. The
Biology 112 Practice Midterm Questions
Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,
Quantitative Measurement of Genome-wide Protein Domain Co-occurrence of Transcription Factors
Quantitative Measurement of Genome-wide Protein Domain Co-occurrence of Transcription Factors Arli Parikesit, Peter F. Stadler, Sonja J. Prohaska Bioinformatics Group Institute of Computer Science University
Name: SBI 4U. Gene Expression Quiz. Overall Expectation:
Gene Expression Quiz Overall Expectation: - Demonstrate an understanding of concepts related to molecular genetics, and how genetic modification is applied in industry and agriculture Specific Expectation(s):
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA
15.2 Prokaryotic Transcription *
OpenStax-CNX module: m52697 1 15.2 Prokaryotic Transcription * Shannon McDermott Based on Prokaryotic Transcription by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons
ECOL/MCB 320 and 320H Genetics
ECOL/MCB 320 and 320H Genetics Instructors Dr. C. William Birky, Jr. Dept. of Ecology and Evolutionary Biology Lecturing on Molecular genetics Transmission genetics Population and evolutionary genetics
BIOINFORMATICS LAB AP BIOLOGY
BIOINFORMATICS LAB AP BIOLOGY Bioinformatics is the science of collecting and analyzing complex biological data. Bioinformatics combines computer science, statistics and biology to allow scientists to
Genomes and Their Evolution
Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
2.1 CELL STRUCTURE. The cell is the smallest unit of living organisms that shows the characteristics of life.
2.1.1 Microscopy The cell is the smallest unit of living organisms that shows the characteristics of life. A general introduction to the microscope. The light microscope All cells are microscopic which
Overview of I519 & Introduction to Bioinformatics. Yuzhen Ye School of Informatics and Computing, IUB
Overview of I519 & Introduction to Bioinformatics Yuzhen Ye (yye@indiana.edu) School of Informatics and Computing, IUB Structure of I519 Two classes and one lab each week Python & C (& R) Textbook: Understanding
CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools
CAP 5510: to : Tools ECS 254A / EC 2474; Phone x3748; Email: giri@cis.fiu.edu My Homepage: http://www.cs.fiu.edu/~giri http://www.cs.fiu.edu/~giri/teach/bioinfs15.html Office ECS 254 (and EC 2474); Phone:
AP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide
Name: Period: Date: AP Bio Module 6: Bacterial Genetics and Operons, Student Learning Guide Getting started. Work in pairs (share a computer). Make sure that you log in for the first quiz so that you get
Chapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
Cell Organelles Tutorial
1 Name: Cell Organelles Tutorial TEK 7.12D: Differentiate between structure and function in plant and animal cell organelles, including cell membrane, cell wall, nucleus, cytoplasm, mitochondrion, chloroplast,
Flow of Genetic Information
presents Flow of Genetic Information A Montagud E Navarro P Fernández de Córdoba JF Urchueguía Elements Nucleic acid DNA RNA building block structure & organization genome building block types Amino acid
Related Courses He who asks is a fool for five minutes, but he who does not ask remains a fool forever.
CSE 527 Computational Biology http://www.cs.washington.edu/527 Lecture 1: Overview & Bio Review Autumn 2004 Larry Ruzzo Related Courses He who asks is a fool for five minutes, but he who does not ask remains
Network motifs in the transcriptional regulation network (of Escherichia coli):
Network motifs in the transcriptional regulation network (of Escherichia coli): Janne.Ravantti@Helsinki.Fi (disclaimer: IANASB) Contents: Transcription Networks (aka. The Very Boring Biology Part ) Network
!"#$%&!"&'(&%")(*(+& '4567,846/-&*,/69450.:&*,.;42/9450&<ᶫ.=097,.4.& #259,40& &95&523/0,--,.
1 2 Contact Information Dr. Sonish Azam Office: SP 375.23 Tel: 514-848-2424 ex 3488 Email: sonish.azam@concordia.ca (Please mention BIOL 266 in subject) Office hours: after the class or by appointment
BIOLOGY STANDARDS BASED RUBRIC
BIOLOGY STANDARDS BASED RUBRIC STUDENTS WILL UNDERSTAND THAT THE FUNDAMENTAL PROCESSES OF ALL LIVING THINGS DEPEND ON A VARIETY OF SPECIALIZED CELL STRUCTURES AND CHEMICAL PROCESSES. First Semester Benchmarks:
Honors Biology Reading Guide Chapter 11
Honors Biology Reading Guide Chapter 11 v Promoter a specific nucleotide sequence in DNA located near the start of a gene that is the binding site for RNA polymerase and the place where transcription begins
3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization.
3.B.1 Gene Regulation Gene regulation results in differential gene expression, leading to cell specialization. We will focus on gene regulation in prokaryotes first. Gene regulation accounts for some of
the noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB)
Biology of the the noisy gene Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) day III: noisy bacteria - Regulation of noise (B. subtilis) - Intrinsic/Extrinsic
Frequently Asked Questions (FAQs)
Frequently Asked Questions (FAQs) Q1. What is meant by Satellite and Repetitive DNA? Ans: Satellite and repetitive DNA generally refers to DNA whose base sequence is repeated many times throughout the
CELL BIOLOGY. by the numbers. Ron Milo. Rob Phillips. illustrated by. Nigel Orme
CELL BIOLOGY by the numbers Ron Milo Rob Phillips illustrated by Nigel Orme viii Detailed Table of Contents List of Estimates xii Preface xv Acknowledgments xiii The Path to Biological Numeracy Why We
Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
Microbial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
Hairpin Database: Why and How?
Hairpin Database: Why and How? Clark Jeffries Research Professor Renaissance Computing Institute and School of Pharmacy University of North Carolina at Chapel Hill, United States Why should a database
Advanced Algorithms and Models for Computational Biology
Advanced Algorithms and Models for Computational Biology Introduction to cell biology genomics development and probability Eric ing Lecture January 3 006 Reading: Chap. DTM book Introduction to cell biology
Introduction to Molecular and Cell Biology
Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What
Upstream Elements Regulating mir-241 and mir-48 Abstract Introduction
Upstream Elements Regulating mir-241 and mir-48 Hanna Vollbrecht, Tamar Resnick, and Ann Rougvie University of Minnesota: Twin Cities Undergraduate Research Scholarship 2012-2013 Abstract Caenorhabditis
Investigation of phylogenetic relationships using microrna sequences and secondary structures
Investigation of phylogenetic relationships using microrna sequences and secondary structures Author: Rohit Dnyansagar a07rohdn@student.his.se Supervisor: Angelica Lindlöf angelica.lindlof@his.se School
2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology
2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the
robustness: revisting the significance of mirna-mediated regulation
: revisting the significance of mirna-mediated regulation Hervé Seitz IGH (CNRS), Montpellier, France October 13, 2012 microrna target identification .. microrna target identification mir: target: 2 7
Biology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 26 Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 2 of 26 Gene Regulation: An Example Gene Regulation: An Example
G4120: Introduction to Computational Biology
ICB Fall 2009 G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology & Immunology Copyright 2008 Oliver Jovanovic, All Rights Reserved. Genome
Topic 4 - #14 The Lactose Operon
Topic 4 - #14 The Lactose Operon The Lactose Operon The lactose operon is an operon which is responsible for the transport and metabolism of the sugar lactose in E. coli. - Lactose is one of many organic
Edward M. Golenberg Wayne State University Detroit, MI
Edward M. Golenberg Wayne State University Detroit, MI Targeting Phragmites Success As Invasive Species Phragmites displays multiple life history parameters High seed output and small seed size Rapid growth
UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11
UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11 REVIEW: Signals that Start and Stop Transcription and Translation BUT, HOW DO CELLS CONTROL WHICH GENES ARE EXPRESSED AND WHEN? First of
12-5 Gene Regulation
12-5 Gene Regulation Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 1 of 26 12-5 Gene Regulation Gene Regulation: An Example Gene
Genome Sequences and Evolution
Jones & Bartlett Learning LLC, an Ascend Learning Company.. Chapter 5 Genome Sequences and Evolution Chapter Outline 5.1 Introduction 5.2 5.3 Prokaryotic Gene Numbers Range Over an Order of Magnitude Total
Is Molecular Genetics Becoming Less Reductionistic?
Is Molecular Genetics Becoming Less Reductionistic? Notes from recent case studies on mapping C. elegans and the discovery of microrna Richard M. Burian Virginia Tech rmburian@vt.edu Outline Introduction
Topic 1 - The building blocks of. cells! Name:!
B2 - Revision Topic 1 - The building blocks of Lesson cells Name: Topic B2.1 Plant and Animal Cells B2.2 Inside Bacteria B2.3 DNA B2.4 Extracting DNA: PCA B2.5 DNA Discovery B2.6 Genetic Engineering B2.7
In Genomes, Two Types of Genes
In Genomes, Two Types of Genes Protein-coding: [Start codon] [codon 1] [codon 2] [ ] [Stop codon] + DNA codons translated to amino acids to form a protein Non-coding RNAs (NcRNAs) No consistent patterns
MCB142/ICB163 Overview. Instructors:
MCB142/ICB163 Overview Instructors: Professor Sharon Amacher Professor Abby Dernburg Professor Monty Slatkin GSIs: Kristin Camfield Nat Hallihan Hana Lee Christine Preston Richard Price Kate Smallenburg
Introduction. Gene expression is the combined process of :
1 To know and explain: Regulation of Bacterial Gene Expression Constitutive ( house keeping) vs. Controllable genes OPERON structure and its role in gene regulation Regulation of Eukaryotic Gene Expression
A DNA Sequence 2017/12/6 1
A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta
Chapter 9 DNA recognition by eukaryotic transcription factors
Chapter 9 DNA recognition by eukaryotic transcription factors TRANSCRIPTION 101 Eukaryotic RNA polymerases RNA polymerase RNA polymerase I RNA polymerase II RNA polymerase III RNA polymerase IV Function
Unit 5: Cell Division and Development Guided Reading Questions (45 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 12 The Cell Cycle Unit 5: Cell Division and Development Guided
CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON
PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter
Translation - Prokaryotes
1 Translation - Prokaryotes Shine-Dalgarno (SD) Sequence rrna 3 -GAUACCAUCCUCCUUA-5 mrna...ggagg..(5-7bp)...aug Influences: Secondary structure!! SD and AUG in unstructured region Start AUG 91% GUG 8 UUG
16 CONTROL OF GENE EXPRESSION
16 CONTROL OF GENE EXPRESSION Chapter Outline 16.1 REGULATION OF GENE EXPRESSION IN PROKARYOTES The operon is the unit of transcription in prokaryotes The lac operon for lactose metabolism is transcribed
Welcome to BIOL 572: Recombinant DNA techniques
Lecture 1: 1 Welcome to BIOL 572: Recombinant DNA techniques Agenda 1: Introduce yourselves Agenda 2: Course introduction Agenda 3: Some logistics for BIOL 572 Agenda 4: Q&A section Agenda 1: Introduce
Genome wide analysis of protein and mrna half lives reveals dynamic properties of mammalian gene expression
Genome wide analysis of protein and mrna half lives reveals dynamic properties of mammalian gene expression Matthias Selbach Cell Signaling and Mass Spectrometry Max Delbrück Center for Molecular Medicine
Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha
Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary
CHAPTER 1 INTRODUCTION TO CELLS 2009 Garland Science Publishing 3 rd Edition
Unity and Diversity of Cells 1-1 The smallest unit of life is a(n) (a) DNA molecule. (b) cell. (c) organelle. (d) virus. (e) protein. CHAPTER 1 INTRODUCTION TO CELLS 2009 Garland Science Publishing 3 rd
Mouth animalcules (bacteria)
Mouth animalcules (bacteria) 1684 http://en.citizendium.org/images/thumb/9/94/leeuwenhoek.jpg/300px-leeuwenhoek.jpg Prokaryotic Cell Shapes Coccus - cocci Bacillus - bacillus Spirillum - spirilli Vibrio
Round 1. Mitosis & Meiosis Inheritance (10 questions)
BIO Quiz Game & Midterm Review Rules: Work in groups of 3-4 Put all group members names at top of your paper When asked a question, talk amongst your group, but quietly! You don t want other groups to
CHAPTER : Prokaryotic Genetics
CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering
Topic 3: Genetics (Student) Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species.
Topic 3: Genetics (Student) 3.2 Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species. 3.2 Chromosomes 3.2.U1 Prokaryotes have one chromosome consisting of
microrna pseudo-targets
microrna pseudo-targets Natalia Pinzón Restrepo Institut de Génétique Humaine (CNRS), Montpellier, France August, 2012 microrna target identification mir: target: 2 7 5 N NNNNNNNNNNNNNN NNNNNN 3 the seed
Universal Rules Governing Genome Evolution Expressed by Linear Formulas
The Open Genomics Journal, 8, 1, 33-3 33 Open Access Universal Rules Governing Genome Evolution Expressed by Linear Formulas Kenji Sorimachi *,1 and Teiji Okayasu 1 Educational Support Center and Center
(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.
1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the
EVOLUTIONARY DISTANCES
EVOLUTIONARY DISTANCES FROM STRINGS TO TREES Luca Bortolussi 1 1 Dipartimento di Matematica ed Informatica Università degli studi di Trieste luca@dmi.units.it Trieste, 14 th November 2007 OUTLINE 1 STRINGS:
Contains ribosomes attached to the endoplasmic reticulum. Genetic material consists of linear chromosomes. Diameter of the cell is 1 m
1. (a) Complete each box in the table, which compares a prokaryotic and a eukaryotic cell, with a tick if the statement is correct or a cross if it is incorrect. Prokaryotic cell Eukaryotic cell Contains
Cellular Neuroanatomy I The Prototypical Neuron: Soma. Reading: BCP Chapter 2
Cellular Neuroanatomy I The Prototypical Neuron: Soma Reading: BCP Chapter 2 Functional Unit of the Nervous System The functional unit of the nervous system is the neuron. Neurons are cells specialized
Define: Alleles. Define: Chromosome. In DNA and RNA, molecules called bases pair up in certain ways.
Alleles Chromosome In DNA and RNA, molecules called bases pair up in certain ways. How do the bases A, C, G, T, and U match up in DNA? How about RNA? Summarize the cell process called protein synthesis!
MONTGOMERY COUNTY COMMUNITY COLLEGE BIO 140 CHAPTER 4. Functional Anatomy of Prokaryotic and Eukaryotic Cells
MONTGOMERY COUNTY COMMUNITY COLLEGE BIO 140 CHAPTER 4 Functional Anatomy of Prokaryotic and Eukaryotic Cells I. PROKARYOTES A. Structure Of The Cell: Chemical Composition And Function 1. Cell Wall a. composition
A Browser for Pig Genome Data
A Browser for Pig Genome Data Thomas Mailund January 2, 2004 This report briefly describe the blast and alignment data available at http://www.daimi.au.dk/ mailund/pig-genome/ hits.html. The report describes
Variation, Evolution, and Correlation Analysis of C+G Content and Genome or Chromosome Size in Different Kingdoms and Phyla
Variation, Evolution, and Correlation Analysis of C+G Content and Genome or Chromosome Size in Different Kingdoms and Phyla Xiu-Qing Li 1 *, Donglei Du 2 1 Molecular Genetics Laboratory, Potato Research
Chapter 18 Active Reading Guide Genomes and Their Evolution
Name: AP Biology Mr. Croft Chapter 18 Active Reading Guide Genomes and Their Evolution Most AP Biology teachers think this chapter involves an advanced topic. The questions posed here will help you understand
How much non-coding DNA do eukaryotes require?
How much non-coding DNA do eukaryotes require? Andrei Zinovyev UMR U900 Computational Systems Biology of Cancer Institute Curie/INSERM/Ecole de Mine Paritech Dr. Sebastian Ahnert Dr. Thomas Fink Bioinformatics
Turns sunlight, water & carbon dioxide (CO 2 ) into sugar & oxygen through photosynthesis
CELL PART/ ORGANELLE FUNCTION (what it does) PICTURE Plant, Animal, or Both Cell Membrane controls what goes in & out of the cell protects the cell Nucleus directs all the cell s activities contains cell
What Organelle Makes Proteins According To The Instructions Given By Dna
What Organelle Makes Proteins According To The Instructions Given By Dna This is because it contains the information needed to make proteins. assemble enzymes and other proteins according to the directions
Introduction to Bioinformatics. Shifra Ben-Dor Irit Orr
Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A