A DNA Sequence 2017/12/6 1
|
|
|
- Bartholomew Austin
- 6 years ago
- Views:
Transcription
1 A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta gaggtcagtgactgatgatcgatgcatgcatggatgatgcagctgatcgatgt agatgcaataagtcgatgatcgatgatgatgctagatgatagctagatgtgat cgatggtaggtaggatggtaggtaaattgatagatgctagatcgtaggtagta gctagatgcagggataaacacacggaggcgagtgatcggtaccgggctg aggtgttagctaatgatgagtacgtatgaggcaggatgagtgacccgatgag gctagatgcgatggatggatcgatgatcgatgcatggtgatgcgatgctagat gatgtgtgtcagtaagtaagcgatgcggctgctgagagcgtaggcccgaga ggagagatgtaggaggaaggtttgatggtagttgtagatgattgtgtagttgta gctgatagtgatgatcgtag 2017/12/6 1
2 Possible Questions What organism is this DNA sequence from? Is it from a bacterium, fly or any other organism? Is it really from one organism? Is it a real DNA sequence? 2017/12/6 2
3 Is any part of the DNA transferred from another organism? ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta gaggtcagtgactgatgatcgatgcatgcatggatgatgcagctgatcgatgt agatgcaataagtcgatgatcgatgatgatgctagatgatagctagatgtgat cgatggtaggtaggatggtaggtaaattgatagatgctagatcgtaggtagta gctagatgcagggataaacacacggaggcgagtgatcggtaccgggctg aggtgttagctaatgatgagtacgtatgaggcaggatgagtgacccgatgag gctagatgcgatggatggatcgatgatcgatgcatggtgatgcgatgctagat gatgtgtgtcagtaagtaagcgatgcggctgctgagagcgtaggcccgaga ggagagatgtaggaggaaggtttgatggtagttgtagatgattgtgtagttgta gctgatagtgatgatcgtag 2017/12/6 3
4 Identification of Foreign Genetic Material Is it possible to identify foreign genetic materials in a given DNA sequence? 2017/12/6 4
5 K-mer Frequencies Combined K-mer frequency: frequency of each K-mer and its reverse complement 4-mers: GGTA/TACC, CGAA/TTGC, GGTC/GACC, frequency genome sequence 2017/12/6 5
6 K-mer Frequencies Genomes have highly stable combined K-mer frequencies, measured using small window size M e.g., M = 1000 bps; K = 4; This is true for all genomes, eukaryotic, prokaryotic, chromosomal and organelle 2017/12/6 6
7 Genome Visualization When mapping the frequencies to grey levels, each genome can be visualized as a grey-level image x-axis: combined K-mers (e.g., 4-mers), and y-axis: genome axis AAAA/TTTT 136 combined 4-mers frequency ACAG/CTGT CGAT/ATCG genome sequence 2017/12/6 7
8 Genome Barcodes Barcodes of various genomes P. furiosus B. pseudomallei E. coli O157 E. coli K /12/6 8
9 Genome Barcodes How about the barcode of a random sequence of {A, C, G, T}? No, you cannot fake a genome Random seq 2017/12/6 9
10 Properties of Genome Barcodes Majority of a prokaryotic genome s short fragments have highly similar barcodes E. coli K-12 E. coli O /12/6 10 B. pseudomallei P. furiosus
11 Abnormal Barcodes On average, 12-13% of genomic fragments in bacterial genomes have substantially different barcodes 2017/12/6 11
12 Abnormal Barcodes This distance distribution suggests that we may be able to figure out how long the transferred genes have been in the host rather than just which ones are the transferred genes
13 Barcode Properties of Genomes Different types of genomic regions tend to have their common and unique characteristics coding regions intergenic regions interoperonic regions 2017/12/6 13
14 Barcode Properties of Genomes Different classes of genomes, i.e., eukaryotic, prokaryotic, mitochondrial, plasmid, plastid, have their unique and identifiable characteristics Red: prokaryotes Blue: eukaryotes Green: plastids Orange: plasmids Black: mitochondria 2017/12/6 14
15 Why Barcode Properties 0 th order Markov chain 1 st order Markov chain 3 rd order Markov chain 5 th order Markov chain We believe that it is the Markov chain properties of the prokaryotic DNA that give rise to the barcode property
16 Barcode Properties But. why do eukaryotic genomes also have (seemingly more complex) barcode properties? Do different (major) regions of a eukaryotic genome also follow Markov chain models or more complex stochastic models? protein-coding genes (hidden Markov model) RNA-coding genes regulatory regions repetitive elements. This is something that we hope to answer someday!
17 What Questions Can We Answer Which organism is this DNA sequence from? Is it from a bacterium, fly or any other organism? Is it really from one organism? Is it a real DNA sequence? YES to all these and many other questions! 2017/12/6 17
18 Take-Home Message Genome visualization could be a key to discoveries of new genomic elements Barcodes represent only an initial effort along this direction
Introduction to Molecular and Cell Biology
Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What
2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology
2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the
Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
Microbial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
Biology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 26 Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 2 of 26 Gene Regulation: An Example Gene Regulation: An Example
HORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS
HORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS OVERVIEW INTRODUCTION MECHANISMS OF HGT IDENTIFICATION TECHNIQUES EXAMPLES - Wolbachia pipientis - Fungus - Plants - Drosophila ananassae
Chapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
12-5 Gene Regulation
12-5 Gene Regulation Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 1 of 26 12-5 Gene Regulation Gene Regulation: An Example Gene
CHAPTER : Prokaryotic Genetics
CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering
Bacterial Genetics & Operons
Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the
NCERT solution for Cell - Structure and Functions Science
NCERT solution for Cell - Structure and Functions Science 1 Question 1 Indicate whether the following statements are True (T) or False (F). (a) Unicellular organisms have one-celled body. (b) Muscle cells
Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.
Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:
2. What was the Avery-MacLeod-McCarty experiment and why was it significant? 3. What was the Hershey-Chase experiment and why was it significant?
Name Date Period AP Exam Review Part 6: Molecular Genetics I. DNA and RNA Basics A. History of finding out what DNA really is 1. What was Griffith s experiment and why was it significant? 1 2. What was
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
Eukaryotic Cells. Figure 1: A mitochondrion
Eukaryotic Cells Figure 1: A mitochondrion How do cells accomplish all their functions in such a tiny, crowded package? Eukaryotic cells those that make up cattails and apple trees, mushrooms and dust
SPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES.
THE TERMS RUN AND TUMBLE ARE GENERALLY ASSOCIATED WITH A) cell wall fluidity. B) cell membrane structures. C) taxic movements of the cell. D) clustering properties of certain rod-shaped bacteria. A MAJOR
Cell Division and Reproduction
Cell Division and Reproduction What do you think this picture shows? If you guessed that it s a picture of two cells, you are right. In fact, the picture shows human cancer cells, and they are nearing
It took more than years for scientists to develop that would allow them to really study.
CELLS NOTES All living things are made of! THE DISCOVERY OF CELLS The Scientist Who? When? What was discovered? Robert Hooke Anton van Leeuwenhoek Looked through a very simple at a thin slice of and saw
MONTGOMERY COUNTY COMMUNITY COLLEGE BIO 140 CHAPTER 4. Functional Anatomy of Prokaryotic and Eukaryotic Cells
MONTGOMERY COUNTY COMMUNITY COLLEGE BIO 140 CHAPTER 4 Functional Anatomy of Prokaryotic and Eukaryotic Cells I. PROKARYOTES A. Structure Of The Cell: Chemical Composition And Function 1. Cell Wall a. composition
The nature of genomes. Viral genomes. Prokaryotic genome. Nonliving particle. DNA or RNA. Compact genomes with little spacer DNA
The nature of genomes Genomics: study of structure and function of genomes Genome size variable, by orders of magnitude number of genes roughly proportional to genome size Plasmids symbiotic DNA molecules,
Microbiology - Problem Drill 04: Prokayotic & Eukaryotic Cells - Structures and Functions
Microbiology - Problem Drill 04: Prokayotic & Eukaryotic Cells - Structures and Functions No. 1 of 10 1. Eukaryote is a word that describes one of two living cell classifications. The word comes from Greek
Unit 2: The Structure and function of Organisms. Section 2: Inside Cells
Unit 2: The Structure and function of Organisms Section 2: 42 Essential Question: Are all cells the same? - Vocabulary 1. 2. 3. 4. 5. 6. 7. 8. Eukaryotic Prokaryotic Organelle Plant Cell Animal Cell Chloroplast
Bio 119 Bacterial Genomics 6/26/10
BACTERIAL GENOMICS Reading in BOM-12: Sec. 11.1 Genetic Map of the E. coli Chromosome p. 279 Sec. 13.2 Prokaryotic Genomes: Sizes and ORF Contents p. 344 Sec. 13.3 Prokaryotic Genomes: Bioinformatic Analysis
15.2 Prokaryotic Transcription *
OpenStax-CNX module: m52697 1 15.2 Prokaryotic Transcription * Shannon McDermott Based on Prokaryotic Transcription by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons
Microbial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
10.2 The Process of Cell Division
10.2 The Process of Cell Division Lesson Objectives Describe the role of chromosomes in cell division. Name the main events of the cell cycle. Describe what happens during the four phases of mitosis. Describe
AP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide
Name: Period: Date: AP Bio Module 6: Bacterial Genetics and Operons, Student Learning Guide Getting started. Work in pairs (share a computer). Make sure that you log in for the first quiz so that you get
3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization.
3.B.1 Gene Regulation Gene regulation results in differential gene expression, leading to cell specialization. We will focus on gene regulation in prokaryotes first. Gene regulation accounts for some of
Chromosomes and Inheritance - 1
Chromosomes and Inheritance - 1 Chromosome Theory of Inheritance Although Gregor Mendel did tremendous work in determining how genetic information was passed from generation to generation, he had no knowledge
Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p.
READING: 14.2 Bacterial Genomes p. 481 14.3 Gene Transfer Mechanisms in Bacteria p. 486 Suggested Problems: 1, 7, 13, 14, 15, 20, 22 BACTERIAL GENETICS AND GENOMICS We still consider the E. coli genome
Gene Regulation and Expression
THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium that contains more than 4000 genes.
Cell Structure and Function
Cell Structure and Function Prokaryote vs. Eukaryote Prokaryotic cells: Pro- Before, Karyot- Center or Nucleus Very Basic Cells with no membrane bound organelles. DNA is not separate from the rest of the
CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON
PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter
Warm-Up. Explain how a secondary messenger is activated, and how this affects gene expression. (LO 3.22)
Warm-Up Explain how a secondary messenger is activated, and how this affects gene expression. (LO 3.22) Yesterday s Picture The first cell on Earth (approx. 3.5 billion years ago) was simple and prokaryotic,
Last time: Obtaining information from a cloned gene
Last time: Obtaining information from a cloned gene Objectives: 1. What is the biochemical role of the gene? 2. Where and when is the gene expressed (transcribed)? 3. Where and when is the protein made?
Plant transformation
Plant transformation Objectives: 1. What is plant transformation? 2. What is Agrobacterium? How and why does it transform plant cells? 3. How is Agrobacterium used as a tool in molecular genetics? References:
The Research Plan. Functional Genomics Research Stream. Transcription Factors. Tuning In Is A Good Idea
Functional Genomics Research Stream The Research Plan Tuning In Is A Good Idea Research Meeting: March 23, 2010 The Road to Publication Transcription Factors Protein that binds specific DNA sequences controlling
5.1 Cell Division and the Cell Cycle
5.1 Cell Division and the Cell Cycle Lesson Objectives Contrast cell division in prokaryotes and eukaryotes. Identify the phases of the eukaryotic cell cycle. Explain how the cell cycle is controlled.
Early History up to Schedule. Proteins DNA & RNA Schwann and Schleiden Cell Theory Charles Darwin publishes Origin of Species
Schedule Bioinformatics and Computational Biology: History and Biological Background (JH) 0.0 he Parsimony criterion GKN.0 Stochastic Models of Sequence Evolution GKN 7.0 he Likelihood criterion GKN 0.0
(A) Heterotrophs produce some organic nutrients, and must absorb inorganic nutrients from the environment.
MCAT Biology - Problem Drill 09: Prokaryotes and Fungi Question No. 1 of 10 Instructions: (1) Read the problem and answer choices carefully; (2) Work the problems on paper as needed; (3) Pick the correct
Cell Structure, Function & Ultrastructure
Cell Structure, Function & Ultrastructure Learning Objectives 2.1.2 Components of the cell as seen under the light microscope and their functions. Cell Structure and Function 1. Plant cells: cell wall,
Chapter 27: Bacteria and Archaea
Name Period Overview 1. The chapter opens with amazing tales of life at the extreme edge. What are the masters of adaptation? Describe the one case you thought most dramatic. Concept 27.1 Structural and
Darwin's theory of natural selection, its rivals, and cells. Week 3 (finish ch 2 and start ch 3)
Darwin's theory of natural selection, its rivals, and cells Week 3 (finish ch 2 and start ch 3) 1 Historical context Discovery of the new world -new observations challenged long-held views -exposure to
Microbial Genetics, Mutation and Repair. 2. State the function of Rec A proteins in homologous genetic recombination.
Answer the following questions 1. Define genetic recombination. Microbial Genetics, Mutation and Repair 2. State the function of Rec A proteins in homologous genetic recombination. 3. List 3 types of bacterial
Chapter 4 A Tour of the Cell. The human body is made up of trillions of cells many of which are specialized - Muscle cells
Chapter 4 A Tour of the Cell State Standards Standard 1.c. Standard 1.e. Introduction to Cells Organisms are either - Single-celled, such as - Multicelled, such as The human body is made up of trillions
Constructing a Pedigree
Constructing a Pedigree Use the appropriate symbols: Unaffected Male Unaffected Female Affected Male Affected Female Male carrier of trait Mating of Offspring 2. Label each generation down the left hand
Slide 1. Slide 2. Slide 3. Chapter 4 A Tour of the Cell. State Standards. Introduction to Cells. Standard 1.c. Standard 1.e.
Slide 1 Chapter 4 A Tour of the Cell Slide 2 State Standards Standard 1.c. Standard 1.e. Slide 3 Introduction to Cells Organisms are either - Single-celled, such as - Multicelled, such as The human body
Introductory Microbiology Dr. Hala Al Daghistani
Introductory Microbiology Dr. Hala Al Daghistani Why Study Microbes? Microbiology is the branch of biological sciences concerned with the study of the microbes. 1. Microbes and Man in Sickness and Health
Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p
Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p.110-114 Arrangement of information in DNA----- requirements for RNA Common arrangement of protein-coding genes in prokaryotes=
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA
Biology Slide 1 of 31
Biology 1 of 31 2 of 31 The Discovery of the Cell The Discovery of the Cell Because there were no instruments to make cells visible, the existence of cells was unknown for most of human history. This changed
Three types of RNA polymerase in eukaryotic nuclei
Three types of RNA polymerase in eukaryotic nuclei Type Location RNA synthesized Effect of α-amanitin I Nucleolus Pre-rRNA for 18,.8 and 8S rrnas Insensitive II Nucleoplasm Pre-mRNA, some snrnas Sensitive
Cell Organelles Tutorial
1 Name: Cell Organelles Tutorial TEK 7.12D: Differentiate between structure and function in plant and animal cell organelles, including cell membrane, cell wall, nucleus, cytoplasm, mitochondrion, chloroplast,
The Discovery of the Cell
The Discovery of the Cell The Discovery of the Cell Because there were no instruments to make cells visible, the existence of cells was unknown for most of human history. This changed with the invention
Genomes and Their Evolution
Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
How much non-coding DNA do eukaryotes require?
How much non-coding DNA do eukaryotes require? Andrei Zinovyev UMR U900 Computational Systems Biology of Cancer Institute Curie/INSERM/Ecole de Mine Paritech Dr. Sebastian Ahnert Dr. Thomas Fink Bioinformatics
Organelle genome evolution
Organelle genome evolution Plant of the day! Rafflesia arnoldii -- largest individual flower (~ 1m) -- no true leafs, shoots or roots -- holoparasitic -- non-photosynthetic Big questions What is the origin
GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H*" ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION
FIFTH EDITION IV I ^HHk ^ttm IZTI/^Q i I II MPHBBMWBBIHB '-llwmpbi^hbwm^^pfc ' GSBHSRSBRSRRk LlML I I \l 1MB ^HP'^^MMMP" jflp^^^^^^^^st I Iv^O FROM GENES TO GENOMES %^MiM^PM^^MWi99Mi$9i0^^ ^^^^^^^^^^^^^V^^^fii^^t^i^^^^^
CELL : THE UNIT OF LIFE
38 BIOLOGY, EXEMPLAR PROBLEMS CHAPTER 8 CELL : THE UNIT OF LIFE MULTIPLE CHOICE QUESTIONS 1. A common characteristic feature of plant sieve tube cells and most of mammalian erythrocytes is a. Absence of
PLNT2530 (2018) Unit 5 Genomes: Organization and Comparisons
PLNT2530 (2018) Unit 5 Genomes: Organization and Comparisons Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License Attribution Share-Alike
Regulation of gene Expression in Prokaryotes & Eukaryotes
Regulation of gene Expression in Prokaryotes & Eukaryotes 1 The trp Operon Contains 5 genes coding for proteins (enzymes) required for the synthesis of the amino acid tryptophan. Also contains a promoter
Flow of Genetic Information
presents Flow of Genetic Information A Montagud E Navarro P Fernández de Córdoba JF Urchueguía Elements Nucleic acid DNA RNA building block structure & organization genome building block types Amino acid
B I O. 1. B I O A N A L Y Z E T H E C E L L A S A L I V I N G S Y S T E M.
Goal 1 B I O. 1. 1 U N D E R S T A N D T H E R E L A T I O N S H I P B E T W E E N T H E S T R U C T U R E S A N D F U N C T I O N S O F C E L L S A N D T H E I R O R G A N E L L E S. B I O. 1. 2 A N A
Essentiality in B. subtilis
Essentiality in B. subtilis 100% 75% Essential genes Non-essential genes Lagging 50% 25% Leading 0% non-highly expressed highly expressed non-highly expressed highly expressed 1 http://www.pasteur.fr/recherche/unites/reg/
Topic 3: Genetics (Student) Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species.
Topic 3: Genetics (Student) 3.2 Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species. 3.2 Chromosomes 3.2.U1 Prokaryotes have one chromosome consisting of
Apicoplast. Apicoplast - history. Treatments and New drug targets
Treatments and New drug targets What is the apicoplast? Where does it come from? How are proteins targeted to the organelle? How does the organelle replicate? What is the function of the organelle? - history
Translation - Prokaryotes
1 Translation - Prokaryotes Shine-Dalgarno (SD) Sequence rrna 3 -GAUACCAUCCUCCUUA-5 mrna...ggagg..(5-7bp)...aug Influences: Secondary structure!! SD and AUG in unstructured region Start AUG 91% GUG 8 UUG
Cell Growth and Reproduction Module B, Anchor 1
Cell Growth and Reproduction Module B, Anchor 1 Key Concepts: - The larger a cell becomes, the more demands the cell places on its DNA. In addition, a larger cell is less efficient in moving nutrients
Classification. Old 5 Kingdom system. New 3 Domain system. reflects a greater understanding of evolution & molecular evidence
Classification Old 5 Kingdom system Monera, Protists, Plants, Fungi, Animals New 3 Domain system reflects a greater understanding of evolution & molecular evidence Prokaryote: Bacteria Prokaryote: Archaebacteria
Principles of Genetics
Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics
Lecture one Introduction to the Cell Biology
Lecture one Introduction to the Cell Biology INTRODUCTION TO THE CELL Both living and non-living things are composed of molecules made from chemical elements such as Carbon, Hydrogen, Oxygen, and Nitrogen.
Lecture 18 June 2 nd, Gene Expression Regulation Mutations
Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase
DNA Technology, Bacteria, Virus and Meiosis Test REVIEW
Be prepared to turn in a completed test review before your test. In addition to the questions below you should be able to make and analyze a plasmid map. Prokaryotic Gene Regulation 1. What is meant by
no.1 Raya Ayman Anas Abu-Humaidan
no.1 Raya Ayman Anas Abu-Humaidan Introduction to microbiology Let's start! As you might have concluded, microbiology is the study of all organisms that are too small to be seen with the naked eye, Ex:
= Monera. Taxonomy. Domains (3) BIO162 Page Baluch. Taxonomy: classifying and organizing life
Taxonomy BIO162 Page Baluch Taxonomy: classifying and organizing life species Genus Family Order Class Phylum Kingdom Spaghetti Good For Over Came Phillip King Domains (3) DOMAINS 1. Bacteria 2. Archea
The Gene The gene; Genes Genes Allele;
Gene, genetic code and regulation of the gene expression, Regulating the Metabolism, The Lac- Operon system,catabolic repression, The Trp Operon system: regulating the biosynthesis of the tryptophan. Mitesh
Sugars, such as glucose or fructose are the basic building blocks of more complex carbohydrates. Which of the following
Name: Score: / Quiz 2 on Lectures 3 &4 Part 1 Sugars, such as glucose or fructose are the basic building blocks of more complex carbohydrates. Which of the following foods is not a significant source of
ORIGIN OF CELLULARITY AND CELLULAR DIVERSITY
ORIGIN OF CELLULARITY AND CELLULAR DIVERSITY Geological stratigraphy, together with radioactive dating, show the sequence of events in the history of the Earth. Note the entry for cyanobacteria and stromatolites
Frequently Asked Questions (FAQs)
Frequently Asked Questions (FAQs) Q1. What is meant by Satellite and Repetitive DNA? Ans: Satellite and repetitive DNA generally refers to DNA whose base sequence is repeated many times throughout the
The diagram below represents levels of organization within a cell of a multicellular organism.
STATION 1 1. Unlike prokaryotic cells, eukaryotic cells have the capacity to a. assemble into multicellular organisms b. establish symbiotic relationships with other organisms c. obtain energy from the
objective functions...
objective functions... COFFEE (Notredame et al. 1998) measures column by column similarity between pairwise and multiple sequence alignments assumes that the pairwise alignments are optimal assumes a set
UNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular microbiology Time Allowed: 1 hour 30 minutes Marking
Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha
Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary
Course Name: Biology Level: A Points: 5 Teacher Name: Claire E. Boudreau
Course Name: Biology Level: A Points: 5 Teacher Name: Claire E. Boudreau Texts/Instructional Materials: Biology : Concepts and Connections 5 th edition Campbell, Reece, Taylor and Simon Pearson Syllabus:
Name Period The Control of Gene Expression in Prokaryotes Notes
Bacterial DNA contains genes that encode for many different proteins (enzymes) so that many processes have the ability to occur -not all processes are carried out at any one time -what allows expression
WHAT DO CELLS DO? CHALLENGE QUESTION. What are the functions of the structures inside of cells?
WHAT DO CELLS DO? CHALLENGE QUESTION What are the functions of the structures inside of cells? WHAT DO CELLS DO? Understanding normal cell structures and their functions help scientists understand how
Organelles & Cells Student Edition. A. chromosome B. gene C. mitochondrion D. vacuole
Name: Date: 1. Which structure is outside the nucleus of a cell and contains DNA? A. chromosome B. gene C. mitochondrion D. vacuole 2. A potato core was placed in a beaker of water as shown in the figure
UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11
UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11 REVIEW: Signals that Start and Stop Transcription and Translation BUT, HOW DO CELLS CONTROL WHICH GENES ARE EXPRESSED AND WHEN? First of
Parts of the Cell book pgs
Parts of the Cell book pgs. 12-18 Animal Cell Cytoplasm Cell Membrane Go to Section: Eukaryotic Cell: Organelles & Functions 1. Cell Membrane (Nickname: skin ) Function: A protective layer that covers
Biology EOCT Review. Milton High School
Biology EOCT Review Milton High School Cell Organelles Nucleus holds DNA Cell membrane what comes in and goes out Mitochondria powerhouse of the cell Ribosomes protein synthesis Lysosomes digestion Cell
689 Special Topics in Ecological Genomics. Spring January 20, 2015
689 Special Topics in Ecological Genomics Spring 2015 January 20, 2015 Dr. Claudio Casola, Assistant Professor in Forest Genomics, Department of Ecosystem Science and Management Phone: email: (979) 845-8803
Map of AP-Aligned Bio-Rad Kits with Learning Objectives
Map of AP-Aligned Bio-Rad Kits with Learning Objectives Cover more than one AP Biology Big Idea with these AP-aligned Bio-Rad kits. Big Idea 1 Big Idea 2 Big Idea 3 Big Idea 4 ThINQ! pglo Transformation
Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1
Name I. Multiple Choice (1 point each) Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1 B 1. Which is possessed by eukaryotes but not by prokaryotes? A. Cell wall B. Distinct nucleus
Boolean models of gene regulatory networks. Matthew Macauley Math 4500: Mathematical Modeling Clemson University Spring 2016
Boolean models of gene regulatory networks Matthew Macauley Math 4500: Mathematical Modeling Clemson University Spring 2016 Gene expression Gene expression is a process that takes gene info and creates
Computational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
Animal Cell Organelles. Plant Cell. Organelle. Cell Wall. Chloroplasts. Vacuole
Cell Biology Higher Electron vs Light Microscope Light use light and lenses to magnify specimen Electron use a beam of electrons to form an image Electron higher magnification and higher resolution Electron
Cells and the Stuff They re Made of. Indiana University P575 1
Cells and the Stuff They re Made of Indiana University P575 1 Goal: Establish hierarchy of spatial and temporal scales, and governing processes at each scale of cellular function: o Where does emergent
From Gene to Protein
From Gene to Protein Gene Expression Process by which DNA directs the synthesis of a protein 2 stages transcription translation All organisms One gene one protein 1. Transcription of DNA Gene Composed
Ti plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines
Ti plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines Mitesh Shrestha Constraints of Wild type Ti/Ri-plasmid Very large
NOTE: Questions are written on both sides of the sheets of paper making up this exam booklet!
Biology 1010 Section A Midterm 1 January 30, 2008 (print): ANSWER KEY Name (signature): Student I.D. #: Time: 50 minutes Read the following instructions: 1. Do not open the examination until you are instructed