2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology

Save this PDF as:

Size: px
Start display at page:

Download "2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology"


1 2012 Univ Aguilera Lecture Introduction to Molecular and Cell Biology

2 Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What is the molecular basis of evolution? How did life arise on earth? What is the molecular basis of memory? How are different cell types produced from a single embryo?

3 Other Important Questions? What are genes? How do genes store information? How is genetic information expressed? How is this process regulated? How are genes duplicated during cell division? What are mutations? To answer these questions it is necessary to understand the nature of genes and proteins

4 Remembering what you already know

5 DNA Prokaryotic Cell Inner Membrane Cell Wall Outer Membrane Eukaryotic Cell DNA Nucleus Nuclear Membrane Plasma Membrane organelles

6 Prokaryotic Cells: No nuclear membrane No internal compartments Eukaryotic Cells: Nucleus Specialized Organelles

7 Eukaryotic Membranes Permeable to gases and water Active transport requires energy

8 Genetic Information: circular E. coli 4 x 10 6 base pairs of DNA (1 chromosome) max. potential proteins 3 x 10 3 actually 1-2 x pairs Human 2.9 x 10 9 base pairs of DNA (46 chromosomes) cell max. potential proteins 2.4 x 10 6 actually much less (~30-40,000) times the total dry weight of bacteria

9 Human Chromosome pairs

10 Although human beings appear to be much more complex and sophisticated than other organisms, we contain and express very similar genes that are highly evolutionarily conserved The function of some genes is so important, that they are highly conserved in sequence and function

11 Expression of Genes follows an ordered developmental plan HOX Humans and Flies express similar genes but obviously have different pattern of expression (function?) During evolution, it is easier to adapt an existing gene than to create it from scratch

12 Biological molecules are interdependent Central Dogma DNA RNA Protein You need protein to make DNA/RNA and you need nucleic acids to make proteins

13 Prevalent view in early 1900 s was that genetic information was contained within proteins Why? Proteins are more complex than nucleic acids (20 amino acids vs 4 different nucleotides) Nucleic acids, DNA, was believed to play structural role in cell

14 DNA is the Genetic Material n Early 1940 s DNA was finally implicated as the genetic material n Pure DNA extracted from one bacterial strain could provide genetic information to another bacteria by a process known as transformation n Makes sense since DNA is very stable, it is present in two copies in eukaryotes (diploid), exist as double-stranded molecule, and most importantly can be faithfully copied

15 Genes Defined as a unit of DNA that encodes the information for the synthesis of a protein Prokaryotes contain less genetic information (genes) than eukaryotes Genes are copied (transcribed) into messenger RNA and it is this message that is translated into protein In prokaryotes, genes involved in the same pathway are commonly linked closed together

16 In most eukaryotes, each gene is generally independently copied or transcribed into a single RNA that is then translated into a single protein Three genes in two chromosomes

17 Most genes in mammals and plants contain introns that are removed during RNA processing Introns spliced out (deleted) mature message Exons encode the information for protein synthesis

18 Mutations within genes can cause disease or death Mutation in an exon can cause the production of an abnormal or truncated (shorter) protein Mutation in an intron can cause no effect or can alter or destroy the normal processing of the mrna Mutation in regulatory regions can cause the gene to not be expressed at all or over-expressed

19 Alternative Splicing can produce different or altered proteins from the same gene

20 Fig.9-2 Even though humans encode for ~30,000 proteins (based on gene count), the # of different proteins is higher due to added complexity

21 In eukaryotes, each gene is independently copied and generally encodes information for a specific product (protein) Eukaryotic mrna is a product of several modifications which include removal of introns All DNA is arranged in a structure called a double-helix that is composed of two identical strands which adds to the chemical stability of this molecule

22 Watson & Crick DNA Double Helix (1953)

23 Linkage of Nucleic Acids Base 1 Base 2 5 O 3 Sugar OH HO P O Sugar O - -H2O 5 Base 1 Sugar O O P O - O Base 2 Sugar 3

24 O - O - P O O CH 2 O Base 1 H O - H O P O H H O H Base 2 CH 2 O H H 3 OH H H H

25 A C T A G P OH 5 ACTAG 3 UGAUC T only in DNA And U only in RNA

26 DNA Helix Held by many H bonds and Hydrophobic Interactions Bases stack on inside Sugar Phosphate backbone is on the outside

27 To maintain the geometry of this structure small bases, pyrimidines, (C or T) must pair with larger bases, purines, (A or G)


29 A-T Base Pair Thymidine (T) Adenine (A) CH 3 C HC O H N H C N N C (Deoxyribose) H C O N HC C C N CH C N N C (Deoxyribose) Base pair complementarity due to size, shape, and chemical composition of bases

30 C-G Base Pair Cytosine (C) HC HC H N H C N N C O C (Deoxyribose) H N H N H Guanine (G) C O C C N CH C N N C (Deoxyribose)

31 Genes are arranged in Chromosomes in specialized structures

32 Widely separated from each other Humans and other higher organisms have more junk DNA

33 DNA packaging within cells The E. coli bacterial genome is approximately 1mm long which is about 1000 x the size (vol) of a single bacteria DNA needs to be highly compacted

34 Eukaryotic DNA n Can be up to hundred thousand times longer than the cell that contains it n Found in highly compacted units called chromosomes n DNA is wound around special proteins

35 Eukaryotic genes are arranged in chromosomes gene 1 gene 2 gene 3 Longest human chromosomes 2-3 x 10 8 base pairs ~10 cm long gene 4

36 Contents of Chromosomes Chromosomes contain different types of sequences such as: n Single copy genes, gene families, defective genes n Non-coding DNA and repetitive sequences (can compose a significant part of genome) n Viral DNA and other transposable elements (few)

37 DNA cloning Cloning comes from the greek word klon which means twig Plants can be cloned by taking a cutting and replanting them- they should turn out identical to original plant. The first cloning experiment was performed in 1973 (only 37 yrs ago) by Cohen and Boyer They used bacterial plasmids which are small circular replicating fragments of DNA They also used enzymes that cut DNA into specific fragments. These enzymes are called restriction endonucleases (enzymes that cleave nucleic acids)

38 Plasmids are selfish pieces of DNA that are circular and replicate inside of bacterial host Origin of replication Ampicillin resistance gene

39 When plasmids replicate they make two identical copies Fig. 7.2

40 Restriction Enzyme Cleaves DNA at specific sites They are called sticky ends because they have a tendency of pairing or re-pairing with each other (or other foreign fragments)

41 Fragment of foreign DNA can be readily introduced into plasmids

42 Mix plasmid with E. coli bacteria and perform transformation Heat Shock

43 Restriction Enzymes Restriction enzymes (RE) are the bacteria s defense against viruses These enzymes restrict the host range of the viruses There are more than 100 different restriction enzymes from a large number of different bacteria Biotech companies have been making millions of dollars selling specific enzymes to researchers

Multiple Choice Review- Eukaryotic Gene Expression

Multiple Choice Review- Eukaryotic Gene Expression Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule

More information

Chapters 12&13 Notes: DNA, RNA & Protein Synthesis

Chapters 12&13 Notes: DNA, RNA & Protein Synthesis Chapters 12&13 Notes: DNA, RNA & Protein Synthesis Name Period Words to Know: nucleotides, DNA, complementary base pairing, replication, genes, proteins, mrna, rrna, trna, transcription, translation, codon,

More information

DNA Technology, Bacteria, Virus and Meiosis Test REVIEW

DNA Technology, Bacteria, Virus and Meiosis Test REVIEW Be prepared to turn in a completed test review before your test. In addition to the questions below you should be able to make and analyze a plasmid map. Prokaryotic Gene Regulation 1. What is meant by

More information


CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter

More information

Topic 1 - The building blocks of. cells! Name:!

Topic 1 - The building blocks of. cells! Name:! B2 - Revision Topic 1 - The building blocks of Lesson cells Name: Topic B2.1 Plant and Animal Cells B2.2 Inside Bacteria B2.3 DNA B2.4 Extracting DNA: PCA B2.5 DNA Discovery B2.6 Genetic Engineering B2.7

More information

Honors Biology Fall Final Exam Study Guide

Honors Biology Fall Final Exam Study Guide Honors Biology Fall Final Exam Study Guide Helpful Information: Exam has 100 multiple choice questions. Be ready with pencils and a four-function calculator on the day of the test. Review ALL vocabulary,

More information

Flow of Genetic Information

Flow of Genetic Information presents Flow of Genetic Information A Montagud E Navarro P Fernández de Córdoba JF Urchueguía Elements Nucleic acid DNA RNA building block structure & organization genome building block types Amino acid

More information

Ch 7: Cell Structure and Functions. AP Biology

Ch 7: Cell Structure and Functions. AP Biology Ch 7: Cell Structure and Functions AP Biology The Cell Theory 1. All living things are made of cells. 2. New cells come from existing cells. 3. Cells are the basic units of structure and function of living

More information

Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1

Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1 Name I. Multiple Choice (1 point each) Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1 B 1. Which is possessed by eukaryotes but not by prokaryotes? A. Cell wall B. Distinct nucleus

More information

Chapter 17. From Gene to Protein. Biology Kevin Dees

Chapter 17. From Gene to Protein. Biology Kevin Dees Chapter 17 From Gene to Protein DNA The information molecule Sequences of bases is a code DNA organized in to chromosomes Chromosomes are organized into genes What do the genes actually say??? Reflecting

More information


PROTEIN SYNTHESIS INTRO MR. POMERANTZ Page 1 of 6 Protein synthesis Intro. Use the text book to help properly answer the following questions 1. RNA differs from DNA in that RNA a. is single-stranded. c. contains the nitrogen

More information

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16 Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection

More information

GENETICS UNIT VOCABULARY CHART. Word Definition Word Part Visual/Mnemonic Related Words 1. adenine Nitrogen base, pairs with thymine in DNA and uracil

GENETICS UNIT VOCABULARY CHART. Word Definition Word Part Visual/Mnemonic Related Words 1. adenine Nitrogen base, pairs with thymine in DNA and uracil Word Definition Word Part Visual/Mnemonic Related Words 1. adenine Nitrogen base, pairs with thymine in DNA and uracil in RNA 2. allele One or more alternate forms of a gene Example: P = Dominant (purple);

More information

AQA Biology A-level. relationships between organisms. Notes.

AQA Biology A-level. relationships between organisms. Notes. AQA Biology A-level Topic 4: Genetic information, variation and relationships between organisms Notes DNA, genes and chromosomes Both DNA and RNA carry information, for instance DNA holds genetic information

More information

RNA Processing: Eukaryotic mrnas

RNA Processing: Eukaryotic mrnas RNA Processing: Eukaryotic mrnas Eukaryotic mrnas have three main parts (Figure 13.8): 5! untranslated region (5! UTR), varies in length. The coding sequence specifies the amino acid sequence of the protein

More information


DNA THE CODE OF LIFE 05 JULY 2014 LIFE SIENES N THE OE OF LIFE 05 JULY 2014 Lesson escription In this lesson we nswer questions on: o N, RN and Protein synthesis o The processes of mitosis and meiosis o omparison of the processes of meiosis

More information

Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:

Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail

More information

nucleus: DNA & chromosomes

nucleus: DNA & chromosomes nucleus: DNA & chromosomes chapter 5 nuclear organization nuclear structure nuclear envelope nucleoplasm nuclear matrix nucleolus nuclear envelope nucleolus nuclear matrix nucleoplasm nuclear pore nuclear

More information

1. In most cases, genes code for and it is that

1. In most cases, genes code for and it is that Name Chapter 10 Reading Guide From DNA to Protein: Gene Expression Concept 10.1 Genetics Shows That Genes Code for Proteins 1. In most cases, genes code for and it is that determine. 2. Describe what Garrod

More information

DNA, Chromosomes, and Genes

DNA, Chromosomes, and Genes N, hromosomes, and Genes 1 You have most likely already learned about deoxyribonucleic acid (N), chromosomes, and genes. You have learned that all three of these substances have something to do with heredity

More information

Lesson Overview. Ribosomes and Protein Synthesis 13.2

Lesson Overview. Ribosomes and Protein Synthesis 13.2 13.2 The Genetic Code The first step in decoding genetic messages is to transcribe a nucleotide base sequence from DNA to mrna. This transcribed information contains a code for making proteins. The Genetic

More information

Cell Division and Reproduction

Cell Division and Reproduction Cell Division and Reproduction What do you think this picture shows? If you guessed that it s a picture of two cells, you are right. In fact, the picture shows human cancer cells, and they are nearing

More information



More information

Cellular Neuroanatomy I The Prototypical Neuron: Soma. Reading: BCP Chapter 2

Cellular Neuroanatomy I The Prototypical Neuron: Soma. Reading: BCP Chapter 2 Cellular Neuroanatomy I The Prototypical Neuron: Soma Reading: BCP Chapter 2 Functional Unit of the Nervous System The functional unit of the nervous system is the neuron. Neurons are cells specialized

More information

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17. Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:

More information

The Complete Set Of Genetic Instructions In An Organism's Chromosomes Is Called The

The Complete Set Of Genetic Instructions In An Organism's Chromosomes Is Called The The Complete Set Of Genetic Instructions In An Organism's Chromosomes Is Called The What is a genome? A genome is an organism's complete set of genetic instructions. Single strands of DNA are coiled up

More information

1. Contains the sugar ribose instead of deoxyribose. 2. Single-stranded instead of double stranded. 3. Contains uracil in place of thymine.

1. Contains the sugar ribose instead of deoxyribose. 2. Single-stranded instead of double stranded. 3. Contains uracil in place of thymine. Protein Synthesis & Mutations RNA 1. Contains the sugar ribose instead of deoxyribose. 2. Single-stranded instead of double stranded. 3. Contains uracil in place of thymine. RNA Contains: 1. Adenine 2.

More information

Videos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.

Videos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu. Translation Translation Videos Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.be/itsb2sqr-r0 Translation Translation The

More information

Berg Tymoczko Stryer Biochemistry Sixth Edition Chapter 1:

Berg Tymoczko Stryer Biochemistry Sixth Edition Chapter 1: Berg Tymoczko Stryer Biochemistry Sixth Edition Chapter 1: Biochemistry: An Evolving Science Tips on note taking... Remember copies of my lectures are available on my webpage If you forget to print them

More information

Chapter 1 Molecules, Cells, and Model Organisms

Chapter 1 Molecules, Cells, and Model Organisms Chapter 1 Molecules, Cells, and Model Organisms 1.1 The Molecules of Life 1.2 Prokaryotic Cell Structure and Function 1.3 Eukaryotic Cell Structure and Function 1.4 Unicellular Eukaryotic Model Organisms

More information

Objective 3.01 (DNA, RNA and Protein Synthesis)

Objective 3.01 (DNA, RNA and Protein Synthesis) Objective 3.01 (DNA, RNA and Protein Synthesis) DNA Structure o Discovered by Watson and Crick o Double-stranded o Shape is a double helix (twisted ladder) o Made of chains of nucleotides: o Has four types

More information

MONTGOMERY COUNTY COMMUNITY COLLEGE BIO 140 CHAPTER 4. Functional Anatomy of Prokaryotic and Eukaryotic Cells

MONTGOMERY COUNTY COMMUNITY COLLEGE BIO 140 CHAPTER 4. Functional Anatomy of Prokaryotic and Eukaryotic Cells MONTGOMERY COUNTY COMMUNITY COLLEGE BIO 140 CHAPTER 4 Functional Anatomy of Prokaryotic and Eukaryotic Cells I. PROKARYOTES A. Structure Of The Cell: Chemical Composition And Function 1. Cell Wall a. composition

More information

Chapter 15 Active Reading Guide Regulation of Gene Expression

Chapter 15 Active Reading Guide Regulation of Gene Expression Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,

More information

Eukaryotic Gene Expression

Eukaryotic Gene Expression Eukaryotic Gene Expression Lectures 22-23 Several Features Distinguish Eukaryotic Processes From Mechanisms in Bacteria 123 Eukaryotic Gene Expression Several Features Distinguish Eukaryotic Processes

More information

WHAT DO CELLS DO? CHALLENGE QUESTION. What are the functions of the structures inside of cells?

WHAT DO CELLS DO? CHALLENGE QUESTION. What are the functions of the structures inside of cells? WHAT DO CELLS DO? CHALLENGE QUESTION What are the functions of the structures inside of cells? WHAT DO CELLS DO? Understanding normal cell structures and their functions help scientists understand how

More information

week: 4 Date: Microscopes Cell Structure Cell Function Standards None 1b, 1h 1b, 1h, 4f, 5a 1a, 1c, 1d, 1e, 1g, 1j

week: 4 Date: Microscopes Cell Structure Cell Function Standards None 1b, 1h 1b, 1h, 4f, 5a 1a, 1c, 1d, 1e, 1g, 1j July, 2004 week: 1 Topics Course introduction Lab Safety week: 2 Introduction to chemistry Chapter summarizing Note Taking week: 3 Biochemistry: Compounds of life week: 4 Microscopes Cell Structure Cell

More information

A DNA Sequence 2017/12/6 1

A DNA Sequence 2017/12/6 1 A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta

More information

Lecture 18 June 2 nd, Gene Expression Regulation Mutations

Lecture 18 June 2 nd, Gene Expression Regulation Mutations Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase

More information

Microbiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms

Microbiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms 1 2 Bergey s Manual of Systematic Bacteriology differs from Bergey s Manual of Determinative Bacteriology in that the former a. groups bacteria into species. b. groups bacteria according to phylogenetic

More information

GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H*" ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION

GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H* ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION FIFTH EDITION IV I ^HHk ^ttm IZTI/^Q i I II MPHBBMWBBIHB '-llwmpbi^hbwm^^pfc ' GSBHSRSBRSRRk LlML I I \l 1MB ^HP'^^MMMP" jflp^^^^^^^^st I Iv^O FROM GENES TO GENOMES %^MiM^PM^^MWi99Mi$9i0^^ ^^^^^^^^^^^^^V^^^fii^^t^i^^^^^

More information

Midterm Review Guide. Unit 1 : Biochemistry: 1. Give the ph values for an acid and a base. 2. What do buffers do? 3. Define monomer and polymer.

Midterm Review Guide. Unit 1 : Biochemistry: 1. Give the ph values for an acid and a base. 2. What do buffers do? 3. Define monomer and polymer. Midterm Review Guide Name: Unit 1 : Biochemistry: 1. Give the ph values for an acid and a base. 2. What do buffers do? 3. Define monomer and polymer. 4. Fill in the Organic Compounds chart : Elements Monomer

More information

Class IX: Biology Chapter 5: The fundamental unit of life. Chapter Notes. 1) In 1665, Robert Hooke first discovered and named the cells.

Class IX: Biology Chapter 5: The fundamental unit of life. Chapter Notes. 1) In 1665, Robert Hooke first discovered and named the cells. Class IX: Biology Chapter 5: The fundamental unit of life. Key learnings: Chapter Notes 1) In 1665, Robert Hooke first discovered and named the cells. 2) Cell is the structural and functional unit of all

More information

5.1 Cell Division and the Cell Cycle

5.1 Cell Division and the Cell Cycle 5.1 Cell Division and the Cell Cycle Lesson Objectives Contrast cell division in prokaryotes and eukaryotes. Identify the phases of the eukaryotic cell cycle. Explain how the cell cycle is controlled.

More information

What Organelle Makes Proteins According To The Instructions Given By Dna

What Organelle Makes Proteins According To The Instructions Given By Dna What Organelle Makes Proteins According To The Instructions Given By Dna This is because it contains the information needed to make proteins. assemble enzymes and other proteins according to the directions

More information

3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization.

3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization. 3.B.1 Gene Regulation Gene regulation results in differential gene expression, leading to cell specialization. We will focus on gene regulation in prokaryotes first. Gene regulation accounts for some of

More information

I. Molecules & Cells. A. Unit One: The Nature of Science. B. Unit Two: The Chemistry of Life. C. Unit Three: The Biology of the Cell.

I. Molecules & Cells. A. Unit One: The Nature of Science. B. Unit Two: The Chemistry of Life. C. Unit Three: The Biology of the Cell. I. Molecules & Cells A. Unit One: The Nature of Science a. How is the scientific method used to solve problems? b. What is the importance of controls? c. How does Darwin s theory of evolution illustrate

More information

Slide 1 / 54. Gene Expression in Eukaryotic cells

Slide 1 / 54. Gene Expression in Eukaryotic cells Slide 1 / 54 Gene Expression in Eukaryotic cells Slide 2 / 54 Central Dogma DNA is the the genetic material of the eukaryotic cell. Watson & Crick worked out the structure of DNA as a double helix. According

More information

Principles of Cellular Biology

Principles of Cellular Biology Principles of Cellular Biology آشنایی با مبانی اولیه سلول Biologists are interested in objects ranging in size from small molecules to the tallest trees: Cell Basic building blocks of life Understanding

More information

Eukaryotic vs. Prokaryotic genes

Eukaryotic vs. Prokaryotic genes BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 18: Eukaryotic genes http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Eukaryotic vs. Prokaryotic genes Like in prokaryotes,

More information


UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11 UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11 REVIEW: Signals that Start and Stop Transcription and Translation BUT, HOW DO CELLS CONTROL WHICH GENES ARE EXPRESSED AND WHEN? First of

More information

Microbiology with Diseases by Taxonomy, 5e (Bauman) Chapter 2 The Chemistry of Microbiology. 2.1 Multiple Choice Questions

Microbiology with Diseases by Taxonomy, 5e (Bauman) Chapter 2 The Chemistry of Microbiology. 2.1 Multiple Choice Questions Microbiology with Diseases by Taxonomy, 5e (Bauman) Chapter 2 The Chemistry of Microbiology 2.1 Multiple Choice Questions 1) Which of the following does not contribute significantly to the mass of an atom?

More information

Guided Notes Unit 4: Cellular Reproduction

Guided Notes Unit 4: Cellular Reproduction Name: Date: Block: Chapter 5: Cell Growth and Division I. Background Guided Notes Unit 4: Cellular Reproduction a. "Where a cell exists, there must have been a preexisting cell..." - Rudolf Virchow b.

More information

Energy Converion: Mitochondria and Chloroplasts. Pınar Tulay, Ph.D.

Energy Converion: Mitochondria and Chloroplasts. Pınar Tulay, Ph.D. Energy Converion: Mitochondria and Chloroplasts Pınar Tulay, Ph.D. pintulay@gmail.com Energy Conversion Prokaryotes use plasma membrane to produce adenosine triphosphate (ATP) used in the cell function

More information

The Physical Basis of Life

The Physical Basis of Life Origins of Life Physics 113 Goderya Chapter(s): 19 Learning Outcomes: The Physical Basis of Life All life forms on Earth, from viruses to complex mammals (including humans) are based on carbon chemistry.

More information

Prokaryotic Regulation

Prokaryotic Regulation Prokaryotic Regulation Control of transcription initiation can be: Positive control increases transcription when activators bind DNA Negative control reduces transcription when repressors bind to DNA regulatory

More information

Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation.

Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Protein Synthesis Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Protein Synthesis: Protein synthesis uses the information in genes to make proteins. 2 Steps

More information

Cell Division. Genetic info must be copied. Each cell gets a complete copy of that info. It occurs in two main stages:

Cell Division. Genetic info must be copied. Each cell gets a complete copy of that info. It occurs in two main stages: 10-2 Cell Division Key Questions: 1)What is the role of chromosomes in cell division? 2) What are the main events of the cell cycle? 3) What events occur during each of the four phases of mitosis? 4) How

More information

How many lessons is it?

How many lessons is it? Science Unit Learning Summary Content Eukaryotes and Prokaryotes Cells are the basic unit of all life forms. A eukaryotic cell contains genetic material enclosed within a nucleus. Plant and animal cells

More information

Gene Control Mechanisms at Transcription and Translation Levels

Gene Control Mechanisms at Transcription and Translation Levels Gene Control Mechanisms at Transcription and Translation Levels Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 9

More information

Student Workbook BIOLOGY. for NGSS

Student Workbook BIOLOGY. for NGSS Student Workbook BIOLOGY for NGSS LS1.A Cell Specialization & Organization Key terms base-pairing rule cell DNA eukaryotic cell gene hierarchical structure nucleotide organelle organ system prokaryotic

More information

MATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME

MATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME MATHEMATICAL MODELING AND THE HUMAN GENOME Hilary S. Booth Australian National University, Australia Keywords: Human genome, DNA, bioinformatics, sequence analysis, evolution. Contents 1. Introduction:

More information

2. Draw two water molecules. Using a dotted line, show a hydrogen bond that could form between them.

2. Draw two water molecules. Using a dotted line, show a hydrogen bond that could form between them. Biology Final Review Packet Directions: Answer the questions below. You may use any notes, worksheets, or your textbook to find the answers. The questions are divided up based on the different units we

More information

CELL PART Expanded Definition Cell Structure Illustration Function Summary Location ALL CELLS DNA Common in Animals Uncommon in Plants Lysosome

CELL PART Expanded Definition Cell Structure Illustration Function Summary Location ALL CELLS DNA Common in Animals Uncommon in Plants Lysosome CELL PART Expanded Definition Cell Structure Illustration Function Summary Location is the material that contains the Carry genetic ALL CELLS information that determines material inherited characteristics.

More information


SPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES. THE TERMS RUN AND TUMBLE ARE GENERALLY ASSOCIATED WITH A) cell wall fluidity. B) cell membrane structures. C) taxic movements of the cell. D) clustering properties of certain rod-shaped bacteria. A MAJOR

More information

Chapter 2: Chemistry. What does chemistry have to do with biology? Vocabulary BIO 105

Chapter 2: Chemistry. What does chemistry have to do with biology? Vocabulary BIO 105 Chapter 2: Chemistry What does chemistry have to do with biology? BIO 105 Vocabulary 1. Matter anything that takes up space and has mass Atoms are the smallest units of matter that can participate in chemical

More information

Extranuclear Inheritance

Extranuclear Inheritance Extranuclear Inheritance Extranuclear Inheritance The past couple of lectures, we ve been exploring exceptions to Mendel s principles of transmission inheritance. Scientists have observed inheritance patterns

More information

Topic 3: Genetics (Student) Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species.

Topic 3: Genetics (Student) Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species. Topic 3: Genetics (Student) 3.2 Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species. 3.2 Chromosomes 3.2.U1 Prokaryotes have one chromosome consisting of

More information

Full Name: Date: Per:

Full Name: Date: Per: Full Name: Date: Per: Quiz: Cell Processes and Microscope (60 points) DIRECTIONS: Clearly label the microscope below using the word bank WORD BANK: (words may be used more than once) Arm Base Body Tube

More information

Organisms: We will need to have some examples in mind for our spherical cows.

Organisms: We will need to have some examples in mind for our spherical cows. Lecture 4: Structure and Composition (Sept. 15) 4.1 Reading Assignment for Lectures 3-4: Phillips, Kondev, Theriot (PKT), Chapter 2 Problem Set 1 (due Sept. 24) now posted on the website. Cellular materials:

More information


CST and FINAL EXAM REVIEW Name Date Period CST and FINAL EXAM REVIEW Directions: Both your final exam and the CST (STAR) test are based on the California Standards. There are five major categories and they include: Investigation

More information

Cells & Cell Organelles. Doing Life s Work

Cells & Cell Organelles. Doing Life s Work Cells & Cell Organelles Doing Life s Work Types of cells bacteria cells Prokaryote - no organelles Eukaryotes - organelles animal cells plant cells Cell size comparison Animal cell Bacterial cell most

More information

Directed Reading A. Section: The Cell Cycle. you finish reading this sentence? THE LIFE OF A CELL. cell. Skills Worksheet

Directed Reading A. Section: The Cell Cycle. you finish reading this sentence? THE LIFE OF A CELL. cell. Skills Worksheet Skills Worksheet Directed Reading A Section: The Cell Cycle 1. Why is it important for your body to produce millions of new cells by the time you finish reading this sentence? THE LIFE OF A CELL 2. When

More information

Miller & Levine Biology 2014

Miller & Levine Biology 2014 A Correlation of Miller & Levine Biology To the Essential Standards for Biology High School Introduction This document demonstrates how meets the North Carolina Essential Standards for Biology, grades

More information

Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation.

Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Protein Synthesis Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Types of RNA Messenger RNA (mrna) makes a copy of DNA, carries instructions for making proteins,

More information

Bio/Life: Cell Biology

Bio/Life: Cell Biology Bio/Life: Cell Biology 1a The fundamental life processes of plants and animals depend on a variety of chemical reactions that occur in specialized areas of the organism's cells. As a basis for understanding

More information

Text of objective. Investigate and describe the structure and functions of cells including: Cell organelles

Text of objective. Investigate and describe the structure and functions of cells including: Cell organelles This document is designed to help North Carolina educators teach the s (Standard Course of Study). NCDPI staff are continually updating and improving these tools to better serve teachers. Biology 2009-to-2004

More information

c. Covalent bonds involve the transfer of electrons between atoms, and ionic bonds involve the sharing of neutrons between atoms. d.

c. Covalent bonds involve the transfer of electrons between atoms, and ionic bonds involve the sharing of neutrons between atoms. d. Final Exam Review *Disclaimer I do not have a PHD. Everything here is just speculation for what I think will be on your test. Your professor is going over everything that will be on your test 12/02/17

More information

2 The Cell Cycle. TAKE A LOOK 2. Complete Prokaryotic cells divide by.

2 The Cell Cycle. TAKE A LOOK 2. Complete Prokaryotic cells divide by. CHAPTER 5 2 The Cell Cycle SECTION The Cell in Action BEFORE YOU READ After you read this section, you should be able to answer these questions: How are new cells made? What is mitosis? What happens when

More information


M P BHOJ (OPEN) UNIVERSITY, BHOPAL ASSIGNMENT QUESTION PAPER PAPER :I Cell and molecular Biology of plants Q.1 Describe various models of Plasma membrane with its significance? OR Discuss role of Plasmodesmata in movements of moleculer and macromolecules? Q.2 Give

More information

Chapter Two: The Chemistry of Biology. The molecules of life make up the structure of cells Chemistry of biological molecule

Chapter Two: The Chemistry of Biology. The molecules of life make up the structure of cells Chemistry of biological molecule Chapter Two: The Chemistry of Biology The molecules of life make up the structure of cells Chemistry of biological molecule Atoms and Elements: Atoms: The basic units of all matter, containing three major

More information

THE CELL CYCLE & MITOSIS. Asexual Reproduction: Production of genetically identical offspring from a single parent.

THE CELL CYCLE & MITOSIS. Asexual Reproduction: Production of genetically identical offspring from a single parent. THE CELL CYCLE & MITOSIS Asexual Reproduction: Production of genetically identical offspring from a single parent. Sexual Reproduction: The fusion of two separate parent cells that produce offspring with

More information

Chapter 8. The Continuity of Life: How Cells Reproduce. Gregory Ahearn. Lectures by. Ammended by John Crocker. University of North Florida

Chapter 8. The Continuity of Life: How Cells Reproduce. Gregory Ahearn. Lectures by. Ammended by John Crocker. University of North Florida Chapter 8 The Continuity of Life: How Cells Reproduce Lectures by Gregory Ahearn University of North Florida Ammended by John Crocker Copyright 2009 Pearson Education, Inc. Review Questions for Chapters

More information

Lecture 14 - Cells. Astronomy Winter Lecture 14 Cells: The Building Blocks of Life

Lecture 14 - Cells. Astronomy Winter Lecture 14 Cells: The Building Blocks of Life Lecture 14 Cells: The Building Blocks of Life Astronomy 141 Winter 2012 This lecture describes Cells, the basic structural units of all life on Earth. Basic components of cells: carbohydrates, lipids,

More information

Cell Structure and Function

Cell Structure and Function Cell Structure and Function Cell size comparison Animal cell Bacterial cell What jobs do cells have to do for an organism to live Gas exchange CO 2 & O 2 Eat (take in & digest food) Make energy ATP Build

More information

Cell Structure, Function & Ultrastructure

Cell Structure, Function & Ultrastructure Cell Structure, Function & Ultrastructure Learning Objectives 2.1.2 Components of the cell as seen under the light microscope and their functions. Cell Structure and Function 1. Plant cells: cell wall,

More information

Chapter 10, 11, 14: Gene Expression, Regulation, and Development Exam

Chapter 10, 11, 14: Gene Expression, Regulation, and Development Exam Chapter 10, 11, 14: Gene Expression, Regulation, and Development Exam Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Why did the original one-gene, one-enzyme

More information

Unit 7: Cells and Life

Unit 7: Cells and Life Unit 7: Cells and Life Name: Period: Test Date: 1 Table of Contents Title of Page Page Number Due Date VIRUS vs CELLS CHECKLIST 3 Warm-ups 4-5 Virus Notes 6-7 Viral Reproduction Notes 8 Viruses VS Cells

More information

SHORT ANSWER. Write the word or phrase that best completes each statement or answers the question.

SHORT ANSWER. Write the word or phrase that best completes each statement or answers the question. ch 2 chemical basis of life Name SHORT ANSWER. Write the word or phrase that best completes each statement or answers the question. Fill in the blank or provide a short answer: 1) When a change in matter

More information

2/25/2013. Electronic Configurations

2/25/2013. Electronic Configurations 1 2 3 4 5 Chapter 2 Chemical Principles The Structure of Atoms Chemistry is the study of interactions between atoms and molecules The atom is the smallest unit of matter that enters into chemical reactions

More information

Special Topics on Genetics

Special Topics on Genetics ARISTOTLE UNIVERSITY OF THESSALONIKI OPEN COURSES Section 9: Transposable elements Drosopoulou E License The offered educational material is subject to Creative Commons licensing. For educational material,

More information

Describe the process of cell division in prokaryotic cells. The Cell Cycle

Describe the process of cell division in prokaryotic cells. The Cell Cycle The Cell Cycle Objective # 1 In this topic we will examine the cell cycle, the series of changes that a cell goes through from one division to the next. We will pay particular attention to how the genetic

More information

METHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task.

METHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Chapter 12 (Strikberger) Molecular Phylogenies and Evolution METHODS FOR DETERMINING PHYLOGENY In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Modern

More information

How do we define what it means to be alive?

How do we define what it means to be alive? How do we define what it means to be alive? Defining Life-7 Characteristics of Life There is no universal definition of life. To define life in unequivocal terms is still a challenge for scientists. Conventional

More information

Describe the structure and composition of the cell membrane. (make a sketch) What does the Theory of Endosymbiosis state?

Describe the structure and composition of the cell membrane. (make a sketch) What does the Theory of Endosymbiosis state? Station 1. Analyze the nature of the relationships between structures and functions in living cells. a. Explain the role of cell organelles for both prokaryotic and eukaryotic cells, including the cell

More information

What is the central dogma of biology?

What is the central dogma of biology? Bellringer What is the central dogma of biology? A. RNA DNA Protein B. DNA Protein Gene C. DNA Gene RNA D. DNA RNA Protein Review of DNA processes Replication (7.1) Transcription(7.2) Translation(7.3)

More information


Chapter 21 PROKARYOTES AND VIRUSES Chapter 21 PROKARYOTES AND VIRUSES Bozeman Video classification of life http://www.youtube.com/watch?v=tyl_8gv 7RiE Impacts, Issues: West Nile Virus Takes Off Alexander the Great, 336 B.C., conquered a

More information

Regulation of Gene Expression

Regulation of Gene Expression Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1)

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) 1) Which of the following statements about the atom A) It has 12 neutrons in its nucleus. B) It

More information


2017 DECEMBER BIOLOGY SEMESTER EXAM DISTRICT REVIEW Name: Period: 2017 DECEMBER BIOLOGY SEMESTER EXAM DISTRICT REVIEW 1. List the characteristics of living things. (p 7) 2. Use the Aquatic Food Web above to answer the following questions (Ch. 2) a. Which

More information

Vital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655)

Vital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655) We still consider the E. coli genome as a fairly typical bacterial genome, and given the extensive information available about this organism and it's lifestyle, the E. coli genome is a useful point of

More information