Introduction to Bioinformatics Integrated Science, 11/9/05
|
|
- Ruth Pope
- 5 years ago
- Views:
Transcription
1 1 Introduction to Bioinformatics Integrated Science, 11/9/05 Morris Levy Biological Sciences Research: Evolutionary Ecology, Plant- Fungal Pathogen Interactions Coordinator: BIOL 495S/CS490B/STAT490B Introduction to Bioinformatics Fall semester [Selected slides from Mark Levinthal and Daisuke Kihara] 1 Bioinformatics/Computational Biology Development and application of computational tools (algorithms*) for genome sequencing and massive data analysis * Systematic procedure for solving a problem in a finite number of steps; can be written in a computer language and run as a program.-mount) Interdisciplinary (Biol/CS/Stat) Emphases on determining sequence, structure and functional relationships of DNAs, genes, and proteins necessary for cell metabolism and organism development Databases and Information Management 2
2 2 DNA RNA protein phenotype genomic DNA databases cdna ESTs Expression profiles protein Sequence Structure databases 3 Research Areas in Bioinformatics Genomics: Sequence and organization of the genome (structural), gene finding and functional annotation; Comparative genomics Proteomics: structure and function of entire inventory of proteins produced Transcriptomics: gene expression profiles in cells, tissues, organs, organisms during development; comparative expression in disease pathology or genetic disorder Metabolomics: organization and flux of all cellular pathways (chemistry and physiology) Phylogenetics: evolutionary history of above 4
3 3 Plan of my three lecturers 1. Intro to bioinformatics: comparative genomics 2. Tutorial on NCBI database use incl. BLAST (Basic Local Alignment Search Tool) 3. Phylogenetic Informatics Always ask questions for clarification during lecture; even other questions 5 3 Domains of Life Archaea Prokaryote, lacks nuclear membrane, singlecell Initially found in extreme conditions, high temp., pressure, low ph Bacteria Prokaryote E.coli Eucarya/Eukarya Yeast (unicellular) a tree of life based human on small subunit rrna sequences (Pace, 2001). 6
4 4 Three Domains of Life + Endosymbiosis Monophyly but with horizontal transfer (eukaryotic organelles,i.e., mitochondria and chloroplasts, are bacterial in evolutionary origin) Closer relationship of the Archea and Eukaryota relative to Bacteria (share information processing genes) 7 Genome Sequences Human Genome Sequence Completed in
5 5 1995: genome of the bacterium Haemophilus influenzae is sequenced 9 10
6 6 Overview of bacterial complete genomes 11 MBGD database 12
7 7 Genome sizes in nucleotide base pairs plasmids viruses bacteria fungi plants The size of the human genome is ~ 3 x 10 9 base pairs and is thought to contain ~25,000-35,000 genes; protein coding genes = <2% of total genome (Why?) algae insects mollusks bony fish amphibians reptiles birds mammals Genes in the genome Organism Domain Genome size (KB) ORFs Ratio- Genome/ORF Escherichia coli Bacteria Bacillus subtilis Bacteria Methanobacterium thermoautotrophicum Archea Saccharomyces cerevisiae Eukaryote Single cell Caenorhabditis elegans Eukaryote nematode Oryza sativa Eukaryote plant Drosophila melanogaster Eukaryote insect
8 8 GC content varies across genomes Number of species in each GC class Bacteria Plants Invertebrates Vertebrates GC content (%) 15 Function Assignment BLAST/FASTA sequence comparison with genes of known function motif (protein folding structures) search via structure prediction Amount of Unknown Function in Genomes (201 Genomes) (Hawkins & Kihara) 16
9 9 Comparison Strategies for Deciphering Gene Function Genomes of closely related organisms Genomes of distantly related organisms Genomes vs. metabolic pathways, compounds *Inference: Conservation of sequence, physical order and/or phylogenetic clustering of genes implies their functional association 17 Dynamic rearrangement of genomes: Mycoplasma pneumoniae and Mycoplasma genitalium (Himmelreich et al., 1997) M. pneumoniae (1996) 732 genes M. genitalium (1995), 522 genes = smallest genome in self-replicating organisms 18
10 10 Genome map of two Mycoplasma sp. Method: FASTA/BLAST bidirectional hits 19 Dot-plots of closely related genomes (Suyama & Bork 2001) (a) (b) (c) (d) (e) (f) (g) (h) (i) Chlamydia pneumoniae, AR39 (CPa) & CWL029 (CP) Neisseria meningitidis, Z2491 (NMa) & MC58 (NMb) Helicobacter pylori, J99(HP99) & (HP) Chlamydia trachomatis, serov ar D (CT) & MoPn (CTm) Mycobacterium leprae (ML) & M. tuberculosis (MT) Pyrococcus horikoshii (PH) & P. abyssi (PA) E.coli (EC) & Vibrio cholerae chromosome 1 (VC1) Mycoplasma pneumoniae (MP) & M. genitalium (MG) CP & CT 20
11 11 Conservation of gene order (gene clusters) Danderkar, Snel, Huynen & Bork (1998) Analysis of selective constraints that preserve gene order Genomes to be compared should be not too far but not too close in evolutionary distance Reason for conservation: Physical interactions between coded proteins Operon: a unit of transcription which consists of several genes with related functions, (a) promoter region(s) and other regulatory sites 21 Conserved gene arrangements Ribosomal proteins ATP synthases Transporters ABC (ATP binding Cassette) transporters Enzyme pairs GroEL & GroES etc. Cell-division proteins Gene pairs of unknown function Tryptophan operon 22
12 12 Examples of proteins with the same phylogenetic profile (co-occurrence) A. Ribosomal proteins B. Flagellar structural proteins C. Histidine biosynthetic protein 23 Domain/gene fusion Genome 1 A B Genome 2 A B Two separate genes in one genome are fused into a single gene in another genome Most probably they are involved in the same function 24
13 13 Fusion proteins in human genome Domain Fusion Database: 25 Pathway database KEGG database: green= E.coli genes 26
14 14 Clusters of chemical compounds on pathways (Hattori, Okuno, Goto, Kanehisa 2003) Compounds in pathways are compared and clustered Sub-pathways with similar compounds sometimes correspond to operons of enzymes 27 Functional network of Escherichia coli 89 complete genomes Functional interactions can be predicted from: Conserved gene order Gene fusion events Common phylogenetic pattern 28
15 15 Summary: Comparative Genomics Conservation of the gene order, phylogenetic patterns, and gene fusion events detected by comparative genomics analyses implies functional association. Detection of orthologous genes (bidirectional best hits) is the basis of all above analyses. Combinations with pathway/compound associations broadens inferences for metabolic pathway analysis Gene/Gene family comparisons across phylogeny indicate functional diversification (not discussed- later see Dr. Mason re globin evolution) 29 References Comparative analysis of the genomes of the bacteria Mycoplasma pneumoniae and Mycoplasma genitalium. Himmelreich R et al. Nucleic Acid Research 25: (1997) Comparative genomics, minimal gene-sets, and the last universal common ancestor. Koonin EV. Nature Review Microbiology, 1: (2003) Evolution of prokaryotic gene order: genome rearrangements in closely related species. Suyama M & Bork P. Trends in Genetics, 17: (2001) Assigning protein functions by comparative genome analysis: Protein phylogenetic profiles. Pellegrini M,,,Eisenberg D, Yeates TO. Proc. Natl. Acad. Sci. USA 96: (1999) Development of a chemical structure comparison method for integrated analysis of chemical and genomic information in the metabolic pathways. Hattori M et al. J. Am. Chem. Soc. 125: (2003) The identification of functional modules from the genomic association of genes. Snel B, Bork P, Huynen MA. Proc. Natl. Acad. Sci. USA 99: (2002) Genome evolution reveals biochemical networks and functional modules. von Mering AC et al. Proc. Natl. Acad. Sci. USA 100: (2003) 30
2 Genome evolution: gene fusion versus gene fission
2 Genome evolution: gene fusion versus gene fission Berend Snel, Peer Bork and Martijn A. Huynen Trends in Genetics 16 (2000) 9-11 13 Chapter 2 Introduction With the advent of complete genome sequencing,
More informationThe Minimal-Gene-Set -Kapil PHY498BIO, HW 3
The Minimal-Gene-Set -Kapil Rajaraman(rajaramn@uiuc.edu) PHY498BIO, HW 3 The number of genes in organisms varies from around 480 (for parasitic bacterium Mycoplasma genitalium) to the order of 100,000
More informationComparative genomics: Overview & Tools + MUMmer algorithm
Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first
More informationGenome Annotation. Bioinformatics and Computational Biology. Genome sequencing Assembly. Gene prediction. Protein targeting.
Genome Annotation Bioinformatics and Computational Biology Genome Annotation Frank Oliver Glöckner 1 Genome Analysis Roadmap Genome sequencing Assembly Gene prediction Protein targeting trna prediction
More information# shared OGs (spa, spb) Size of the smallest genome. dist (spa, spb) = 1. Neighbor joining. OG1 OG2 OG3 OG4 sp sp sp
Bioinformatics and Evolutionary Genomics: Genome Evolution in terms of Gene Content 3/10/2014 1 Gene Content Evolution What about HGT / genome sizes? Genome trees based on gene content: shared genes Haemophilus
More informationBio 119 Bacterial Genomics 6/26/10
BACTERIAL GENOMICS Reading in BOM-12: Sec. 11.1 Genetic Map of the E. coli Chromosome p. 279 Sec. 13.2 Prokaryotic Genomes: Sizes and ORF Contents p. 344 Sec. 13.3 Prokaryotic Genomes: Bioinformatic Analysis
More informationGenetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.
Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:
More informationBiology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p.
READING: 14.2 Bacterial Genomes p. 481 14.3 Gene Transfer Mechanisms in Bacteria p. 486 Suggested Problems: 1, 7, 13, 14, 15, 20, 22 BACTERIAL GENETICS AND GENOMICS We still consider the E. coli genome
More informationEvolutionary Analysis by Whole-Genome Comparisons
JOURNAL OF BACTERIOLOGY, Apr. 2002, p. 2260 2272 Vol. 184, No. 8 0021-9193/02/$04.00 0 DOI: 184.8.2260 2272.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Evolutionary Analysis
More informationComputational approaches for functional genomics
Computational approaches for functional genomics Kalin Vetsigian October 31, 2001 The rapidly increasing number of completely sequenced genomes have stimulated the development of new methods for finding
More informationGenomes and Their Evolution
Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationComputational methods for predicting protein-protein interactions
Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational
More informationABSTRACT. As a result of recent successes in genome scale studies, especially genome
ABSTRACT Title of Dissertation / Thesis: COMPUTATIONAL ANALYSES OF MICROBIAL GENOMES OPERONS, PROTEIN FAMILIES AND LATERAL GENE TRANSFER. Yongpan Yan, Doctor of Philosophy, 2005 Dissertation / Thesis Directed
More informationVirginia Western Community College BIO 101 General Biology I
BIO 101 General Biology I Prerequisites Successful completion of MTE 1, 2, 3, 4, and 5; and a placement recommendation for ENG 111, co-enrollment in ENF 3/ENG 111, or successful completion of all developmental
More informationTaxonomy. Content. How to determine & classify a species. Phylogeny and evolution
Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature
More informationMETHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task.
Chapter 12 (Strikberger) Molecular Phylogenies and Evolution METHODS FOR DETERMINING PHYLOGENY In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Modern
More informationRelated Courses He who asks is a fool for five minutes, but he who does not ask remains a fool forever.
CSE 527 Computational Biology http://www.cs.washington.edu/527 Lecture 1: Overview & Bio Review Autumn 2004 Larry Ruzzo Related Courses He who asks is a fool for five minutes, but he who does not ask remains
More informationChapter 19. Microbial Taxonomy
Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)
More informationOrganization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p
Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p.110-114 Arrangement of information in DNA----- requirements for RNA Common arrangement of protein-coding genes in prokaryotes=
More informationMicrobial Diversity and Assessment (II) Spring, 2007 Guangyi Wang, Ph.D. POST103B
Microbial Diversity and Assessment (II) Spring, 007 Guangyi Wang, Ph.D. POST03B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm General introduction and overview Taxonomy [Greek
More informationFitness constraints on horizontal gene transfer
Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationThe minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
More informationDynamic optimisation identifies optimal programs for pathway regulation in prokaryotes. - Supplementary Information -
Dynamic optimisation identifies optimal programs for pathway regulation in prokaryotes - Supplementary Information - Martin Bartl a, Martin Kötzing a,b, Stefan Schuster c, Pu Li a, Christoph Kaleta b a
More informationChapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
More informationComputational Structural Bioinformatics
Computational Structural Bioinformatics ECS129 Instructor: Patrice Koehl http://koehllab.genomecenter.ucdavis.edu/teaching/ecs129 koehl@cs.ucdavis.edu Learning curve Math / CS Biology/ Chemistry Pre-requisite
More information3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization.
3.B.1 Gene Regulation Gene regulation results in differential gene expression, leading to cell specialization. We will focus on gene regulation in prokaryotes first. Gene regulation accounts for some of
More informationMicrobes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationMicrobial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationIntroduction to Bioinformatics. Shifra Ben-Dor Irit Orr
Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A
More informationCGS 5991 (2 Credits) Bioinformatics Tools
CAP 5991 (3 Credits) Introduction to Bioinformatics CGS 5991 (2 Credits) Bioinformatics Tools Giri Narasimhan 8/26/03 CAP/CGS 5991: Lecture 1 1 Course Schedules CAP 5991 (3 credit) will meet every Tue
More information11/24/13. Science, then, and now. Computational Structural Bioinformatics. Learning curve. ECS129 Instructor: Patrice Koehl
Computational Structural Bioinformatics ECS129 Instructor: Patrice Koehl http://www.cs.ucdavis.edu/~koehl/teaching/ecs129/index.html koehl@cs.ucdavis.edu Learning curve Math / CS Biology/ Chemistry Pre-requisite
More informationBSC 4934: QʼBIC Capstone Workshop" Giri Narasimhan. ECS 254A; Phone: x3748
BSC 4934: QʼBIC Capstone Workshop" Giri Narasimhan ECS 254A; Phone: x3748 giri@cs.fiu.edu http://www.cs.fiu.edu/~giri/teach/bsc4934_su10.html July 2010 7/12/10 Q'BIC Bioinformatics 1 Overview of Course"
More informationMouth animalcules (bacteria)
Mouth animalcules (bacteria) 1684 http://en.citizendium.org/images/thumb/9/94/leeuwenhoek.jpg/300px-leeuwenhoek.jpg Prokaryotic Cell Shapes Coccus - cocci Bacillus - bacillus Spirillum - spirilli Vibrio
More informationSPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES.
THE TERMS RUN AND TUMBLE ARE GENERALLY ASSOCIATED WITH A) cell wall fluidity. B) cell membrane structures. C) taxic movements of the cell. D) clustering properties of certain rod-shaped bacteria. A MAJOR
More informationAP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide
Name: Period: Date: AP Bio Module 6: Bacterial Genetics and Operons, Student Learning Guide Getting started. Work in pairs (share a computer). Make sure that you log in for the first quiz so that you get
More informationECOL/MCB 320 and 320H Genetics
ECOL/MCB 320 and 320H Genetics Instructors Dr. C. William Birky, Jr. Dept. of Ecology and Evolutionary Biology Lecturing on Molecular genetics Transmission genetics Population and evolutionary genetics
More informationMicrobial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationEvolutionary Use of Domain Recombination: A Distinction. Between Membrane and Soluble Proteins
1 Evolutionary Use of Domain Recombination: A Distinction Between Membrane and Soluble Proteins Yang Liu, Mark Gerstein, Donald M. Engelman Department of Molecular Biophysics and Biochemistry, Yale University,
More informationIntroduction to Biology
Introduction to Biology Course Description Introduction to Biology is an introductory course in the biological sciences. Topics included are biological macromolecules, cell biology and metabolism, DNA
More informationThe Gene The gene; Genes Genes Allele;
Gene, genetic code and regulation of the gene expression, Regulating the Metabolism, The Lac- Operon system,catabolic repression, The Trp Operon system: regulating the biosynthesis of the tryptophan. Mitesh
More informationGiri Narasimhan. CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Evaluation. Course Homepage.
CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 389; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs06.html 1/12/06 CAP5510/CGS5166 1 Evaluation
More informationBIOLOGY Grades Summer Units: 10 high school credits UC Requirement Category: d. General Description:
Summer 2015 Units: 10 high school credits UC Requirement Category: d General Description: BIOLOGY Grades 9-12 Summer session biology will be an intense, fast paced course. Students will gain an understanding
More informationBio 101 General Biology 1
Revised: Fall 2016 Bio 101 General Biology 1 COURSE OUTLINE Prerequisites: Prerequisite: Successful completion of MTE 1, 2, 3, 4, and 5, and a placement recommendation for ENG 111, co-enrollment in ENF
More informationBiology 112 Practice Midterm Questions
Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,
More informationBiology Science Crosswalk
SB1. Students will analyze the nature of the relationships between structures and functions in living cells. a. Explain the role of cell organelles for both prokaryotic and eukaryotic cells, including
More informationBacterial Genetics & Operons
Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the
More informationMicrobial Taxonomy and the Evolution of Diversity
19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy
More informationMicrobiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms
1 2 Bergey s Manual of Systematic Bacteriology differs from Bergey s Manual of Determinative Bacteriology in that the former a. groups bacteria into species. b. groups bacteria according to phylogenetic
More informationBioinformatics Chapter 1. Introduction
Bioinformatics Chapter 1. Introduction Outline! Biological Data in Digital Symbol Sequences! Genomes Diversity, Size, and Structure! Proteins and Proteomes! On the Information Content of Biological Sequences!
More informationMidterm Exam #1 : In-class questions! MB 451 Microbial Diversity : Spring 2015!
Midterm Exam #1 : In-class questions MB 451 Microbial Diversity : Spring 2015 Honor pledge: I have neither given nor received unauthorized aid on this test. Signed : Name : Date : TOTAL = 45 points 1.
More informationBioinformatics in the post-sequence era
Bioinformatics in the post-sequence era review Minoru Kanehisa 1 & Peer Bork 2 doi:10.1038/ng1109 In the past decade, bioinformatics has become an integral part of research and development in the biomedical
More informationBig Idea 1: The process of evolution drives the diversity and unity of life. Sunday, August 28, 16
Big Idea 1: The process of evolution drives the diversity and unity of life. Enduring understanding 1.B: Organisms are linked by lines of descent from common ancestry. Essential knowledge 1.B.1: Organisms
More informationSPRINGFIELD TECHNICAL COMMUNITY COLLEGE ACADEMIC AFFAIRS
SPRINGFIELD TECHNICAL COMMUNITY COLLEGE ACADEMIC AFFAIRS Course Number: BIOL 102 Department: Biological Sciences Course Title: Principles of Biology 1 Semester: Spring Year: 1997 Objectives/ 1. Summarize
More informationno.1 Raya Ayman Anas Abu-Humaidan
no.1 Raya Ayman Anas Abu-Humaidan Introduction to microbiology Let's start! As you might have concluded, microbiology is the study of all organisms that are too small to be seen with the naked eye, Ex:
More informationRCPS Curriculum Pacing Guide Subject: Biology. Remembering, Understanding, Applying, Analyzing, Evaluating, Creating
RCPS Curriculum Pacing Guide 2013 2014 Subject: Biology Week of: SOL # Unit Bloom s Objectives Week 1 and throughout the semester #BIO1 Scientific reasoning, logic and the nature of science Chapter 1 Biology:
More informationIntroductory Microbiology Dr. Hala Al Daghistani
Introductory Microbiology Dr. Hala Al Daghistani Why Study Microbes? Microbiology is the branch of biological sciences concerned with the study of the microbes. 1. Microbes and Man in Sickness and Health
More informationBIOLOGY (BIOL) Biology (BIOL) 1. BIOL 155 Introductory Microbiology Laboratory 1 credits
Biology (BIOL) 1 BIOLOGY (BIOL) BIOL 101 Perspectives in Biology Open only to majors. Intro to the disciplines in the fields of biology; current research topics. BIOL 102 Biology and Society Not open to
More informationI. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes.
I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes. A. Chemistry of Life B. Cells 1. Water How do the unique chemical
More informationPhylogeny & Systematics
Phylogeny & Systematics Phylogeny & Systematics An unexpected family tree. What are the evolutionary relationships among a human, a mushroom, and a tulip? Molecular systematics has revealed that despite
More informationI. Molecules & Cells. A. Unit One: The Nature of Science. B. Unit Two: The Chemistry of Life. C. Unit Three: The Biology of the Cell.
I. Molecules & Cells A. Unit One: The Nature of Science a. How is the scientific method used to solve problems? b. What is the importance of controls? c. How does Darwin s theory of evolution illustrate
More informationThe use of gene clusters to infer functional coupling
Proc. Natl. Acad. Sci. USA Vol. 96, pp. 2896 2901, March 1999 Genetics The use of gene clusters to infer functional coupling ROSS OVERBEEK*, MICHAEL FONSTEIN, MARK D SOUZA*, GORDON D. PUSCH*, AND NATALIA
More informationBIOLOGY I, PRE-AP. Section Description State Standard Addressed
Grade Level: 9 Course #: 3024T Length: Full Year Credits: Two Diploma: Core 40, Academic Honors Prerequisite: None COURSE DESCRIPTION: BIOLOGY I, PRE-AP This course is designed to introduce the student
More informationG4120: Introduction to Computational Biology
ICB Fall 2009 G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology & Immunology Copyright 2008 Oliver Jovanovic, All Rights Reserved. Genome
More informationUniversal Rules Governing Genome Evolution Expressed by Linear Formulas
The Open Genomics Journal, 8, 1, 33-3 33 Open Access Universal Rules Governing Genome Evolution Expressed by Linear Formulas Kenji Sorimachi *,1 and Teiji Okayasu 1 Educational Support Center and Center
More informationAP Biology. Read college-level text for understanding and be able to summarize main concepts
St. Mary's College AP Biology Continuity and Change Consider how specific changes to an ecosystem (geological, climatic, introduction of new organisms, etc.) can affect the organisms that live within it.
More informationHORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS
HORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS OVERVIEW INTRODUCTION MECHANISMS OF HGT IDENTIFICATION TECHNIQUES EXAMPLES - Wolbachia pipientis - Fungus - Plants - Drosophila ananassae
More information6.096 Algorithms for Computational Biology. Prof. Manolis Kellis
6.096 Algorithms for Computational Biology Prof. Manolis Kellis Today s Goals Introduction Class introduction Challenges in Computational Biology Gene Regulation: Regulatory Motif Discovery Exhaustive
More informationFundamentals of Biology Valencia College BSC1010C
1 Fundamentals of Biology Valencia College BSC1010C 1 Studying Life Chapter objectives: What Is Biology? Is All Life on Earth Related? How Do Biologists Investigate Life? How Does Biology Influence Public
More informationHorizontal transfer and pathogenicity
Horizontal transfer and pathogenicity Victoria Moiseeva Genomics, Master on Advanced Genetics UAB, Barcelona, 2014 INDEX Horizontal Transfer Horizontal gene transfer mechanisms Detection methods of HGT
More informationBio 1B Lecture Outline (please print and bring along) Fall, 2007
Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution
More informationBurton's Microbiology for the Health Sciences
Burton's Microbiology for the Health Sciences Chapter 3. Cell Structure and Taxonomy Chapter 3 Outline Introduction Eucaryotic Cell Structure Procaryotic Cell Structure Summary of Structural Differences
More informationBibb County Science Pacing Guide for Biology Parts A and B*
2018-19 Bibb County Science Pacing Guide for Biology Parts A and B* Georgia Standards of Excellence: Biology *Always use along with the Georgia Standards of Excellence for Science Biology: Curriculum Map
More informationBacillus anthracis. Last Lecture: 1. Introduction 2. History 3. Koch s Postulates. 1. Prokaryote vs. Eukaryote 2. Classifying prokaryotes
Last Lecture: Bacillus anthracis 1. Introduction 2. History 3. Koch s Postulates Today s Lecture: 1. Prokaryote vs. Eukaryote 2. Classifying prokaryotes 3. Phylogenetics I. Basic Cell structure: (Fig.
More informationINTERACTIVE CLUSTERING FOR EXPLORATION OF GENOMIC DATA
INTERACTIVE CLUSTERING FOR EXPLORATION OF GENOMIC DATA XIUFENG WAN xw6@cs.msstate.edu Department of Computer Science Box 9637 JOHN A. BOYLE jab@ra.msstate.edu Department of Biochemistry and Molecular Biology
More informationUnderstanding Science Through the Lens of Computation. Richard M. Karp Nov. 3, 2007
Understanding Science Through the Lens of Computation Richard M. Karp Nov. 3, 2007 The Computational Lens Exposes the computational nature of natural processes and provides a language for their description.
More informationBiology IA & IB Syllabus Mr. Johns/Room 2012/August,
Biology IA & IB Syllabus Mr. Johns/Room 2012/August, 2017-2018 Description of Course: A study of the natural world centers on cellular structure and the processes of life. First semester topics include:
More information2. Cellular and Molecular Biology
2. Cellular and Molecular Biology 2.1 Cell Structure 2.2 Transport Across Cell Membranes 2.3 Cellular Metabolism 2.4 DNA Replication 2.5 Cell Division 2.6 Biosynthesis 2.1 Cell Structure What is a cell?
More informationPRESCOTT UNIFIED SCHOOL DISTRICT District Instructional Guide
PRESCOTT UNIFIED SCHOOL DISTRICT District Instructional Guide Grade Level: High School Subject: Biology Quarter/Semester 1/1 Core Text: Biology, Miller & Levine, 2006 Time Block Unit Content Skills Standards
More informationMap of AP-Aligned Bio-Rad Kits with Learning Objectives
Map of AP-Aligned Bio-Rad Kits with Learning Objectives Cover more than one AP Biology Big Idea with these AP-aligned Bio-Rad kits. Big Idea 1 Big Idea 2 Big Idea 3 Big Idea 4 ThINQ! pglo Transformation
More informationGenome reduction in prokaryotic obligatory intracellular parasites of humans: a comparative analysis
International Journal of Systematic and Evolutionary Microbiology (2004), 54, 1937 1941 DOI 10.1099/ijs.0.63090-0 Genome reduction in prokaryotic obligatory intracellular parasites of humans: a comparative
More informationIntro to Prokaryotes Lecture 1 Spring 2014
Intro to Prokaryotes Lecture 1 Spring 2014 Meet the Prokaryotes 1 Meet the Prokaryotes 2 Meet the Prokaryotes 3 Why study prokaryotes? Deep Time 4 Fig. 25.7 Fossilized stromatolite (above) and living stromatolite
More informationIntroduction to Microbiology. CLS 212: Medical Microbiology Miss Zeina Alkudmani
Introduction to Microbiology CLS 212: Medical Microbiology Miss Zeina Alkudmani Microbiology Micro- means very small (that needs a microscope to see). Microbiology is the study of very small living organisms.
More informationComputational Cell Biology Lecture 4
Computational Cell Biology Lecture 4 Case Study: Basic Modeling in Gene Expression Yang Cao Department of Computer Science DNA Structure and Base Pair Gene Expression Gene is just a small part of DNA.
More informationVital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655)
We still consider the E. coli genome as a fairly typical bacterial genome, and given the extensive information available about this organism and it's lifestyle, the E. coli genome is a useful point of
More informationAdvanced Algorithms and Models for Computational Biology
Advanced Algorithms and Models for Computational Biology Introduction to cell biology genomics development and probability Eric ing Lecture January 3 006 Reading: Chap. DTM book Introduction to cell biology
More informationMicrobial Genetics, Mutation and Repair. 2. State the function of Rec A proteins in homologous genetic recombination.
Answer the following questions 1. Define genetic recombination. Microbial Genetics, Mutation and Repair 2. State the function of Rec A proteins in homologous genetic recombination. 3. List 3 types of bacterial
More informationChapter 1. How Do Biologists Study Life?
Chapter 1 How Do Biologists Study Life? Biology is the study of life Biologists ask questions about all aspects of living organisms Bios logos means a discourse on life in Greek Biology has many sub-disciplines
More informationComparing Prokaryotic and Eukaryotic Cells
A prokaryotic cell Basic unit of living organisms is the cell; the smallest unit capable of life. Features found in all cells: Ribosomes Cell Membrane Genetic Material Cytoplasm ATP Energy External Stimuli
More informationMicrobiology - Problem Drill 04: Prokayotic & Eukaryotic Cells - Structures and Functions
Microbiology - Problem Drill 04: Prokayotic & Eukaryotic Cells - Structures and Functions No. 1 of 10 1. Eukaryote is a word that describes one of two living cell classifications. The word comes from Greek
More informationConservation of Gene Co-Regulation between Two Prokaryotes: Bacillus subtilis and Escherichia coli
116 Genome Informatics 16(1): 116 124 (2005) Conservation of Gene Co-Regulation between Two Prokaryotes: Bacillus subtilis and Escherichia coli Shujiro Okuda 1 Shuichi Kawashima 2 okuda@kuicr.kyoto-u.ac.jp
More informationThis is a repository copy of Microbiology: Mind the gaps in cellular evolution.
This is a repository copy of Microbiology: Mind the gaps in cellular evolution. White Rose Research Online URL for this paper: http://eprints.whiterose.ac.uk/114978/ Version: Accepted Version Article:
More informationName: Class: Date: ID: A
Class: _ Date: _ Ch 17 Practice test 1. A segment of DNA that stores genetic information is called a(n) a. amino acid. b. gene. c. protein. d. intron. 2. In which of the following processes does change
More informationBioinformatics. Dept. of Computational Biology & Bioinformatics
Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS
More informationIntroduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1
Name I. Multiple Choice (1 point each) Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1 B 1. Which is possessed by eukaryotes but not by prokaryotes? A. Cell wall B. Distinct nucleus
More informationGACE Biology Assessment Test I (026) Curriculum Crosswalk
Subarea I. Cell Biology: Cell Structure and Function (50%) Objective 1: Understands the basic biochemistry and metabolism of living organisms A. Understands the chemical structures and properties of biologically
More informationIntroduction to cells
Almen Cellebiologi Introduction to cells 1. Unity and diversity of cells 2. Microscopes and visualization of cells 3. Prokaryotic cells, eubacteria and archaea 4. Eucaryotic cells, nucleus, mitochondria
More informationOutline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16
Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection
More informationTranslation - Prokaryotes
1 Translation - Prokaryotes Shine-Dalgarno (SD) Sequence rrna 3 -GAUACCAUCCUCCUUA-5 mrna...ggagg..(5-7bp)...aug Influences: Secondary structure!! SD and AUG in unstructured region Start AUG 91% GUG 8 UUG
More informationWarm Up. What are some examples of living things? Describe the characteristics of living things
Warm Up What are some examples of living things? Describe the characteristics of living things Objectives Identify the levels of biological organization and explain their relationships Describe cell structure
More information