Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc
|
|
|
- Percival Williamson
- 5 years ago
- Views:
Transcription
1 Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and Sm2 domains are shown. Black and gray shading indicates identical or similar residues, respectively, in at least half of the sequences. Sequence alignment was generated using CLUSTALW software (Thompson et al., 994) and edited with BioEdit software (Hall, 999).
2 Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc Supplemental Figure 2. Phylogenetic analysis of plant LSM proteins. The amino acid sequences of LSM proteins from Arabidopsis thaliana (At), Glycine max (Gm), Populus trichocarpa (Pt), Oryza sativa (Os), Zea mays (Zm) and Homo sapiens (Hs) were aligned with MAFFT software version 6 (Katoh and Toh, 28) and manually adjusted (the alignment is provided in Supplemental Data set online). The evolutionary history was inferred by using the Maximum Likelihood method based on the JTT matrix-based model, and represented with the bootstrap consensus tree. Boostrap support, from replicates, is shown on branches as a percentage. Branches reproduced in less than 5% bootstrap replicates are collapsed. The tree is drawn to scale, and the scale bar shows the number of substitutions per branch length. Evolutionary analyses were conducted with MEGA5 (Tamura et al., 2). A, B, C and D suffixes indicate different isoforms of a given LSM protein. Plant protein sequences were retrieved from Phytozome ( Goodstein et al., 22) using Arabidopsis LSM sequences to perform BLAST. The accession numbers for the represented proteins are described in Supplemental Data set 2E online. 2
3 Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc A B Supplemental Figure 3. Expression patterns of LSMA and LSMB genes. GUS activity in whole Arabidopsis plants containing the fusion LSMA PRO -GUS (A) or LSMB PRO -GUS (B). Bars = mm. 3
4 Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc LSMB/LSM2 LSMB/LSM4 LSMB/LSM8 LSM2/LSM3B LSM3B/LSM6A LSM6B/LSM5 LSM4/LSM6B LSM6B/LSM7 LSM3B/LSM5 Supplemental Figure 4. Visualization of in vivo interactions between Arabidopsis LSM proteins by BiFC assays. The corresponding LSM-nGFP/LSM-cGFP proteins were pairwise tested by Agrobacterium-mediated transformation in Nicotiana benthamiana leaves. Interactions between LSMB/LSM2, LSMB/LSM4, LSMB/LSM8, LSM2/LSM3B, LSM3B/LSM6A, LSM6B/LSM5, LSM4/LSM6B, LSM6B/LSM7 and LSM3B/LSM5 are presented. Bars = 2 µm. 4
5 Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc A No- lsma Col- lsmb B No- lsma Col- lsmb Supplemental Figure 5. Phenotypical analysis of lsma and lsmb single mutants. (A) and (B) Morphological phenotypes of No-, lsma, Col- and lsmb plants. Five-day-old seedlings (A) and 6-week-old plants (B). 5
6 Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc Germination (%) 2 ) Rosettearea(cm Root lenght (cm) Total leaf number A. Germination B. Abnormal seedlings C. Cotyledonary veins c-lsma D. Rosette size E. Petiole lenght Seedlings (%) cotyledons abnormal cotyledons F. Leaf area G. Root lenght H. Secondary roots I. Flowering time (LD) J. Flowering time (SD) K. Silique lenght L. Seed number c-lsma c-lsma c-lsma c-lsma Petiole lenght (cm) Secondary roots number Silique lenght (cm) c-lsma 8 6 ** ** * c-lsma c-lsma Supplemental Figure 6. Quantification of developmental phenotypes shown by lsm mutants. (A) to (L) Quantitative data on the developmental phenotypes exhibited by wild-type (),, c-lsma,,, and c- lsm8 plants. Percentage of germination 5 days after stratification. At least 3 seeds of each genotype were analyzed (A). Percentage of seedlings with abnormal shape or number of cotyledons. A minimum of 5 seedlings of each genotype were scored (B). Percentage of cotyledons showing closed areoles. Data were collected from at least 5 seedlings of each genotype (C). Area of rosettes from 4-week-old plants. A minimum of 25 plants of each genotype were measured (D). Petiole lengths of the st and 2nd leaves from -day-old plants. At least 25 petioles of each genotype were measured (E). Area of the 3rd and 4th leaves from 5-day-old plants. A minimum of 2 leaves of each genotype were measured (F). Length of the main root (G) and number of secondary roots (H) in -day-old plants. At least 6 plants of each genotype were analyzed. Flowering time in long-day (LD) (I) and short-day (SD) (J) photoperiods scored as total leaf numbers. A total of 24 plants of each genotype were scored. Length of the 6th and 7th siliques of the main stem. A minimum of 25 siliques of each genotype were measured (K). Number of seeds from the 6th and 7th siliques of the main stem. Seeds from at least 2 siliques of each genotype were counted (L). In all cases, data represent mean ± SD. Asterisks indicate significantly different data from according to a t-test (*P<.5, **P<., P<.). ** Cotyledons (%) 2 areoles 3 areoles 4 areoles 2 ) Total leaf number Leaf area (cm Seed number/silique ** c-lsma ** ** c-lsma c-lsma c-lsma 6
7 Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc A B C D lsma lsmb E Supplemental Figure 7. Complementation of the double mutant by LSMB. (A) to (E) Morphological phenotypes of wild-type (), and plants. Five-day-old seedlings (A), rosette leaves (B), siliques (C), seeds (D), and 6-week-old plants (E). 7
8 Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc A EXPL ATHSPRO2 B C D Relative expression,8,6,4,2 EIF4A rrna Relative expression Relative expression EXPL EIF4A rrna EXPL,8,6,4, ,8,6,4, No EXPL No-,8,6,4, min lsma ATHSPRO2,8,6,4, ,8,6 EIF4A,4, /4 5/8 9/ min 47/42 8/2 lsma,8,6,4,2 EIF4A E F Relative expression G H Relative expression I EXPL EIF4A,8,6,4,2 rrna EXPL EIF4A,8,6,4,2 rrna EXPL ATHSPRO2 EIF4A Col EXPL Col EXPL No- Col-,8 Col-,8,6,4, lsma Col- lsmb min lsmb 39/35 9/ min lsmb,8,6,4,2,6,4, ,8,6,4,2 EIF4A 49/46 6/5 EIF4A Supplemental Figure 8. mrna stability and accumulation of capped transcripts in, lsma, lsmb and plants. (A) to (H) Transcript accumulation in, lsma, lsmb and plants. Levels of several transcripts in 6- day-old Arabidopsis seedlings of and (A-B), No- and lsma (C-D), Col- and lsmb (E-F), and Col and (G-H) at different minutes (min) after cordycepin treatment. (A, C, E and G) RNA hybridization using specific probes. rrna levels were used as a loading control. The estimated half-life (min) of mrnas is shown to the right of each panel (/analyzed genotype). (B, D, F and H) Graphical representation of normalized data from gel quantification of all analyzed genes in and (B), No- and lsma (D), Col- and lsmb (F) or Col- and (H) seedlings. (I) Accumulation of capped transcripts corresponding to different genes in 6-day-old No-, lsma, Col-, lsmb and Arabidopsis seedlings by RACE-PCR. RACEPCR products were obtained using a high number of cycles in all cases. EIF4A RACE-PCR product is shown as a loading control. 8
9 Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc Supplemental Figure 9. Tiling array hybridization signals in representative genes showing intron retention events in the mutant. Vertical bars represent the signal intensity values obtained by comparing the signals for all the array probes along the selected genes between the mutant and. The structure of each gene (TAIR 7) is also represented: black boxes, narrow lines and border boxes symbolize exons, introns and untranslated regions, respectively. Orange boxes indicate intron retention events. Genome graphs displaying probe intensity data all over the gene structure were generated with the Integrated Genome Browser (Nicol et al., 29). 9
10 Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc U6 snrna h U3 snorna U4 snrna rrna Supplemental Figure. Stability of U6 snrna in the double mutant. Levels of U6 snrna, U3 snorna and U4 snrna in 6- day-old wild-type () and Arabidopsis seedlings at different hours (h) after cordycepin treatment, as shown by RNA hybridization using specific probes. rrna levels were used as a loading control.
11 Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc Supplemental References Goodstein, D.M., Shu, S., Howson, R., Neupane, R., Hayes, R.D., Fazo, J., Mitros, T., Dirks, W., Hellsten, U., Putnam, N., and Rokhsar, D.S. (22). Phytozome: a comparative platform for green plant genomics. Nucleic Acids Res. 4, Hall, T.A. (999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT Nucl. Acids Symp. Ser. 4, Katoh, K. and Toh, H. (28) Recent developments in the MAFFT multiple sequence alignment program. Brief. Bioinform. 9, Nicol J.W., Helt G.A., Blanchard S.G. Jr., Raja A. and Loraine A.E. (29). The Integrated Genome Browser: free software for distribution and exploration of genomescale datasets. Bioinformatics. 25, Tamura K., Peterson D., Peterson N., Stecher G., Nei M., and Kumar S. (2). MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution 28, Thompson, J.D., Higgins, D.G., and Gibson, T.J. (994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10534 Supplementary Fig. 1. Diagrammatic representation of the N-end rule pathway of targeted proteolysis (after Graciet and Wellmer 2010 9 ). Tertiary, secondary
Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.
Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods
Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc
Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation
Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type
A B 2 3 3 2 1 1 Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type (A) and d27 (B) seedlings at the four
Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc
Supplemental Data. Chen and Thelen (2010). Plant Cell 10.1105/tpc.109.071837 1 C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector
Supplemental Table 1. Primers used for cloning and PCR amplification in this study
Supplemental Table 1. Primers used for cloning and PCR amplification in this study Target Gene Primer sequence NATA1 (At2g393) forward GGG GAC AAG TTT GTA CAA AAA AGC AGG CTT CAT GGC GCC TCC AAC CGC AGC
** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.
Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *
Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids
Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Plant growth conditions The soil was a 1:1 v/v mixture of loamy soil and organic compost. Initial soil water content was determined
Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated
Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin
SUPPLEMENTARY INFORMATION
reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative
Supplemental Data. Perrella et al. (2013). Plant Cell /tpc
Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization
Development 143: doi: /dev : Supplementary information
Supplementary Materials and Methods Plant materials The mutants and transgenic plants used in the present study were as follows: E361 (from Alex Webb s laboratory); tmm-1, ptmm::tmm-gfp and flp-1 (from
Genome-wide Identification of Lineage Specific Genes in Arabidopsis, Oryza and Populus
Genome-wide Identification of Lineage Specific Genes in Arabidopsis, Oryza and Populus Xiaohan Yang Sara Jawdy Timothy Tschaplinski Gerald Tuskan Environmental Sciences Division Oak Ridge National Laboratory
Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed
Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed using the Geneious software. Accession numbers of the
Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering
Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering by Valverde et. Al Published in Science 2004 Presented by Boyana Grigorova CBMG 688R Feb. 12, 2007 Circadian Rhythms: The Clock Within
Supplemental Data. Hou et al. (2016). Plant Cell /tpc
Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc.16.295 A Distance to 1 st nt of start codon Distance to 1 st nt of stop codon B Normalized PARE abundance 8 14 nt 17 nt Frame1 Arabidopsis inflorescence
InDel 3-5. InDel 8-9. InDel 3-5. InDel 8-9. InDel InDel 8-9
Lecture 5 Alignment I. Introduction. For sequence data, the process of generating an alignment establishes positional homologies; that is, alignment provides the identification of homologous phylogenetic
Phylogenetic analyses. Kirsi Kostamo
Phylogenetic analyses Kirsi Kostamo The aim: To construct a visual representation (a tree) to describe the assumed evolution occurring between and among different groups (individuals, populations, species,
Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.
Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on
Supplemental Data. Wang et al. (2014). Plant Cell /tpc
Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and
Tex 25mer ssrna Binding Stoichiometry
Figure S. Determination of Tex:2nt ssrna binding stoichiometry using fluorescence polarization. Fluorescein labeled RNA was held at a constant concentration 2-fold above the K d. Tex protein was titrated
Supplementary Figure 1. Nature Biotechnology: doi: /nbt.4067
Supplementary Figure 1 Phylogenetic tree of GAUT Protein Family and gene model, RNAi construct, and relative transcript abundance of GAUT4 in switchgrass, rice and poplar knockdown (KD) lines. Phylogenetic
Supplementary Figure 1. Phenotype of the HI strain.
Supplementary Figure 1. Phenotype of the HI strain. (A) Phenotype of the HI and wild type plant after flowering (~1month). Wild type plant is tall with well elongated inflorescence. All four HI plants
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
Algorithms in Bioinformatics FOUR Pairwise Sequence Alignment. Pairwise Sequence Alignment. Convention: DNA Sequences 5. Sequence Alignment
Algorithms in Bioinformatics FOUR Sami Khuri Department of Computer Science San José State University Pairwise Sequence Alignment Homology Similarity Global string alignment Local string alignment Dot
Supplementary Information for Hurst et al.: Causes of trends of amino acid gain and loss
Supplementary Information for Hurst et al.: Causes of trends of amino acid gain and loss Methods Identification of orthologues, alignment and evolutionary distances A preliminary set of orthologues was
23-. Shoot and root development depend on ratio of IAA/CK
Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal
Table S1 List of primers used for genotyping and qrt-pcr.
Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!
Bioinformatics tools for phylogeny and visualization. Yanbin Yin
Bioinformatics tools for phylogeny and visualization Yanbin Yin 1 Homework assignment 5 1. Take the MAFFT alignment http://cys.bios.niu.edu/yyin/teach/pbb/purdue.cellwall.list.lignin.f a.aln as input and
CONCEPT OF SEQUENCE COMPARISON. Natapol Pornputtapong 18 January 2018
CONCEPT OF SEQUENCE COMPARISON Natapol Pornputtapong 18 January 2018 SEQUENCE ANALYSIS - A ROSETTA STONE OF LIFE Sequence analysis is the process of subjecting a DNA, RNA or peptide sequence to any of
Supplemental material
Supplemental material Table 1- Segregation analysis of sgt1a sgt1b double mutant plants Parental genotype No. of lines Normal seeds Phenotype Abnormal seeds Ratio of abnormal seeds (%) WT 3 171 2 1.16
Supplemental Data. Yang et al. (2012). Plant Cell /tpc
Supplemental Figure 1. Mature flowers of P. heterotricha. (A) An inflorescence of P. heterotricha showing the front view of a zygomorphic flower characterized by two small dorsal petals and only two fertile
MegAlign Pro Pairwise Alignment Tutorials
MegAlign Pro Pairwise Alignment Tutorials All demo data for the following tutorials can be found in the MegAlignProAlignments.zip archive here. Tutorial 1: Multiple versus pairwise alignments 1. Extract
Introduction to Bioinformatics Online Course: IBT
Introduction to Bioinformatics Online Course: IBT Multiple Sequence Alignment Building Multiple Sequence Alignment Lec1 Building a Multiple Sequence Alignment Learning Outcomes 1- Understanding Why multiple
Effects of Gap Open and Gap Extension Penalties
Brigham Young University BYU ScholarsArchive All Faculty Publications 200-10-01 Effects of Gap Open and Gap Extension Penalties Hyrum Carroll hyrumcarroll@gmail.com Mark J. Clement clement@cs.byu.edu See
Biological Roles of Cytokinins
Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators
Bioinformatics. Dept. of Computational Biology & Bioinformatics
Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS
Statistical Machine Learning Methods for Biomedical Informatics II. Hidden Markov Model for Biological Sequences
Statistical Machine Learning Methods for Biomedical Informatics II. Hidden Markov Model for Biological Sequences Jianlin Cheng, PhD William and Nancy Thompson Missouri Distinguished Professor Department
SUPPLEMENTARY INFORMATION
Figure S1. Haploid plant produced by centromere-mediated genome elimination Chromosomes containing altered CENH3 in their centromeres (green dots) are eliminated after fertilization in a cross to wild
Small RNA in rice genome
Vol. 45 No. 5 SCIENCE IN CHINA (Series C) October 2002 Small RNA in rice genome WANG Kai ( 1, ZHU Xiaopeng ( 2, ZHONG Lan ( 1,3 & CHEN Runsheng ( 1,2 1. Beijing Genomics Institute/Center of Genomics and
PYR1 PYL1 PYL2 PYL3 PYL4 PYL5 PYL6 PYL7 PYL8 PYL9 PYL10 PYL11/12
Supplemental Data. Gonzalez-Guzman et al. Plant Cell. (212). 1.115/tpc.112.98574 Supplemental Figure 1. Gene expression levels of the PYR/PYL/RCAR ABA receptors in the Arabidopsis transcriptome genomic
. Supplementary Information
. Supplementary Information Supplementary Figure S1. Mature embryo sac observations. Supplementary Figure S2. STT observations. Supplementary Figure S3. Comparison of the PTB1 cdna with that of the mutant.
Supplemental Information. The Mitochondrial Fission Receptor MiD51. Requires ADP as a Cofactor
Structure, Volume 22 Supplemental Information The Mitochondrial Fission Receptor MiD51 Requires ADP as a Cofactor Oliver C. Losón, Raymond Liu, Michael E. Rome, Shuxia Meng, Jens T. Kaiser, Shu-ou Shan,
Phylogenies Scores for Exhaustive Maximum Likelihood and Parsimony Scores Searches
Int. J. Bioinformatics Research and Applications, Vol. x, No. x, xxxx Phylogenies Scores for Exhaustive Maximum Likelihood and s Searches Hyrum D. Carroll, Perry G. Ridge, Mark J. Clement, Quinn O. Snell
Statistical Machine Learning Methods for Bioinformatics II. Hidden Markov Model for Biological Sequences
Statistical Machine Learning Methods for Bioinformatics II. Hidden Markov Model for Biological Sequences Jianlin Cheng, PhD Department of Computer Science University of Missouri 2008 Free for Academic
Supplementary Table 1. Primers used in this study.
Supplementary Tale 1. Primers used in this study. Name Primer sequence (5'-3') Primers of PCR-ased molecular markers developed in this study M1 F M1 R M2 F M2 R M3 F M3 R M4 F M4 R M5 F M5 R M6 F M6 R
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12791 Supplementary Figure 1 (1/3) WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 1 (2/3) 2 WWW.NATURE.COM/NATURE SUPPLEMENTARY
A greedy, graph-based algorithm for the alignment of multiple homologous gene lists
A greedy, graph-based algorithm for the alignment of multiple homologous gene lists Jan Fostier, Sebastian Proost, Bart Dhoedt, Yvan Saeys, Piet Demeester, Yves Van de Peer, and Klaas Vandepoele Bioinformatics
Araport, a community portal for Arabidopsis. Data integration, sharing and reuse. sergio contrino University of Cambridge
Araport, a community portal for Arabidopsis. Data integration, sharing and reuse sergio contrino University of Cambridge Acknowledgements J Craig Venter Institute Chris Town Agnes Chan Vivek Krishnakumar
Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2
Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2 IRT1, FRO2 and FIT expression levels in roots of the wild-type, nas4x- 1 and nas4x-2, showing that in both nas mutants
THEORY. Based on sequence Length According to the length of sequence being compared it is of following two types
Exp 11- THEORY Sequence Alignment is a process of aligning two sequences to achieve maximum levels of identity between them. This help to derive functional, structural and evolutionary relationships between
Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST
Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST Introduction Bioinformatics is a powerful tool which can be used to determine evolutionary relationships and
The Phylogenetic Handbook
The Phylogenetic Handbook A Practical Approach to DNA and Protein Phylogeny Edited by Marco Salemi University of California, Irvine and Katholieke Universiteit Leuven, Belgium and Anne-Mieke Vandamme Rega
Supplementary Information for: The genome of the extremophile crucifer Thellungiella parvula
Supplementary Information for: The genome of the extremophile crucifer Thellungiella parvula Maheshi Dassanayake 1,9, Dong-Ha Oh 1,9, Jeffrey S. Haas 1,2, Alvaro Hernandez 3, Hyewon Hong 1,4, Shahjahan
Model plants and their Role in genetic manipulation. Mitesh Shrestha
Model plants and their Role in genetic manipulation Mitesh Shrestha Definition of Model Organism Specific species or organism Extensively studied in research laboratories Advance our understanding of Cellular
Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.
Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny
Dr. Amira A. AL-Hosary
Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological
Introduction to Evolutionary Concepts
Introduction to Evolutionary Concepts and VMD/MultiSeq - Part I Zaida (Zan) Luthey-Schulten Dept. Chemistry, Beckman Institute, Biophysics, Institute of Genomics Biology, & Physics NIH Workshop 2009 VMD/MultiSeq
Sequence Alignment Techniques and Their Uses
Sequence Alignment Techniques and Their Uses Sarah Fiorentino Since rapid sequencing technology and whole genomes sequencing, the amount of sequence information has grown exponentially. With all of this
"Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky
MOLECULAR PHYLOGENY "Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky EVOLUTION - theory that groups of organisms change over time so that descendeants differ structurally
Nature Genetics: doi: /ng Supplementary Figure 1. The FIN and FAB genes act separately from the meristem maturation pathway.
Supplementary Figure 1 The FIN and FAB genes act separately from the meristem maturation pathway. (a) Representative inflorescence from the compound inflorescence (s, defective in the homolog of Arabidopsis
Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao
New Phytologist Supporting Information Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bhlh transcription factor MtTT8 Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang
Sara C. Madeira. Universidade da Beira Interior. (Thanks to Ana Teresa Freitas, IST for useful resources on this subject)
Bioinformática Sequence Alignment Pairwise Sequence Alignment Universidade da Beira Interior (Thanks to Ana Teresa Freitas, IST for useful resources on this subject) 1 16/3/29 & 23/3/29 27/4/29 Outline
BIOINFORMATICS LAB AP BIOLOGY
BIOINFORMATICS LAB AP BIOLOGY Bioinformatics is the science of collecting and analyzing complex biological data. Bioinformatics combines computer science, statistics and biology to allow scientists to
Supplementary Methods
Supplementary Methods Microarray analysis Grains of 7 DAP of the wild-type and gif1 were harvested for RNA preparation. Microarray analysis was performed with the Affymetrix (Santa Clara, CA) GeneChip
BINF6201/8201. Molecular phylogenetic methods
BINF60/80 Molecular phylogenetic methods 0-7-06 Phylogenetics Ø According to the evolutionary theory, all life forms on this planet are related to one another by descent. Ø Traditionally, phylogenetics
GFP GAL bp 3964 bp
Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive
Bioinformatics Chapter 1. Introduction
Bioinformatics Chapter 1. Introduction Outline! Biological Data in Digital Symbol Sequences! Genomes Diversity, Size, and Structure! Proteins and Proteomes! On the Information Content of Biological Sequences!
GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL
GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,
Browsing Genomic Information with Ensembl Plants
Browsing Genomic Information with Ensembl Plants Etienne de Villiers, PhD (Adapted from slides by Bert Overduin EMBL-EBI) Outline of workshop Brief introduction to Ensembl Plants History Content Tutorial
Sequence Bioinformatics. Multiple Sequence Alignment Waqas Nasir
Sequence Bioinformatics Multiple Sequence Alignment Waqas Nasir 2010-11-12 Multiple Sequence Alignment One amino acid plays coy; a pair of homologous sequences whisper; many aligned sequences shout out
Symmetric Tree, ClustalW. Divergence x 0.5 Divergence x 1 Divergence x 2. Alignment length
ONLINE APPENDIX Talavera, G., and Castresana, J. (). Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Systematic Biology, -. Symmetric
Growth and development of Arabidopsis thaliana under single-wavelength red
1 Supplementary Information 2 3 4 Growth and development of Arabidopsis thaliana under single-wavelength red and blue laser light 5 6 7 8 Authors Amanda Ooi 1 *, Aloysius Wong 1 *, Tien Khee Ng 2, Claudius
Unsupervised Learning in Spectral Genome Analysis
Unsupervised Learning in Spectral Genome Analysis Lutz Hamel 1, Neha Nahar 1, Maria S. Poptsova 2, Olga Zhaxybayeva 3, J. Peter Gogarten 2 1 Department of Computer Sciences and Statistics, University of
The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively as positive regulators of salt stress tolerance in rice
Lou et al. BMC Plant Biology (2018) 18:203 https://doi.org/10.1186/s12870-018-1408-0 RESEARCH ARTICLE Open Access The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively
THE ROLE OF THE PHYTOCHROME B PHOTORECEPTOR IN THE REGULATION OF PHOTOPERIODIC FLOWERING. AnitaHajdu. Thesis of the Ph.D.
THE ROLE OF THE PHYTOCHROME B PHOTORECEPTOR IN THE REGULATION OF PHOTOPERIODIC FLOWERING AnitaHajdu Thesis of the Ph.D. dissertation Supervisor: Dr. LászlóKozma-Bognár - senior research associate Doctoral
THE LSM1-7 COMPLEX DIFFERENTIALLY REGULATES ARABIDOPSIS TOLERANCE TO ABIOTIC STRESS CONDITIONS BY PROMOTING SELECTIVE mrna DECAPPING
Plant Cell Advance Publication. Published on January 13, 2016, doi:10.1105/tpc.16.00867 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 THE LSM1-7 COMPLEX DIFFERENTIALLY
BIOINFORMATICS: An Introduction
BIOINFORMATICS: An Introduction What is Bioinformatics? The term was first coined in 1988 by Dr. Hwa Lim The original definition was : a collective term for data compilation, organisation, analysis and
08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega
BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments
Grundlagen der Bioinformatik Summer semester Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SS 10, D. Huson, April 12, 2010 1 1 Introduction Grundlagen der Bioinformatik Summer semester 2010 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a)
Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication
SUPPORTING ONLINE MATERIALS Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication Bin Cong, Luz Barrero, & Steven Tanksley 1 SUPPORTING
Supplementary Figure 3
Supplementary Figure 3 7.0 Col Kas-1 Line FTH1A 8.4 F3PII3 8.9 F26H11 ATQ1 T9I22 PLS8 F26B6-B 9.6 F27L4 9.81 F27D4 9.92 9.96 10.12 10.14 10.2 11.1 0.5 Mb T1D16 Col % RGR 83.3 101 227 93.5 75.9 132 90 375
Cladistics and Bioinformatics Questions 2013
AP Biology Name Cladistics and Bioinformatics Questions 2013 1. The following table shows the percentage similarity in sequences of nucleotides from a homologous gene derived from five different species
Supplementary Information
Supplementary Information Rice APC/C TE controls tillering through mediating the degradation of MONOCULM 1 Qibing Lin 1*, Dan Wang 1*, Hui Dong 2*, Suhai Gu 1, Zhijun Cheng 1, Jie Gong 2, Ruizhen Qin 1,
PGA: A Program for Genome Annotation by Comparative Analysis of. Maximum Likelihood Phylogenies of Genes and Species
PGA: A Program for Genome Annotation by Comparative Analysis of Maximum Likelihood Phylogenies of Genes and Species Paulo Bandiera-Paiva 1 and Marcelo R.S. Briones 2 1 Departmento de Informática em Saúde
Measuring plant response to virus infection and water stress
Measuring plant response to virus infection and water stress van den Brink RC, Austin PT, Arthur KR, MacDiarmid RM, Hedderley DI Valmonte G, Immanuel T, Fagaloa-Time M, Higgins C Introduction can we quantify
Ethylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis
Ethylene is critical to the maintenance of primary root growth and Fe homeostasis under Fe stress in Arabidopsis Guangjie Li, Weifeng Xu, Herbert J. Kronzucker, Weiming Shi * Supplementary Data Supplementary
PETIOLE VARIATION IN QUAKING ASPEN 1
PETIOLE VARIATION IN QUAKING ASPEN 1 Group 11 Proposal: An Investigation on Petiole Variation in Quaking Aspen Alexander Shu, Amy Loret, and Hunter Frederiksen University of Utah PETIOLE VARIATION IN QUAKING
Comparative Protein Modeling of Superoxide Dismutase Isoforms in Maize.
Comparative Protein Modeling of Superoxide Dismutase Isoforms in Maize. Kaliyugam Shiriga 1, 2, Rinku Sharma 1, Krishan Kumar 2, Firoz Hossain 1 and NepoleanThirunavukkarasu 1* Division of Genetics, Indian
DEGseq: an R package for identifying differentially expressed genes from RNA-seq data
DEGseq: an R package for identifying differentially expressed genes from RNA-seq data Likun Wang Zhixing Feng i Wang iaowo Wang * and uegong Zhang * MOE Key Laboratory of Bioinformatics and Bioinformatics
Regulation of Phosphate Homeostasis by microrna in Plants
Regulation of Phosphate Homeostasis by microrna in Plants Tzyy-Jen Chiou 1 *, Kyaw Aung 1,2, Shu-I Lin 1,3, Chia-Chune Wu 1, Su-Fen Chiang 1, and Chun-Lin Su 1 Abstract Upon phosphate (Pi) starvation,
Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells
Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells By: Patrick Rutledge 1 Dr. Jennifer Lorang 2,3, Dr. Marc Curtis 2,3, Dr. Thomas Wolpert 2,3 BioResource Research 1, Botany and
Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut
Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic analysis Phylogenetic Basics: Biological
Genomics and bioinformatics summary. Finding genes -- computer searches
Genomics and bioinformatics summary 1. Gene finding: computer searches, cdnas, ESTs, 2. Microarrays 3. Use BLAST to find homologous sequences 4. Multiple sequence alignments (MSAs) 5. Trees quantify sequence
Computational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
Arabidopsis COMPASS-Like Complexes Mediate Histone H3 Lysine-4 Trimethylation to Control Floral Transition and Plant Development
Arabidopsis COMPASS-Like Complexes Mediate Histone H3 Lysine-4 Trimethylation to Control Floral Transition and Plant Development Danhua Jiang 1,2, Nicholas C. Kong 1,2, Xiaofeng Gu 2, Zicong Li 1, Yuehui
Nature Genetics: doi: /ng Supplementary Figure 1. Icm/Dot secretion system region I in 41 Legionella species.
Supplementary Figure 1 Icm/Dot secretion system region I in 41 Legionella species. Homologs of the effector-coding gene lega15 (orange) were found within Icm/Dot region I in 13 Legionella species. In four
SUPPLEMENTARY INFORMATION
Supplemental Methods Isolation and mapping of SPCH An EMS-mutagenized population of tmm-1 (Col);E1728 (an enhancer trap GFP marking guard cells) was created. M2 seeds were collected from M1 s planted in
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/452/ra106/dc1 Supplementary Materials for Stem-piped light activates phytochrome B to trigger light responses in Arabidopsis thaliana roots Hyo-Jun Lee, Jun-Ho
Additional file 10. Classification of Pac sequences based on maximum-likelihood (ML) phylogenetic analyses. Analyses were performed on the same
Additional file 10. Classification of Pac sequences based on maximum-likelihood (ML) phylogenetic analyses. Analyses were performed on the same dataset alignments used for crucial Neighbor-joining trees