Plant transformation

Size: px
Start display at page:

Download "Plant transformation"

Transcription

1 Plant transformation Objectives: 1. What is plant transformation? 2. What is Agrobacterium? How and why does it transform plant cells? 3. How is Agrobacterium used as a tool in molecular genetics? References: Hooykaas and Schilperoort Agrobacterium and plant genetic engineering. Plant Molecular Biology 19: Westhoff et al. Molecular Plant Development:from gene to plant. Chapter 7,

2 Plant transformation Introduction of exogenous DNA into a plant cell Transient no incorporation of exogenous DNA into the genome Stable incorporation of introduced exogenous DNA into the genome Transformation of multicellular organisms: C t di tl t f ll T f ti Cannot directly transform every cell - Transformation involves one cell which then regenerates an entire organism

3 Agrobacterium tumefaciens: a natural tool for plant transformation ti Soil gram positive bacterium Martha Hawes Agrobacterium tumefaciens attached to a plant cell

4 Agrobacterium tumefaciens: a natural tool for plant transformation ti Causes Crown Gall disease - tumors (galls) form at base of stem in many dicots Photographs supplied by Sharon von Broembsen, Oklahoma State University production of tumors is caused by the transfer of bacterial DNA to the plant, which integrates into the plant genome

5 Agrobacterium tumefaciens: a natural tool for plant transformation ti Genes involved in crown gall disease are not present on the chromosome of A. tumefaciens but on a large plasmid, called the Ti (tumor-inducing) plasmid. Ti A. tumefaciens Circular chromosome vir genes LB T-DNA Ti plasmid ~ 120 kbp ori RB

6 A. tumefaciens T-DNA Structure LB RB Shi Shi Roi Nos LB and RB 25 bp repeats Nos - nopaline synthase opine biosynthetic i gene* * Shi - shoot inducing - 2 genes for auxin synthesis* Roi - root inducing - gene for cytokinin synthesis* *have eukaryotic promoters these genes are not expressed in Agrobacterium!!!

7 T-DNA transfer into plants T-DNA transfer process is activated when Agrobacterium gets in contact with damaged plant tissue T-DNA is nicked at the RB, T-DNA gets replicated to the LB and moved into the plant cell this is catalyzed by products of vir genes

8 T-DNA transfer into plants T-DNA is inserted into plant nuclear genome at random sites Transformed cell starts proliferating upon DNA integration resulting in tumor formation. Why? Transformed cells make opines - specific nutrients (type of amino acids) for bacterium ( Genetic colonization )

9 Agrobacterium tumefaciens as a tool for genetic engineering i Problem: tumor How can we engineer the Ti plasmid to make it useful? Delete auxin and cytokinin genes Retain vir genes, LB&RB, ori Ti plasmid is huge (~120 kb) need to make it smaller

10 Agrobacterium tumefaciens as a tool for genetic engineering i vir genes and T-DNA can be on separate plasmids only left and right borders (LB & RB) are required for T-DNA to be transferred Cloning site for plant genes LB Selectable marker (Plants) vir genes Ti plasmid T-DNA Binary vector RB Selectable marker (Bacteria) ori ori (E.coli) ori (Agrobacterium)

11 Steps in plant transformation 1. Propagate binary vector in E. coli 2. Isolate binary vector from E.coli and engineer (introduce a foreign gene) 3. Re-introduce engineered binary vector into E. coli to amplify 4. Isolate engineered binary vector and introduce into Agrobacterium containing a modified (smaller) Ti plasmid 5. Infect plant tissue with engineered Agrobacterium (T-DNA containing the foreign gene gets inserted into a plant cell genome)

12 Plant transformation In each cell T-DNA gets integrated at a different site in the genome Each cell is hemizygous for the insertion only one of the homologous chromosomes gets the insertion Consequences of the insertion: - Foreign DNA is inserted - Insertional mutagenesis (does not kill the cell the organism is diploid!)

13 Plant transformation Problem: We want to transform the whole organism, not one cell!!! This is done by: Transforming plant cells in culture, selecting transformed cells and regenerating the entire plant from the transformed cell (eg. tobacco)

14

15 Plant transformation Problem: We want to transform the whole organism, not one cell!!! This is done by: Transforming plant cells in culture, selecting transformed cells and regenerating the entire plant from the transformed cell (eg. tobacco) In planta transformation of Arabidopsis - Dip flowering plants into Agrobacterium suspension - Harvest seed and select for transformants (they are hemizygous!)

16 Plant transformation plbio.life.ku.dk In planta transformation of Arabidopsis (Floral dip method) Systemic infection in Arabidopsis is accomplished by transformation of female gametes!

Last time: Obtaining information from a cloned gene

Last time: Obtaining information from a cloned gene Last time: Obtaining information from a cloned gene Objectives: 1. What is the biochemical role of the gene? 2. Where and when is the gene expressed (transcribed)? 3. Where and when is the protein made?

More information

Ti plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines

Ti plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines Ti plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines Mitesh Shrestha Constraints of Wild type Ti/Ri-plasmid Very large

More information

AGRO- BACTERIUM MEDIATED GENE TRANSFER IN PLANTS

AGRO- BACTERIUM MEDIATED GENE TRANSFER IN PLANTS MODULE 5- LECTURE 4 AGRO- BACTERIUM MEDIATED GENE TRANSFER IN PLANTS 5-4.1. Introduction Agrobacterium is considered as the nature s genetic engineer. Agrobacterium tumefaciens is a rod shaped, gram negative

More information

AGROBACTERIUM. First described by Smith and Townsend (1907) Responsible for crown gall. Performed Koch's postulates

AGROBACTERIUM. First described by Smith and Townsend (1907) Responsible for crown gall. Performed Koch's postulates AGROBACTERIUM First described by Smith and Townsend (1907) Responsible for crown gall Performed Koch's postulates The disease is worldwide in distribution Speciation was based on pathogenicity Agrobacterium

More information

Agrobacterium tumefasciens, the Ti Plasmid, and Crown Gall Tumorigenesis

Agrobacterium tumefasciens, the Ti Plasmid, and Crown Gall Tumorigenesis Agrobacterium tumefasciens, the Ti Plasmid, and Crown Gall Tumorigenesis BOM-11: 10.9 Plasmids: General Principles (review) p. 274 10.11 Conjugation: Essential Features (review) p. 278 19.21 Agrobacterium

More information

AMADEPA Association Martiniquaise pour le Developpement des Plantes Alimentaires

AMADEPA Association Martiniquaise pour le Developpement des Plantes Alimentaires AMADEPA Association Martiniquaise pour le Developpement des Plantes Alimentaires 29eme CONGRES ANNUEL ANNUAL MEETING REUNION ANNUAL Agriculture Intensive dans les Iles de la Caraibe : enjeux, contraintes

More information

Bacterial Genetics & Operons

Bacterial Genetics & Operons Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the

More information

Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p.

Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p. READING: 14.2 Bacterial Genomes p. 481 14.3 Gene Transfer Mechanisms in Bacteria p. 486 Suggested Problems: 1, 7, 13, 14, 15, 20, 22 BACTERIAL GENETICS AND GENOMICS We still consider the E. coli genome

More information

Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha

Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary

More information

Unit 2: Cellular Chemistry, Structure, and Physiology Module 5: Cellular Reproduction

Unit 2: Cellular Chemistry, Structure, and Physiology Module 5: Cellular Reproduction Unit 2: Cellular Chemistry, Structure, and Physiology Module 5: Cellular Reproduction NC Essential Standard: 1.2.2 Analyze how cells grow and reproduce in terms of interphase, mitosis, and cytokinesis

More information

Why mitosis?

Why mitosis? Mitosis occurs only in eukaryotes. Prokaryotes (i.e., archaea and bacteria) divide via binary fission. Mitosis is the process by which the somatic cells of all multicellular organisms multiply. Somatic

More information

Methods of genetic transformation :

Methods of genetic transformation : Indirect transformation: Genetic transformation of plant tissues with the use of Agrobacterium, Ti-plasmid and mechanism of T-DNA transfer (different protein involved and their role, vir region and other

More information

Major Plant Hormones 1.Auxins 2.Cytokinins 3.Gibberelins 4.Ethylene 5.Abscisic acid

Major Plant Hormones 1.Auxins 2.Cytokinins 3.Gibberelins 4.Ethylene 5.Abscisic acid Plant Hormones Lecture 9: Control Systems in Plants What is a Plant Hormone? Compound produced by one part of an organism that is translocated to other parts where it triggers a response in target cells

More information

Introduction to Molecular and Cell Biology

Introduction to Molecular and Cell Biology Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What

More information

Plant and animal cells (eukaryotic cells) have a cell membrane, cytoplasm and genetic material enclosed in a nucleus.

Plant and animal cells (eukaryotic cells) have a cell membrane, cytoplasm and genetic material enclosed in a nucleus. 4.1 Cell biology Cells are the basic unit of all forms of life. In this section we explore how structural differences between types of cells enables them to perform specific functions within the organism.

More information

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology 2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the

More information

THE NOPALINE SYNTHASE PROMOTER AS A MODEL SYSTEM FOR STUDYING PLANT RESPONSE TO UV-B

THE NOPALINE SYNTHASE PROMOTER AS A MODEL SYSTEM FOR STUDYING PLANT RESPONSE TO UV-B International Journal of Environmentally Conscious Design & Manufacturing, Vol. 10, No. 3, 2001-2002 THE NOPALINE SYNTHASE PROMOTER AS A MODEL SYSTEM FOR STUDYING PLANT RESPONSE TO UV-B GYUNG-HEE YU AND

More information

Chapter 27: Bacteria and Archaea

Chapter 27: Bacteria and Archaea Name Period Overview 1. The chapter opens with amazing tales of life at the extreme edge. What are the masters of adaptation? Describe the one case you thought most dramatic. Concept 27.1 Structural and

More information

Introduction. Phylogeny. Taxonomy

Introduction. Phylogeny. Taxonomy jim_3-1-4.fm Page 91 Thursday, October 6, 2005 5:19 PM CHAPTER 3.1.4 eth sun Ge um i retcabor Ag The Genus Agrobacterium ANN G. MATTHYSSE Introduction The genus Agrobacterium is a group of Gramnegative

More information

Assist. Prof. Martina Šeruga Musić acad. year 2016/17

Assist. Prof. Martina Šeruga Musić acad. year 2016/17 Assist. Prof. Martina Šeruga Musić acad. year 2016/17 PHYTOPATHOGENIC BACTERIA there are more than 100 species of known phytopathogenic bacteria genera Agrobacterium, Erwinia, Ralstonia, Pseudomonas, Xanthomonas,

More information

Part II. Agrobacterium rhizogenes-mediated Gene Transfer

Part II. Agrobacterium rhizogenes-mediated Gene Transfer Part II Agrobacterium rhizogenes-mediated Gene Transfer Introduction II Agrobacterium rhizogenes, a Natural Transformation System D. TEPFER Plant-microorganism interactions are based on exchanges of nutritional

More information

Questions for Biology IIB (SS 2006) Wilhelm Gruissem

Questions for Biology IIB (SS 2006) Wilhelm Gruissem Questions for Biology IIB (SS 2006) Plant biology Wilhelm Gruissem The questions for my part of Biology IIB, Plant Biology, are provided for self-study and as material for the exam. Please note that the

More information

Chapter 19. Gene creatures, Part 1: viruses, viroids and plasmids. Prepared by Woojoo Choi

Chapter 19. Gene creatures, Part 1: viruses, viroids and plasmids. Prepared by Woojoo Choi Chapter 19. Gene creatures, Part 1: viruses, viroids and plasmids Prepared by Woojoo Choi Dead or alive? 1) In this chapter we will explore the twilight zone of biology and the gene creature who live there.

More information

Anaphase, Telophase. Animal cells divide their cytoplasm by forming? Cleavage furrow. Bacteria, Paramecium, Amoeba, etc. reproduce by...

Anaphase, Telophase. Animal cells divide their cytoplasm by forming? Cleavage furrow. Bacteria, Paramecium, Amoeba, etc. reproduce by... The 4 phases of mitosis Animal cells divide their cytoplasm by forming? Bacteria, Paramecium, Amoeba, etc. reproduce by... Cell which after division is identical to the original is called a Prophase, Metaphase,

More information

Plant and animal cells (eukaryotic cells) have a cell membrane, cytoplasm and genetic material enclosed in a nucleus.

Plant and animal cells (eukaryotic cells) have a cell membrane, cytoplasm and genetic material enclosed in a nucleus. 4.1 Cell biology Cells are the basic unit of all forms of life. In this section we explore how structural differences between types of cells enables them to perform specific functions within the organism.

More information

Using Crossbreeding and Hybrids

Using Crossbreeding and Hybrids Lesson C2 5 Using Crossbreeding and Hybrids Unit C. Plant and Soil Science Problem Area 2. Basic Principles of Plant Science Lesson 5. Using Crossbreeding and Hybrids New Mexico Content Standard: Pathway

More information

(A) Heterotrophs produce some organic nutrients, and must absorb inorganic nutrients from the environment.

(A) Heterotrophs produce some organic nutrients, and must absorb inorganic nutrients from the environment. MCAT Biology - Problem Drill 09: Prokaryotes and Fungi Question No. 1 of 10 Instructions: (1) Read the problem and answer choices carefully; (2) Work the problems on paper as needed; (3) Pick the correct

More information

Somaclonal Variation

Somaclonal Variation Tissue-culture cycle involves: dedifferentiation in culture proliferation of cells (implies sev. cell generations removed from original differentiated cell) subsequent regeneration to plants no selection

More information

CELL GROWTH AND DIVISION. Chapter 10

CELL GROWTH AND DIVISION. Chapter 10 CELL GROWTH AND DIVISION Chapter 10 Cell division = The formation of 2 daughter cells from a single parent cell Increases ratio of surface area to volume for each cell Allows for more efficient exchange

More information

Sporic life cycles involve 2 types of multicellular bodies:

Sporic life cycles involve 2 types of multicellular bodies: Chapter 3- Human Manipulation of Plants Sporic life cycles involve 2 types of multicellular bodies: -a diploid, spore-producing sporophyte -a haploid, gamete-producing gametophyte Sexual Reproduction in

More information

AP Biology Unit 6 Practice Test 1. A group of cells is assayed for DNA content immediately following mitosis and is found to have an average of 8

AP Biology Unit 6 Practice Test 1. A group of cells is assayed for DNA content immediately following mitosis and is found to have an average of 8 AP Biology Unit 6 Practice Test Name: 1. A group of cells is assayed for DNA content immediately following mitosis and is found to have an average of 8 picograms of DNA per nucleus. How many picograms

More information

Universiteit van Pretoria University of Pretoria. Mikrobiologie 251 Toets Maart 2012 Microbiology 251 Test March Examiners: Dr L Moleleki

Universiteit van Pretoria University of Pretoria. Mikrobiologie 251 Toets Maart 2012 Microbiology 251 Test March Examiners: Dr L Moleleki Universiteit van Pretoria University of Pretoria Mikrobiologie 251 Toets Maart 2012 Microbiology 251 Test March 2012 Tyd: 1 uur Time: 1 hour Eksaminatore: Dr L Moleleki Examiners: Dr L Moleleki Beantwoord

More information

Topic 8 Mitosis & Meiosis Ch.12 & 13. The Eukaryotic Genome. The Eukaryotic Genome. The Eukaryotic Genome

Topic 8 Mitosis & Meiosis Ch.12 & 13. The Eukaryotic Genome. The Eukaryotic Genome. The Eukaryotic Genome Topic 8 Mitosis & Meiosis Ch.12 & 13 The Eukaryotic Genome pp. 244-245,268-269 Genome All of the genes in a cell. Eukaryotic cells contain their DNA in long linear pieces. In prokaryotic cells, there is

More information

Cell Division: the process of copying and dividing entire cells The cell grows, prepares for division, and then divides to form new daughter cells.

Cell Division: the process of copying and dividing entire cells The cell grows, prepares for division, and then divides to form new daughter cells. Mitosis & Meiosis SC.912.L.16.17 Compare and contrast mitosis and meiosis and relate to the processes of sexual and asexual reproduction and their consequences for genetic variation. 1. Students will describe

More information

THE CELL CYCLE & MITOSIS. Asexual Reproduction: Production of genetically identical offspring from a single parent.

THE CELL CYCLE & MITOSIS. Asexual Reproduction: Production of genetically identical offspring from a single parent. THE CELL CYCLE & MITOSIS Asexual Reproduction: Production of genetically identical offspring from a single parent. Sexual Reproduction: The fusion of two separate parent cells that produce offspring with

More information

How many lessons is it?

How many lessons is it? Science Unit Learning Summary Content Eukaryotes and Prokaryotes Cells are the basic unit of all life forms. A eukaryotic cell contains genetic material enclosed within a nucleus. Plant and animal cells

More information

Cell Division and Reproduction

Cell Division and Reproduction Cell Division and Reproduction What do you think this picture shows? If you guessed that it s a picture of two cells, you are right. In fact, the picture shows human cancer cells, and they are nearing

More information

The Science of Plants in Agriculture Pl.Sci 102. Getting to Know Plants

The Science of Plants in Agriculture Pl.Sci 102. Getting to Know Plants The Science of Plants in Agriculture Pl.Sci 102 Getting to Know Plants Growth and Development of Plants Growth and Development of Plants Why it s important to have knowledge about plant development. What

More information

CELL CYCLE UNIT GUIDE- Due January 19, 2016

CELL CYCLE UNIT GUIDE- Due January 19, 2016 CELL CYCLE UNIT GUIDE- Due January 19, 2016 Monday Tuesday Wednesday Thursday Friday January 4- No School 5-Cell Cycle/Mitosis 6-Cell Cycle/ Mitosis 7-Mitosis 8-Meiosis Reading Check Quiz #1 sections 5.1-5.5

More information

The impact of Agrobacterium tumefaciens and other soil borne disease causing agents of economic importance in production of roses

The impact of Agrobacterium tumefaciens and other soil borne disease causing agents of economic importance in production of roses The impact of Agrobacterium tumefaciens and other soil borne disease causing agents of economic importance in production of roses Video conference on global competitiveness of the flower industry in the

More information

Unit 6 Test: The Cell Cycle

Unit 6 Test: The Cell Cycle Name Date Class Mrs. Knight Biology EHS Unit 6 Test: The Cell Cycle 1. What are the four main stages of the cell cycle (correct order)? A. G 1, S, G 0, M C. G 2, S, G 1, M B. G 1, S, G 2, M D. M, G 2,

More information

SPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES.

SPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES. THE TERMS RUN AND TUMBLE ARE GENERALLY ASSOCIATED WITH A) cell wall fluidity. B) cell membrane structures. C) taxic movements of the cell. D) clustering properties of certain rod-shaped bacteria. A MAJOR

More information

Cell Division: the process of copying and dividing entire cells The cell grows, prepares for division, and then divides to form new daughter cells.

Cell Division: the process of copying and dividing entire cells The cell grows, prepares for division, and then divides to form new daughter cells. Mitosis & Meiosis SC.912.L.16.17 Compare and contrast mitosis and meiosis and relate to the processes of sexual and asexual reproduction and their consequences for genetic variation. 1. Students will describe

More information

5.1 Cell Division and the Cell Cycle

5.1 Cell Division and the Cell Cycle 5.1 Cell Division and the Cell Cycle Lesson Objectives Contrast cell division in prokaryotes and eukaryotes. Identify the phases of the eukaryotic cell cycle. Explain how the cell cycle is controlled.

More information

no.1 Raya Ayman Anas Abu-Humaidan

no.1 Raya Ayman Anas Abu-Humaidan no.1 Raya Ayman Anas Abu-Humaidan Introduction to microbiology Let's start! As you might have concluded, microbiology is the study of all organisms that are too small to be seen with the naked eye, Ex:

More information

Chapter 6: Cell Growth and Reproduction Lesson 6.1: The Cell Cycle and Mitosis

Chapter 6: Cell Growth and Reproduction Lesson 6.1: The Cell Cycle and Mitosis Chapter 6: Cell Growth and Reproduction Lesson 6.1: The Cell Cycle and Mitosis No matter the type of cell, all cells come from preexisting cells through the process of cell division. The cell may be the

More information

Applying crown gall research-based knowledge to orchard management. E. Fichtner, UCCE Tulare County

Applying crown gall research-based knowledge to orchard management. E. Fichtner, UCCE Tulare County Applying crown gall research-based knowledge to orchard management E. Fichtner, UCCE Tulare County Paradox: Juglans hindsii x Juglans regia Crown Gall Common in walnut Paradox rootstock susceptible Less

More information

Mitosis & Meiosis Practice Questions

Mitosis & Meiosis Practice Questions Name: Date: 1. The diagram shown represents a cell that will undergo mitosis. Which diagrams below best illustrate the nuclei of the daughter cells that result from a normal mitotic cell division of the

More information

#2 How do organisms grow?

#2 How do organisms grow? #2 How do organisms grow? Why doesn t a cell keep growing larger and larger? The larger a cell becomes the more demands the cell places on its DNA. The cell also has trouble moving enough nutrients and

More information

LAB 8 EUKARYOTIC CELL DIVISION: MITOSIS AND MEIOSIS

LAB 8 EUKARYOTIC CELL DIVISION: MITOSIS AND MEIOSIS LAB 8 EUKARYOTIC CELL DIVISION: MITOSIS AND MEIOSIS Name: Date: INTRODUCTION BINARY FISSION: Prokaryotic cells (bacteria) reproduce asexually by binary fission. Bacterial cells have a single circular chromosome,

More information

Glimpses of a Century-Old Story

Glimpses of a Century-Old Story Glimpses of a Century-Old Story Agrobacterium, a Pathogen Deployed for Genetic Engineering Jasmine M Shah Jasmine M Shah is a postdoctoral fellow, Department of Biotechnology, Indian Institute of Technology-Madras.

More information

Cryotherapy: A New Method to Eliminate Pathogens from Sweetpotato Propagation Materials

Cryotherapy: A New Method to Eliminate Pathogens from Sweetpotato Propagation Materials Cryotherapy: A New Method to Eliminate Pathogens from Sweetpotato Propagation Materials Margaret Worthington Graduate Group in Horticulture and Agronomy University of California, Davis April 14, 2009 http://www.judithbarathart.com

More information

Agrobacterium-Mediated Plant Transformation: the Biology behind the Gene-Jockeying Tool

Agrobacterium-Mediated Plant Transformation: the Biology behind the Gene-Jockeying Tool MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS, Mar. 2003, p. 16 37 Vol. 67, No. 1 1092-2172/03/$08.00 0 DOI: 10.1128/MMBR.67.1.16 37.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved.

More information

DNA Technology, Bacteria, Virus and Meiosis Test REVIEW

DNA Technology, Bacteria, Virus and Meiosis Test REVIEW Be prepared to turn in a completed test review before your test. In addition to the questions below you should be able to make and analyze a plasmid map. Prokaryotic Gene Regulation 1. What is meant by

More information

Biology Notes 2. Mitosis vs Meiosis

Biology Notes 2. Mitosis vs Meiosis Biology Notes 2 Mitosis vs Meiosis Diagram Booklet Cell Cycle (bottom corner draw cell in interphase) Mitosis Meiosis l Meiosis ll Cell Cycle Interphase Cell spends the majority of its life in this phase

More information

Why do we have to cut our hair, nails, and lawn all the time?

Why do we have to cut our hair, nails, and lawn all the time? Chapter 5 Cell Reproduction Mitosis Think about this Why do we have to cut our hair, nails, and lawn all the time? EQ: Why is cell division necessary for the growth & development of living organisms? Section

More information

Binary fission occurs in prokaryotes. parent cell. DNA duplicates. cell begins to divide. daughter cells

Binary fission occurs in prokaryotes. parent cell. DNA duplicates. cell begins to divide. daughter cells Chapter 11 Chapter 11 Some eukaryotes reproduce through mitosis. Binary fission is similar in function to mitosis. Asexual reproduction is the creation of offspring from a single parent. Binary fission

More information

A DNA Sequence 2017/12/6 1

A DNA Sequence 2017/12/6 1 A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta

More information

Lab tomorrow: Bacterial Diseases. Bacteria

Lab tomorrow: Bacterial Diseases. Bacteria Lab tomorrow: Bacterial Diseases Quiz: Koch s Postulates (p. 17-19), Botrytis Predisposition (p. 97)., And, intros for Bacteria (pp 67-69), Biocontrol of Crown Gall (p. 117), and Observation of Viral Movement

More information

BACTERIA AND ARCHAEA 10/15/2012

BACTERIA AND ARCHAEA 10/15/2012 BACTERIA AND ARCHAEA Chapter 27 KEY CONCEPTS: Structural and functional adaptations contribute to prokaryotic success Rapid reproduction, mutation, and genetic recombination promote genetic diversity in

More information

Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach

Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach ABSTRACT SUBMITTED TO JAMIA MILLIA ISLAMIA NEW DELHI IN PARTIAL FULFILMENT OF

More information

Name: Period: EOC Review Part F Outline

Name: Period: EOC Review Part F Outline Name: Period: EOC Review Part F Outline Mitosis and Meiosis SC.912.L.16.17 Compare and contrast mitosis and meiosis and relate to the processes of sexual and asexual reproduction and their consequences

More information

Biology 321 Genetics Winter 2009

Biology 321 Genetics Winter 2009 Biology 321 Genetics Winter 2009 Dr. Sandra Schulze Office BI409 Office Hours: WF 4:00PM 5:00PM Grading Exam I: 25% Exam II: 25% Exam III: 25% Problem sets 25%* No specific grades for attendance or participation,

More information

Ecology of Infectious Disease

Ecology of Infectious Disease Ecology of Infectious Disease What is the basis of community robustness (resistance to invasion)? How does robustness influence disease development? The Microbial Context: Microbial Interactions Affect

More information

tumefaciens Attachment to Zea mays, Gladiolus sp.,

tumefaciens Attachment to Zea mays, Gladiolus sp., JOURNAL OF BACTERIOLOGY, May 1988, p. 2395-2400 Vol. 170, No. 5 0021-9193/88/052395-06$02.00/0 Copyright 1988, American Society for Microbiology Scanning Electron Microscope Studies of Agrobacterium tumefaciens

More information

Mitosis. Meiosis MP3. Why do cells divide? Why Do Cells Need To Divide? Vocab List Chapter 10 & 11. What has to happen before a cell divides? divides?

Mitosis. Meiosis MP3. Why do cells divide? Why Do Cells Need To Divide? Vocab List Chapter 10 & 11. What has to happen before a cell divides? divides? MP3 Vocab List Chapter 10 & 11 Mitosis Anaphase Mitosis Cell Cycle Telophase Cytokinesis Cell Division Metaphase 4 Daughter Cells Prophase Meiosis Diploid Somatic Cells Interphase Haploid Parent Cell Gametes

More information

Bacterial spot of pepper and tomato

Bacterial spot of pepper and tomato Website to brush up on bacterial diseases Bacterial spot of pepper and tomato http://www.apsnet.org/edcenter/intropp/lessons/prokaryotes/pages/bacterialspot.aspx Potato blackleg and soft rot http://www.apsnet.org/edcenter/intropp/lessons/prokaryotes/pages/blacklegpotato.aspx

More information

CELL REPRODUCTION. Mitotic M phase Mitosis. Chromosomes divide. Cytokinesis. Cytoplasm and cell membrane divide. Chromosomes as Packaged Genes

CELL REPRODUCTION. Mitotic M phase Mitosis. Chromosomes divide. Cytokinesis. Cytoplasm and cell membrane divide. Chromosomes as Packaged Genes CELL REPRODUCTION Kimberly Lozano Biology 490 Spring 2010 CELL CYCLE Interphase G1: Growth (1) New organelles form within the cell. S: Synthesis Cell duplicates its DNA. G2: Growth (2) Cell prepares for

More information

Meiosis and Sexual Reproduction

Meiosis and Sexual Reproduction Note-taking Workbook Meiosis and Sexual Reproduction Section: Reproduction ASEXUAL REPRODUCTION Key Idea: An individual formed by asexual reproduction is to its parent. Additional notes about Asexual Reproduction:

More information

Unit 5: Cell Division and Development Guided Reading Questions (45 pts total)

Unit 5: Cell Division and Development Guided Reading Questions (45 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 12 The Cell Cycle Unit 5: Cell Division and Development Guided

More information

Plant Transformation

Plant Transformation Plant Transformation Indirect and direct methods Indirect method: bacterial mediators are employed. Agrobacterium tumefaciens (leaf tissues) Agrobacterium rhizogenes (root tissues) Direct methods: no mediator

More information

Useful Propagation Terms. Propagation The application of specific biological principles and concepts in the multiplication of plants.

Useful Propagation Terms. Propagation The application of specific biological principles and concepts in the multiplication of plants. Useful Propagation Terms Propagation The application of specific biological principles and concepts in the multiplication of plants. Adventitious Typically describes new organs such as roots that develop

More information

Chapter 11: The Continuity of Life: Cellular Reproduction

Chapter 11: The Continuity of Life: Cellular Reproduction Chapter 11: The Continuity of Life: Cellular Reproduction Chapter 11: Cellular Reproduction What is Cellular Reproduction? Answer: The division of a parent cell into two daughter cells Requirements of

More information

Towards the Ultimate Solution: Genetic Resistance to HLB in Commercial Citrus. Greening Summit Florida Citrus Growers Institute 2008

Towards the Ultimate Solution: Genetic Resistance to HLB in Commercial Citrus. Greening Summit Florida Citrus Growers Institute 2008 Towards the Ultimate Solution: Genetic Resistance to HLB in Commercial Citrus Greening Summit Florida Citrus Growers Institute 2008 Jude Grosser University of Florida, Citrus Research and Education Center,

More information

CELL REPRODUCTION NOTES

CELL REPRODUCTION NOTES CELL REPRODUCTION NOTES CELL GROWTH AND DIVISION The adult human body produces roughly cells every day. WHY DO CELLS REPRODUCE? So that the organism can and As multicellular organisms grow larger, its

More information

CHAPTER 1 INTRODUCTION TO CELLS 2009 Garland Science Publishing 3 rd Edition

CHAPTER 1 INTRODUCTION TO CELLS 2009 Garland Science Publishing 3 rd Edition Unity and Diversity of Cells 1-1 The smallest unit of life is a(n) (a) DNA molecule. (b) cell. (c) organelle. (d) virus. (e) protein. CHAPTER 1 INTRODUCTION TO CELLS 2009 Garland Science Publishing 3 rd

More information

Topic 3: Genetics (Student) Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species.

Topic 3: Genetics (Student) Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species. Topic 3: Genetics (Student) 3.2 Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species. 3.2 Chromosomes 3.2.U1 Prokaryotes have one chromosome consisting of

More information

CAPE Biology Unit 1 Scheme of Work

CAPE Biology Unit 1 Scheme of Work CAPE Biology Unit 1 Scheme of Work 2011-2012 Term 1 DATE SYLLABUS OBJECTIVES TEXT PAGES ASSIGNMENTS COMMENTS Orientation Introduction to CAPE Biology syllabus content and structure of the exam Week 05-09

More information

Name 8 Cell Cycle and Meiosis Test Date Study Guide You must know: The structure of the replicated chromosome. The stages of mitosis.

Name 8 Cell Cycle and Meiosis Test Date Study Guide You must know: The structure of the replicated chromosome. The stages of mitosis. Name 8 Cell Cycle and Meiosis Test Date Study Guide You must know: The structure of the replicated chromosome. The stages of mitosis. The role of kinases and cyclin in the regulation of the cell cycle.

More information

Vital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655)

Vital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655) We still consider the E. coli genome as a fairly typical bacterial genome, and given the extensive information available about this organism and it's lifestyle, the E. coli genome is a useful point of

More information

CHAPTER 12 - THE CELL CYCLE (pgs )

CHAPTER 12 - THE CELL CYCLE (pgs ) CHAPTER 12 - THE CELL CYCLE (pgs. 228-245) CHAPTER SEVEN TARGETS I. Describe the importance of mitosis in single-celled and multi-cellular organisms. II. Explain the organization of DNA molecules and their

More information

Model plants and their Role in genetic manipulation. Mitesh Shrestha

Model plants and their Role in genetic manipulation. Mitesh Shrestha Model plants and their Role in genetic manipulation Mitesh Shrestha Definition of Model Organism Specific species or organism Extensively studied in research laboratories Advance our understanding of Cellular

More information

CELL DIVISION: MEIOSIS

CELL DIVISION: MEIOSIS CELL DIVISION: MEIOSIS How do Organisms Reproduce? Option 1: Asexual Reproduction Can be done by a single organism without the involvement of gametes (sperm or egg) Offspring are clones of the parent,

More information

Animal Cell Organelles. Plant Cell. Organelle. Cell Wall. Chloroplasts. Vacuole

Animal Cell Organelles. Plant Cell. Organelle. Cell Wall. Chloroplasts. Vacuole Cell Biology Higher Electron vs Light Microscope Light use light and lenses to magnify specimen Electron use a beam of electrons to form an image Electron higher magnification and higher resolution Electron

More information

Sexual and Asexual Reproduction. Cell Reproduction TEST Friday, 11/13

Sexual and Asexual Reproduction. Cell Reproduction TEST Friday, 11/13 Sexual and Asexual Reproduction Cell Reproduction TEST Friday, 11/13 How many chromosomes do humans have? What are Chromosomes? How many chromosomes came from your mom? How many chromosomes came from your

More information

Module B Unit 5 Cell Growth and Reproduction. Mr. Mitcheltree

Module B Unit 5 Cell Growth and Reproduction. Mr. Mitcheltree Module B Unit 5 Cell Growth and Reproduction Mr. Mitcheltree DNA and Genetics - The Cell and Inheritance Gene = group of codons that code for a specific protein Allele = alternate form of a gene A dominant,

More information

SOALAN ULANGKAJI BAB 5 BIOLOGI TINGKATAN 4

SOALAN ULANGKAJI BAB 5 BIOLOGI TINGKATAN 4 SOALAN ULANGKAJI BAB 5 BIOLOGI TINGKATAN 4 SECTION A: OBJECTIVES QUESTIONS. Diagram shows the phases in a cell cycle. Diagram 3 Diagram What is V? A Mitosis B Cytokinesis C Stage S D Stage G What is the

More information

pglo/amp R Bacterial Transformation Lab

pglo/amp R Bacterial Transformation Lab pglo/amp R Bacterial Transformation Lab Name: Date: Purpose: To gain an understanding of the techniques of culturing E. coli bacteria and transforming E. coli bacteria using genetic engineering. Introduction:

More information

Reproduction & Development. 1 parent cell divides to form 2 daughter cells All offspring have exact same DNA as parent

Reproduction & Development. 1 parent cell divides to form 2 daughter cells All offspring have exact same DNA as parent Living Environment Dr. Golub Reproduction & Development Asexual reproduction 1 parent cell divides to form 2 daughter cells All offspring have exact same DNA as parent Sexual Reproduction Requires 2 parents

More information

Unit D: Controlling Pests and Diseases in the Orchard. Lesson 5: Identify and Control Diseases in the Orchard

Unit D: Controlling Pests and Diseases in the Orchard. Lesson 5: Identify and Control Diseases in the Orchard Unit D: Controlling Pests and Diseases in the Orchard Lesson 5: Identify and Control Diseases in the Orchard 1 Terms Abiotic disease Bacteria Biotic diseases Cultural disease control Disease avoidance

More information

Cell Reproduction. Objectives

Cell Reproduction. Objectives Cell Reproduction Lecture 10 Objectives At the end of this series of lectures you should be able to: Define terms. Describe the functions of cellular reproduction. Compare the parent offspring relationship

More information

Mitosis / Meiosis / Reproduction: Asexual vs. sexual: Refer to Chapter 9 and sections of Chapter 10.

Mitosis / Meiosis / Reproduction: Asexual vs. sexual: Refer to Chapter 9 and sections of Chapter 10. Mitosis / Meiosis / Reproduction: Asexual vs. sexual: Refer to Chapter 9 and sections of Chapter 10. 1. Why do cells divide? For unicellular species, cell division is synonymous with reproduction and is

More information

Warm up. sexual life cycle. 1. Compare sexual to asexual reproduction. 2. What are homologous chromosomes?

Warm up. sexual life cycle. 1. Compare sexual to asexual reproduction. 2. What are homologous chromosomes? Warm up 1. Compare sexual to asexual reproduction. 2. What are homologous chromosomes? 1. Describe what major processes occur during a sexual life cycle. Warm up 1. Describe what occurs during crossing

More information

UNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology

UNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular microbiology Time Allowed: 1 hour 30 minutes Marking

More information

Unit 6 : Meiosis & Sexual Reproduction

Unit 6 : Meiosis & Sexual Reproduction Unit 6 : Meiosis & Sexual Reproduction 2006-2007 Cell division / Asexual reproduction Mitosis produce cells with same information identical daughter cells exact copies clones same number of chromosomes

More information

Cellular Growth & Reproduction. Biology 1B Ms. Morris

Cellular Growth & Reproduction. Biology 1B Ms. Morris Cellular Growth & Reproduction Biology 1B Ms. Morris Friday, February 7, 2014 Warm Up: Look around at the other people in the classroom. What types of variation (differences) do you see? What similarities

More information

Foundation Cell Biology

Foundation Cell Biology Foundation Cell Biology Electron vs Light Microscope Light use light and lenses to magnify specimen Electron use a beam of electrons to form an image Electron higher magnification and higher resolution

More information

Lesson Overview Meiosis

Lesson Overview Meiosis 11.4 THINK ABOUT IT As geneticists in the early 1900s applied Mendel s laws, they wondered where genes might be located. They expected genes to be carried on structures inside the cell, but which structures?

More information

Chapter 12: The Cell Cycle

Chapter 12: The Cell Cycle Name Period Chapter 12: The Cell Cycle Overview: 1. What are the three key roles of cell division? State each role, and give an example. Key Role Example 2. What is meant by the cell cycle? Concept 12.1

More information

CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON

CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter

More information