SBI lab Jou-hyun Jeon Jae-seong Yang Solip Park Yonghwan Choi Yoonsup Choi Jinho Kim HyunJun Nam JiHye Hwang Inhae Kim Youngeun Shin Sung gyu Han

Size: px
Start display at page:

Download "SBI lab Jou-hyun Jeon Jae-seong Yang Solip Park Yonghwan Choi Yoonsup Choi Jinho Kim HyunJun Nam JiHye Hwang Inhae Kim Youngeun Shin Sung gyu Han"

Transcription

1 POSTECH 생명과학과김상욱

2 Structural Bioinformatics Laboratory Pohang University of Science and Technology Acknowledgement SBI lab Jou-hyun Jeon Jae-seong Yang Solip Park Yonghwan Choi Yoonsup Choi Jinho Kim HyunJun Nam JiHye Hwang Inhae Kim Youngeun Shin Sung gyu Han

3 Disease mechanism in the protein interaction network Disrupt the interaction interface leading to loss of function effect Modify the interaction properties recruiting of novel partners

4 Society Biological signaling network Internet

5 Biological Networks GENOME PROTEOME PHENOME 5 Citrate Cycle

6 Costanzo et al. The Genetic Landscape of a Cell. Science (2010) vol. 327 (5964) pp

7 Procedures to connect comorbidity and genetic associations

8 Genotype-phenotype connections Phenotype connections are triggered by various types of molecular connections

9 Integrative approach to predict phenotype connections

10 The human disease network Construction of the diseasome bipartite network PNAS May 22, 2007 vol. 104 no

11 Disease Gene Network

12 Example: Diabetes in the Human disease network

13 Protein subcellular localization and Human diseases

14 Relationships between disease-associated proteins and their subcellular localizations Mol Sys Biol :494.

15 Correlation between disease classes and subcellular localizations Mol Sys Biol :494.

16 The implication of subcellular localization for disease comorbidity Subcellular localization similarity of human diseases

17 The implication of subcellular localization for disease comorbidity Mol Sys Biol :494.

18 Subcellular localization and human diseases Construction of functional interaction networks through consensus localization predictions of the human proteome. Park et.al..j. Proteome Res., 2009, 8 (7), pp > Protein localization information facilitates the identification of disease associated genes

19 Network position reveals spatial and functional organization of mitochondrial proteins

20 Eye diseases Aging Heart failure Cancer Liver failure Dysfunction of mitochondria is related over 400 disease phenotypes Alzhaimer PLoS Comput Biol 5(4): e

21 Extensive experiments and bioinformatics approaches have been applied to identify mitochondrial proteome Experiments Bioinformatics EMBO reports 7, 9, (2006) Organellar proteomics: turning inventories into insights Jens S Andersen 1 & Matthias Mann 2 Park, S., Yang, J.S., Jang, S.K. and Kim, S. (2009) Construction of functional interaction networks through consensus localization predictions of the human proteome, J Proteome Res, 8, Identification of mitochondrial proteins

22 Identifying spatial organization of mitochondrial proteins provide key clues for functions

23 Assigning network position of mitochondrial proteins in functional interaction network

24 Network position reflects spatial organization of mitochondrial proteins

25 Network position reflects spatial organization of mitochondrial proteins

26 Network position reflects spatial organization of mitochondrial proteins

27 Network position reflects functional organization of mitochondrial proteins

28 Network positions are similar between same disease associated protein pairs

29 Network position can help to find mitochondrial disease candidates

30 Network position can help to find mitochondrial disease candidates Underlined genes in the disease candidates are known to be associated with mitochondrial diseases

31 Integrative approaches for network medicine of human diseases

32 Structural Bioinformatics Laboratory Pohang University of Science and Technology Acknowledgement SBI lab Jou-hyun Jeon Jae-seong Yang Solip Park Yonghwan Choi Yoonsup Choi Jinho Kim HyunJun Nam JiHye Hwang Inhae Kim Youngeun Shin Sung gyu Han

The Role of Network Science in Biology and Medicine. Tiffany J. Callahan Computational Bioscience Program Hunter/Kahn Labs

The Role of Network Science in Biology and Medicine. Tiffany J. Callahan Computational Bioscience Program Hunter/Kahn Labs The Role of Network Science in Biology and Medicine Tiffany J. Callahan Computational Bioscience Program Hunter/Kahn Labs Network Analysis Working Group 09.28.2017 Network-Enabled Wisdom (NEW) empirically

More information

Computational Biology From The Perspective Of A Physical Scientist

Computational Biology From The Perspective Of A Physical Scientist Computational Biology From The Perspective Of A Physical Scientist Dr. Arthur Dong PP1@TUM 26 November 2013 Bioinformatics Education Curriculum Math, Physics, Computer Science (Statistics and Programming)

More information

MSc Drug Design. Module Structure: (15 credits each) Lectures and Tutorials Assessment: 50% coursework, 50% unseen examination.

MSc Drug Design. Module Structure: (15 credits each) Lectures and Tutorials Assessment: 50% coursework, 50% unseen examination. Module Structure: (15 credits each) Lectures and Assessment: 50% coursework, 50% unseen examination. Module Title Module 1: Bioinformatics and structural biology as applied to drug design MEDC0075 In the

More information

Genome-wide multilevel spatial interactome model of rice

Genome-wide multilevel spatial interactome model of rice Sino-German Workshop on Multiscale Spatial Computational Systems Biology, Beijing, Oct 8-12, 2015 Genome-wide multilevel spatial interactome model of rice Ming CHEN ( 陈铭 ) mchen@zju.edu.cn College of Life

More information

NETWORK BIOLOGY AND COMPLEX DISEASES. Ahto Salumets

NETWORK BIOLOGY AND COMPLEX DISEASES. Ahto Salumets NETWORK BIOLOGY AND COMPLEX DISEASES Ahto Salumets CENTRAL DOGMA OF BIOLOGY https://en.wikipedia.org/wiki/central_dogma_of_molecular_biology http://www.qaraqalpaq.com/genetics.html CHROMOSOMES SINGLE-NUCLEOTIDE

More information

Erzsébet Ravasz Advisor: Albert-László Barabási

Erzsébet Ravasz Advisor: Albert-László Barabási Hierarchical Networks Erzsébet Ravasz Advisor: Albert-László Barabási Introduction to networks How to model complex networks? Clustering and hierarchy Hierarchical organization of cellular metabolism The

More information

MATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME

MATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME MATHEMATICAL MODELING AND THE HUMAN GENOME Hilary S. Booth Australian National University, Australia Keywords: Human genome, DNA, bioinformatics, sequence analysis, evolution. Contents 1. Introduction:

More information

Modeling. FRANCK DELAPLACE IBISC GENOPOLE EVRY UNIVERSITY

Modeling. FRANCK DELAPLACE IBISC GENOPOLE EVRY UNIVERSITY 1 Modeling FRANCK DELAPLACE Franck.delaplace@ibisc.univ-evry.fr IBISC GENOPOLE EVRY UNIVERSITY 2 R. Thom : «On essaye de dominer des situations à l aide de la modélisation, [..] en construisant un système

More information

Lecture Notes for Fall Network Modeling. Ernest Fraenkel

Lecture Notes for Fall Network Modeling. Ernest Fraenkel Lecture Notes for 20.320 Fall 2012 Network Modeling Ernest Fraenkel In this lecture we will explore ways in which network models can help us to understand better biological data. We will explore how networks

More information

Clustering and Network

Clustering and Network Clustering and Network Jing-Dong Jackie Han jdhan@picb.ac.cn http://www.picb.ac.cn/~jdhan Copy Right: Jing-Dong Jackie Han What is clustering? A way of grouping together data samples that are similar in

More information

GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H*" ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION

GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H* ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION FIFTH EDITION IV I ^HHk ^ttm IZTI/^Q i I II MPHBBMWBBIHB '-llwmpbi^hbwm^^pfc ' GSBHSRSBRSRRk LlML I I \l 1MB ^HP'^^MMMP" jflp^^^^^^^^st I Iv^O FROM GENES TO GENOMES %^MiM^PM^^MWi99Mi$9i0^^ ^^^^^^^^^^^^^V^^^fii^^t^i^^^^^

More information

An Information-Theoretic Approach to Methylation Data Analysis

An Information-Theoretic Approach to Methylation Data Analysis An Information-Theoretic Approach to Methylation Data Analysis John Goutsias Whitaker Biomedical Engineering Institute The Johns Hopkins University Baltimore, MD 21218 Objective Present an information-theoretic

More information

Using phylogenetics to estimate species divergence times... Basics and basic issues for Bayesian inference of divergence times (plus some digression)

Using phylogenetics to estimate species divergence times... Basics and basic issues for Bayesian inference of divergence times (plus some digression) Using phylogenetics to estimate species divergence times... More accurately... Basics and basic issues for Bayesian inference of divergence times (plus some digression) "A comparison of the structures

More information

Biology Scope and Sequence Student Outcomes (Objectives Skills/Verbs)

Biology Scope and Sequence Student Outcomes (Objectives Skills/Verbs) C-4 N.12.A 1-6 N.12.B.1-4 Scientific Literacy/ Nature of (embedded throughout course) Scientific Inquiry is the process by which humans systematically examine the natural world. Scientific inquiry is a

More information

Super Flexible, High-efficiency Perovskite Solar Cells Employing Graphene Electrodes: Toward Future Foldable Power Sources

Super Flexible, High-efficiency Perovskite Solar Cells Employing Graphene Electrodes: Toward Future Foldable Power Sources Electronic Supplementary Material (ESI) for Energy & Environmental Science. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information Super Flexible, High-efficiency Perovskite

More information

What are mitochondria?

What are mitochondria? What are mitochondria? What are mitochondria? An intracellular organelle. There are 100 to 1000s of mitochondria/cell. Most mitochondria come from the mother. Mitochondria have their own DNA Mitochondria

More information

Title: Evolutionary dynamics of the protein structure-function relation and the origin of the genetic code

Title: Evolutionary dynamics of the protein structure-function relation and the origin of the genetic code Blue Waters Illinois Allocation Report 2016 Primary contact email and name: NAME: Dr. Gustavo Caetano-Anolles EMAIL: gca@illinois.edu Title: Evolutionary dynamics of the protein structure-function relation

More information

Updated: 10/11/2018 Page 1 of 5

Updated: 10/11/2018 Page 1 of 5 A. Academic Division: Health Sciences B. Discipline: Biology C. Course Number and Title: BIOL1230 Biology I MASTER SYLLABUS 2018-2019 D. Course Coordinator: Justin Tickhill Assistant Dean: Melinda Roepke,

More information

Mitochondrial phosphoproteome

Mitochondrial phosphoproteome Mitochondrial phosphoproteome Claire Lemaire UMR8221, CNRS, CEA, Université Paris-Sud CEA Saclay/ ibitec-s/sb2sm/lpm Mai 2014 1 Importance of the regulation by phosphorylation A large proportion of the

More information

FRAUNHOFER IME SCREENINGPORT

FRAUNHOFER IME SCREENINGPORT FRAUNHOFER IME SCREENINGPORT Design of screening projects General remarks Introduction Screening is done to identify new chemical substances against molecular mechanisms of a disease It is a question of

More information

What is Systems Biology

What is Systems Biology What is Systems Biology 2 CBS, Department of Systems Biology 3 CBS, Department of Systems Biology Data integration In the Big Data era Combine different types of data, describing different things or the

More information

09/30/2017. Kyu-Sun Lee, Ph.D. Metabolism & Neurophysiology Research Group Hazard Monitoring BNT Res Center

09/30/2017. Kyu-Sun Lee, Ph.D. Metabolism & Neurophysiology Research Group Hazard Monitoring BNT Res Center 09/30/2017 Kyu-Sun Lee, Ph.D. Metabolism & Neurophysiology Research Group Hazard Monitoring BNT Res Center Conflict of interest disclosure None Committee of Scientific Affairs Committee of Scientific Affairs

More information

Design, Synthesis and Biological Evaluation of Novel. Deguelin-Based Heat Shock Protein 90 (HSP90) Inhibitors

Design, Synthesis and Biological Evaluation of Novel. Deguelin-Based Heat Shock Protein 90 (HSP90) Inhibitors Design, Synthesis and Biological Evaluation of Novel Deguelin-Based Heat Shock Protein 90 (HSP90) Inhibitors Targeting Proliferation and Angiogenesis Dong-Jo Chang, Hongchan An, Kyoung-suk Kim, Hyun Ho

More information

Undergraduate Curriculum in Biology

Undergraduate Curriculum in Biology Fall Courses *114: Principles of Biology *116: Introduction to Anatomy and Physiology I 302: Human Learning and the Brain (o, DS) 336: Aquatic Biology (p/e) 339: Aquatic Biology Lab (L) 351: Principles

More information

Mechanical Engineering Science Requirements

Mechanical Engineering Science Requirements Mechanical Engineering Requirements This file is a representation of all courses that Mechanical Engineering students can take to satisfy the requirement. ME students are required to take Physics II and

More information

Mitochondrial dynamics in ischemia and reperfusion

Mitochondrial dynamics in ischemia and reperfusion Mitochondrial dynamics in ischemia and reperfusion Derek J Hausenloy Reader in Cardiovascular Medicine, British Heart Foundation Senior Clinical Research Fellow, The Hatter Cardiovascular Institute, University

More information

Four specialisations. Cell and System Biology. Evolution and Behaviour. Ecology and Environment

Four specialisations. Cell and System Biology. Evolution and Behaviour. Ecology and Environment Master in Biology Four specialisations Cell and System Biology Evolution and Behaviour Ecology and Environment 1 Three professional profiles Research Education Management 2 two years - 120 ECTS points

More information

Biochemistry-BS Program Study Abroad Pathway

Biochemistry-BS Program Study Abroad Pathway Biochemistry-BS Program Study Abroad Pathway (last revised September 2016) Table 1a: Undergraduate Program Schedule These undergraduate program schedules are subject to change. Please verify information

More information

Expression QTLs and Mapping of Complex Trait Loci. Paul Schliekelman Statistics Department University of Georgia

Expression QTLs and Mapping of Complex Trait Loci. Paul Schliekelman Statistics Department University of Georgia Expression QTLs and Mapping of Complex Trait Loci Paul Schliekelman Statistics Department University of Georgia Definitions: Genes, Loci and Alleles A gene codes for a protein. Proteins due everything.

More information

Gene regulation: From biophysics to evolutionary genetics

Gene regulation: From biophysics to evolutionary genetics Gene regulation: From biophysics to evolutionary genetics Michael Lässig Institute for Theoretical Physics University of Cologne Thanks Ville Mustonen Johannes Berg Stana Willmann Curt Callan (Princeton)

More information

Proteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering

Proteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering Proteomics 2 nd semester, 2013 1 Text book Principles of Proteomics by R. M. Twyman, BIOS Scientific Publications Other Reference books 1) Proteomics by C. David O Connor and B. David Hames, Scion Publishing

More information

Predicting Protein Functions and Domain Interactions from Protein Interactions

Predicting Protein Functions and Domain Interactions from Protein Interactions Predicting Protein Functions and Domain Interactions from Protein Interactions Fengzhu Sun, PhD Center for Computational and Experimental Genomics University of Southern California Outline High-throughput

More information

Pathway Association Analysis Trey Ideker UCSD

Pathway Association Analysis Trey Ideker UCSD Pathway Association Analysis Trey Ideker UCSD A working network map of the cell Network evolutionary comparison / cross-species alignment to identify conserved modules The Working Map Network-based classification

More information

# shared OGs (spa, spb) Size of the smallest genome. dist (spa, spb) = 1. Neighbor joining. OG1 OG2 OG3 OG4 sp sp sp

# shared OGs (spa, spb) Size of the smallest genome. dist (spa, spb) = 1. Neighbor joining. OG1 OG2 OG3 OG4 sp sp sp Bioinformatics and Evolutionary Genomics: Genome Evolution in terms of Gene Content 3/10/2014 1 Gene Content Evolution What about HGT / genome sizes? Genome trees based on gene content: shared genes Haemophilus

More information

Systems biology and biological networks

Systems biology and biological networks Systems Biology Workshop Systems biology and biological networks Center for Biological Sequence Analysis Networks in electronics Radio kindly provided by Lazebnik, Cancer Cell, 2002 Systems Biology Workshop,

More information

Statistical mass spectrometry-based proteomics

Statistical mass spectrometry-based proteomics 1 Statistical mass spectrometry-based proteomics Olga Vitek www.stat.purdue.edu Outline What is proteomics? Biological questions and technologies Protein quantification in label-free workflows Joint analysis

More information

Year: Subject Area: Biochemistry, Genetics and Molecular Biology. Subject Category: Aging.

Year: Subject Area: Biochemistry, Genetics and Molecular Biology. Subject Category: Aging. Year: 2011. Subject Category: Aging. 1 Aging Cell 2 Ageing Research Reviews 3 Psychology and Aging 4 Journals of Gerontology - Series A Biological Sciences and Medical Sciences 5 Mechanisms of Ageing and

More information

TE content correlates positively with genome size

TE content correlates positively with genome size TE content correlates positively with genome size Mb 3000 Genomic DNA 2500 2000 1500 1000 TE DNA Protein-coding DNA 500 0 Feschotte & Pritham 2006 Transposable elements. Variation in gene numbers cannot

More information

Cardiolipin Remodeling by ALCAT1 Regulates Dilated Cardiomyopathy Through Oxidative Stress and Mitophagy. Yuguang (Roger) Shi

Cardiolipin Remodeling by ALCAT1 Regulates Dilated Cardiomyopathy Through Oxidative Stress and Mitophagy. Yuguang (Roger) Shi Cardiolipin Remodeling by ALCAT1 Regulates Dilated Cardiomyopathy Through xidative Stress and Mitophagy Yuguang (Roger) Shi yus11@psu.eud Cardiolipin Biosynthetic and Remodeling Pathways Phosphatidic Acid

More information

Bioinformatics. Genotype -> Phenotype DNA. Jason H. Moore, Ph.D. GECCO 2007 Tutorial / Bioinformatics.

Bioinformatics. Genotype -> Phenotype DNA. Jason H. Moore, Ph.D. GECCO 2007 Tutorial / Bioinformatics. Bioinformatics Jason H. Moore, Ph.D. Frank Lane Research Scholar in Computational Genetics Associate Professor of Genetics Adjunct Associate Professor of Biological Sciences Adjunct Associate Professor

More information

Undergraduate Curriculum in Biology

Undergraduate Curriculum in Biology Fall Courses *114: Principles of Biology *116: Introduction to Anatomy and Physiology I 302: Human Learning and the Brain (o, DS) 336: Aquatic Biology (p/e) 339: Aquatic Biology Lab (L) 351: Principles

More information

The geneticist s questions

The geneticist s questions The geneticist s questions a) What is consequence of reduced gene function? 1) gene knockout (deletion, RNAi) b) What is the consequence of increased gene function? 2) gene overexpression c) What does

More information

Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution

Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature

More information

Proportional Variance Explained by QLT and Statistical Power. Proportional Variance Explained by QTL and Statistical Power

Proportional Variance Explained by QLT and Statistical Power. Proportional Variance Explained by QTL and Statistical Power Proportional Variance Explained by QTL and Statistical Power Partitioning the Genetic Variance We previously focused on obtaining variance components of a quantitative trait to determine the proportion

More information

Miller & Levine Biology

Miller & Levine Biology A Correlation of To the Science Biology A Correlation of, 2014 to the, Table of Contents From Molecules to Organisms: Structures and Processes... 3 Ecosystems: Interactions, Energy, and Dynamics... 4 Heredity:

More information

An introduction to SYSTEMS BIOLOGY

An introduction to SYSTEMS BIOLOGY An introduction to SYSTEMS BIOLOGY Paolo Tieri CNR Consiglio Nazionale delle Ricerche, Rome, Italy 10 February 2015 Universidade Federal de Minas Gerais, Belo Horizonte, Brasil Course outline Day 1: intro

More information

Curriculum Guide for 8th_ Grade (UPDATED 6/4/2013)

Curriculum Guide for 8th_ Grade (UPDATED 6/4/2013) Curriculum Guide for 8th_ Grade (UPDATED 6//01) NGSS T.E. Book Title Critical Content (Big Idea written as a question) Student chapter & Section Objectives/Key Concepts (Please write as a statement.).1.1

More information

Introduction to Systems Biology

Introduction to Systems Biology Introduction to Systems Biology References: Watson s Molecular Biology of the Gene, Chapter 22 Alberts Molecular Biology of the Cell, Chapter 7 Yousof Gheisari ygheisari@med.mui.ac.ir Why is this picture

More information

BIOL-UA38: Genome Biology

BIOL-UA38: Genome Biology Lectures Recitation Text Instructors 75 minutes, twice per week (Mondays and Wednesdays, 9:30-10:45am) 75 minutes, once per week (Wednesday 5:00pm-6:15pm) A Primer of Genome Science, 3rd edition Greg Gibson

More information

Supplementary information. A proposal for a novel impact factor as an alternative to the JCR impact factor

Supplementary information. A proposal for a novel impact factor as an alternative to the JCR impact factor Supplementary information A proposal for a novel impact factor as an alternative to the JCR impact factor Zu-Guo Yang a and Chun-Ting Zhang b, * a Library, Tianjin University, Tianjin 300072, China b Department

More information

Yifei Bao. Beatrix. Manor Askenazi

Yifei Bao. Beatrix. Manor Askenazi Detection and Correction of Interference in MS1 Quantitation of Peptides Using their Isotope Distributions Yifei Bao Department of Computer Science Stevens Institute of Technology Beatrix Ueberheide Department

More information

Carri-Lyn Mead Thursday, January 13, 2005 Terry Fox Laboratory, Dr. Dixie Mager

Carri-Lyn Mead Thursday, January 13, 2005 Terry Fox Laboratory, Dr. Dixie Mager Investigating Trends in Transposable Element Insertion within Regulatory Regions Carri-Lyn Mead cmead@bcgsc.ca Thursday, January 13, 2005 Terry Fox Laboratory, Dr. Dixie Mager Outline Transposable Element

More information

Molecular Biology Of The Cell 6th Edition Alberts

Molecular Biology Of The Cell 6th Edition Alberts We have made it easy for you to find a PDF Ebooks without any digging. And by having access to our ebooks online or by storing it on your computer, you have convenient answers with molecular biology of

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Breker et al., http://www.jcb.org/cgi/content/full/jcb.201301120/dc1 Figure S1. Single-cell proteomics of stress responses. (a) Using

More information

CONCEPT Year Schedule Master Biomolecular Sciences Specialization Molecular Cell Biology

CONCEPT Year Schedule Master Biomolecular Sciences Specialization Molecular Cell Biology Course Project Elective Elective (6 ec) Exams Holidays CONCEPT Year Schedule Master Sciences 2017-2018 Specialization Cell Biology Scientific Writing in English (AM_BMOL) (3 1156 modified: 6-7-2017 period

More information

Bioinformatics 2. Yeast two hybrid. Proteomics. Proteomics

Bioinformatics 2. Yeast two hybrid. Proteomics. Proteomics GENOME Bioinformatics 2 Proteomics protein-gene PROTEOME protein-protein METABOLISM Slide from http://www.nd.edu/~networks/ Citrate Cycle Bio-chemical reactions What is it? Proteomics Reveal protein Protein

More information

Genetic dissection of the Arabidopsis thaliana ionome

Genetic dissection of the Arabidopsis thaliana ionome Genetic dissection of the Arabidopsis thaliana ionome Genome Ionome Landscape distribution David E Salt Purdue University, USA What is the Ionome Environment Transcriptome Proteome Ionome The elemental

More information

Constructing a Pedigree

Constructing a Pedigree Constructing a Pedigree Use the appropriate symbols: Unaffected Male Unaffected Female Affected Male Affected Female Male carrier of trait Mating of Offspring 2. Label each generation down the left hand

More information

USING BLAST TO IDENTIFY PROTEINS THAT ARE EVOLUTIONARILY RELATED ACROSS SPECIES

USING BLAST TO IDENTIFY PROTEINS THAT ARE EVOLUTIONARILY RELATED ACROSS SPECIES USING BLAST TO IDENTIFY PROTEINS THAT ARE EVOLUTIONARILY RELATED ACROSS SPECIES HOW CAN BIOINFORMATICS BE USED AS A TOOL TO DETERMINE EVOLUTIONARY RELATIONSHPS AND TO BETTER UNDERSTAND PROTEIN HERITAGE?

More information

UE Praktikum Bioinformatik

UE Praktikum Bioinformatik UE Praktikum Bioinformatik WS 08/09 University of Vienna 7SK snrna 7SK was discovered as an abundant small nuclear RNA in the mid 70s but a possible function has only recently been suggested. Two independent

More information

Coding sequence array Office hours Wednesday 3-4pm 304A Stanley Hall

Coding sequence array Office hours Wednesday 3-4pm 304A Stanley Hall Coding sequence array Office hours Wednesday 3-4pm 304A Stanley Hall Review session 5pm Thursday, Dec. 11 GPB100 Fig. 1.13 RNA-seq Expression effects of cancer AAAAA AAAAA AAAAA Solexa sequencing counts

More information

BIOLOGY Chair Associate Chair Faculty with Research Interests Degree Programs Other Degree Programs in Biology Research Honors Program

BIOLOGY Chair Associate Chair Faculty with Research Interests Degree Programs Other Degree Programs in Biology Research Honors Program Biology 1 BIOLOGY Robert A. Pritzker Science Center, Room 182 3101 S. Dearborn St. Chicago, IL 60616 312.567.3480 kersh@iit.edu science.iit.edu/biology Chair Thomas Irving Associate Chair Tanya Bekyarova

More information

Executive Summary. IP Owner Summary. Personal Description of Researcher. Market Feasibility. Key Technology Highlights. Trend & Partnership

Executive Summary. IP Owner Summary. Personal Description of Researcher. Market Feasibility. Key Technology Highlights. Trend & Partnership POSTECH Executive Summary Dr. Kimoon Kim, a professor of Postech, has researched supramolecular chemistry using cucurbituril and developed cucurbit[n]uril (CB[n], n=5-10) and functionalized CB[n] with

More information

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG

More information

Graduate Funding Information Center

Graduate Funding Information Center Graduate Funding Information Center UNC-Chapel Hill, The Graduate School Graduate Student Proposal Sponsor: Program Title: NESCent Graduate Fellowship Department: Biology Funding Type: Fellowship Year:

More information

STATE UNIVERSITY OF NEW YORK COLLEGE OF TECHNOLOGY CANTON, NEW YORK. COURSE OUTLINE BIOL 310 The Human Genome. Prepared By: Ron Tavernier

STATE UNIVERSITY OF NEW YORK COLLEGE OF TECHNOLOGY CANTON, NEW YORK. COURSE OUTLINE BIOL 310 The Human Genome. Prepared By: Ron Tavernier STATE UNIVERSITY OF NEW YORK COLLEGE OF TECHNOLOGY CANTON, NEW YORK COURSE OUTLINE BIOL 310 The Human Genome Prepared By: Ron Tavernier SCHOOL OF SCIENCE, HEALTH & CRIMINAL JUSTICE SCIENCE DEPARTMENT May

More information

Miller & Levine Biology 2014

Miller & Levine Biology 2014 A Correlation of Miller & Levine Biology To the Essential Standards for Biology High School Introduction This document demonstrates how meets the North Carolina Essential Standards for Biology, grades

More information

Education RESEARCH CAREER

Education RESEARCH CAREER Prof. Sun Tae KIM Assistant Professor, Department of Plant Bioscience College of Natural Resources & Life Science Pusan National University, 50 Cheonghak, Samrangjin, Miryang, 627-706, Korea TEL: +82-055-350-5505

More information

Subcellular Localisation of Proteins in Living Cells Using a Genetic Algorithm and an Incremental Neural Network

Subcellular Localisation of Proteins in Living Cells Using a Genetic Algorithm and an Incremental Neural Network Subcellular Localisation of Proteins in Living Cells Using a Genetic Algorithm and an Incremental Neural Network Marko Tscherepanow and Franz Kummert Applied Computer Science, Faculty of Technology, Bielefeld

More information

Evidence for dynamically organized modularity in the yeast protein-protein interaction network

Evidence for dynamically organized modularity in the yeast protein-protein interaction network Evidence for dynamically organized modularity in the yeast protein-protein interaction network Sari Bombino Helsinki 27.3.2007 UNIVERSITY OF HELSINKI Department of Computer Science Seminar on Computational

More information

Network Biology: Understanding the cell s functional organization. Albert-László Barabási Zoltán N. Oltvai

Network Biology: Understanding the cell s functional organization. Albert-László Barabási Zoltán N. Oltvai Network Biology: Understanding the cell s functional organization Albert-László Barabási Zoltán N. Oltvai Outline: Evolutionary origin of scale-free networks Motifs, modules and hierarchical networks Network

More information

1.1. KEY CONCEPT Biologists study life in all its forms. 4 Reinforcement Unit 1 Resource Book. Biology in the 21st Century CHAPTER 1

1.1. KEY CONCEPT Biologists study life in all its forms. 4 Reinforcement Unit 1 Resource Book. Biology in the 21st Century CHAPTER 1 1.1 THE STUDY OF LIFE KEY CONCEPT Biologists study life in all its forms. Biology is the scientific study of all forms of life. Living things are found almost everywhere on Earth, from very hot environments

More information

Computational methods for predicting protein-protein interactions

Computational methods for predicting protein-protein interactions Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational

More information

Proteomics Systems Biology

Proteomics Systems Biology Dr. Sanjeeva Srivastava IIT Bombay Proteomics Systems Biology IIT Bombay 2 1 DNA Genomics RNA Transcriptomics Global Cellular Protein Proteomics Global Cellular Metabolite Metabolomics Global Cellular

More information

Development of a Non-invasive Ultrasonic Measurement System for tissue elasticity

Development of a Non-invasive Ultrasonic Measurement System for tissue elasticity J Biomed Eng Res : 469-475 29 이균정 1 최우혁 1 유재원 1 서종범 1 최서형 2 신태민 1 1 Development of a Non-invasive Ultrasonic Measurement System for tissue elasticity G J Lee 1 W H choi 1 J W Yu 1 J B Seo 1 S H Choi 2

More information

Biology I Level - 2nd Semester Final Review

Biology I Level - 2nd Semester Final Review Biology I Level - 2nd Semester Final Review The 2 nd Semester Final encompasses all material that was discussed during second semester. It s important that you review ALL notes and worksheets from the

More information

Introduction to Bioinformatics. Shifra Ben-Dor Irit Orr

Introduction to Bioinformatics. Shifra Ben-Dor Irit Orr Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A

More information

Chapter 16. Table of Contents. Section 1 Genetic Equilibrium. Section 2 Disruption of Genetic Equilibrium. Section 3 Formation of Species

Chapter 16. Table of Contents. Section 1 Genetic Equilibrium. Section 2 Disruption of Genetic Equilibrium. Section 3 Formation of Species Population Genetics and Speciation Table of Contents Section 1 Genetic Equilibrium Section 2 Disruption of Genetic Equilibrium Section 3 Formation of Species Section 1 Genetic Equilibrium Objectives Identify

More information

Identify stages of plant life cycle Botany Oral/written pres, exams

Identify stages of plant life cycle Botany Oral/written pres, exams DPI Standards Biology Education (for students) 1. Characteristics of organisms Know Properties of living organisms, including: Acquire and use energy and materials Sense and respond to stimuli Reproduce

More information

A DNA Sequence 2017/12/6 1

A DNA Sequence 2017/12/6 1 A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta

More information

GENETICS - CLUTCH CH.1 INTRODUCTION TO GENETICS.

GENETICS - CLUTCH CH.1 INTRODUCTION TO GENETICS. !! www.clutchprep.com CONCEPT: HISTORY OF GENETICS The earliest use of genetics was through of plants and animals (8000-1000 B.C.) Selective breeding (artificial selection) is the process of breeding organisms

More information

Inferring Transcriptional Regulatory Networks from Gene Expression Data II

Inferring Transcriptional Regulatory Networks from Gene Expression Data II Inferring Transcriptional Regulatory Networks from Gene Expression Data II Lectures 9 Oct 26, 2011 CSE 527 Computational Biology, Fall 2011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday

More information

THE ROLE OF BBSRC IN BIODIVERSITY RESEARCH

THE ROLE OF BBSRC IN BIODIVERSITY RESEARCH THE ROLE OF BBSRC IN BIODIVERSITY RESEARCH INTRODUCTION The aim of this document is to explain the role of biodiversity research in the delivery of the BBSRC mission, and thereby to provide guidance to

More information

Innovative Nanosensor for Disease Diagnosis

Innovative Nanosensor for Disease Diagnosis Supporting Information Innovative Nanosensor for Disease Diagnosis Sang Joon Kim,, Seon Jin Choi,,, Ji Soo Jang, Hee Jin Cho, and Il Doo Kim,* Department of Materials Science and Engineering, Korea Advanced

More information

Dropping Your Genes. A Simulation of Meiosis and Fertilization and An Introduction to Probability

Dropping Your Genes. A Simulation of Meiosis and Fertilization and An Introduction to Probability Dropping Your Genes A Simulation of Meiosis and Fertilization and An Introduction to To fully understand Mendelian genetics (and, eventually, population genetics), you need to understand certain aspects

More information

Drosophila melanogaster and D. simulans, two fruit fly species that are nearly

Drosophila melanogaster and D. simulans, two fruit fly species that are nearly Comparative Genomics: Human versus chimpanzee 1. Introduction The chimpanzee is the closest living relative to humans. The two species are nearly identical in DNA sequence (>98% identity), yet vastly different

More information

Protein function studies: history, current status and future trends

Protein function studies: history, current status and future trends 19 3 2007 6 Chinese Bulletin of Life Sciences Vol. 19, No. 3 Jun., 2007 1004-0374(2007)03-0294-07 ( 100871) Q51A Protein function studies: history, current status and future trends MA Jing, GE Xi, CHANG

More information

Effective Capacitance Enhancement Methods for 90-nm DRAM Capacitors

Effective Capacitance Enhancement Methods for 90-nm DRAM Capacitors Journal of the Korean Physical Society, Vol. 44, No. 1, January 2004, pp. 112 116 Effective Capacitance Enhancement Methods for 90-nm DRAM Capacitors Y. K. Park, Y. S. Ahn, S. B. Kim, K. H. Lee, C. H.

More information

Lecture 4: Yeast as a model organism for functional and evolutionary genomics. Part II

Lecture 4: Yeast as a model organism for functional and evolutionary genomics. Part II Lecture 4: Yeast as a model organism for functional and evolutionary genomics Part II A brief review What have we discussed: Yeast genome in a glance Gene expression can tell us about yeast functions Transcriptional

More information

SWEEPFINDER2: Increased sensitivity, robustness, and flexibility

SWEEPFINDER2: Increased sensitivity, robustness, and flexibility SWEEPFINDER2: Increased sensitivity, robustness, and flexibility Michael DeGiorgio 1,*, Christian D. Huber 2, Melissa J. Hubisz 3, Ines Hellmann 4, and Rasmus Nielsen 5 1 Department of Biology, Pennsylvania

More information

Formative/Summative Assessments (Tests, Quizzes, reflective writing, Journals, Presentations)

Formative/Summative Assessments (Tests, Quizzes, reflective writing, Journals, Presentations) Biology Curriculum Map 2017-18 2 Weeks- Introduction to Biology: Scientific method, lab safety, organizing and analyzing data, and psuedoscience. This unit establishes the fundamental nature of scientific

More information

Types of biological networks. I. Intra-cellurar networks

Types of biological networks. I. Intra-cellurar networks Types of biological networks I. Intra-cellurar networks 1 Some intra-cellular networks: 1. Metabolic networks 2. Transcriptional regulation networks 3. Cell signalling networks 4. Protein-protein interaction

More information

Gene Ontology and Functional Enrichment. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein

Gene Ontology and Functional Enrichment. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein Gene Ontology and Functional Enrichment Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein The parsimony principle: A quick review Find the tree that requires the fewest

More information

Bioinformatics. Dept. of Computational Biology & Bioinformatics

Bioinformatics. Dept. of Computational Biology & Bioinformatics Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS

More information

Eero Vuorio 5 th EPSO Conference, Olos, Aug 29, 2010

Eero Vuorio 5 th EPSO Conference, Olos, Aug 29, 2010 Eero Vuorio 5 th EPSO Conference, Olos, Aug 29, 2010 Biocenter Finland in a nutshell Founded in August 2006 by six Finnish Universities the Biocenter Finland today functions as an umbrella organization

More information

Electronic Supplementary information (ESI) for. High-Performance Electrothermal and Anticorrosive Transparent

Electronic Supplementary information (ESI) for. High-Performance Electrothermal and Anticorrosive Transparent Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary information (ESI) for High-Performance Electrothermal

More information

Proteomics. Yeast two hybrid. Proteomics - PAGE techniques. Data obtained. What is it?

Proteomics. Yeast two hybrid. Proteomics - PAGE techniques. Data obtained. What is it? Proteomics What is it? Reveal protein interactions Protein profiling in a sample Yeast two hybrid screening High throughput 2D PAGE Automatic analysis of 2D Page Yeast two hybrid Use two mating strains

More information

Natural Selection results in increase in one (or more) genotypes relative to other genotypes.

Natural Selection results in increase in one (or more) genotypes relative to other genotypes. Natural Selection results in increase in one (or more) genotypes relative to other genotypes. Fitness - The fitness of a genotype is the average per capita lifetime contribution of individuals of that

More information

HORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS

HORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS HORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS OVERVIEW INTRODUCTION MECHANISMS OF HGT IDENTIFICATION TECHNIQUES EXAMPLES - Wolbachia pipientis - Fungus - Plants - Drosophila ananassae

More information

TEST SUMMARY AND FRAMEWORK TEST SUMMARY

TEST SUMMARY AND FRAMEWORK TEST SUMMARY Washington Educator Skills Tests Endorsements (WEST E) TEST SUMMARY AND FRAMEWORK TEST SUMMARY BIOLOGY Copyright 2014 by the Washington Professional Educator Standards Board 1 Washington Educator Skills

More information