SBI lab Jou-hyun Jeon Jae-seong Yang Solip Park Yonghwan Choi Yoonsup Choi Jinho Kim HyunJun Nam JiHye Hwang Inhae Kim Youngeun Shin Sung gyu Han
|
|
- Beatrice Knight
- 5 years ago
- Views:
Transcription
1 POSTECH 생명과학과김상욱
2 Structural Bioinformatics Laboratory Pohang University of Science and Technology Acknowledgement SBI lab Jou-hyun Jeon Jae-seong Yang Solip Park Yonghwan Choi Yoonsup Choi Jinho Kim HyunJun Nam JiHye Hwang Inhae Kim Youngeun Shin Sung gyu Han
3 Disease mechanism in the protein interaction network Disrupt the interaction interface leading to loss of function effect Modify the interaction properties recruiting of novel partners
4 Society Biological signaling network Internet
5 Biological Networks GENOME PROTEOME PHENOME 5 Citrate Cycle
6 Costanzo et al. The Genetic Landscape of a Cell. Science (2010) vol. 327 (5964) pp
7 Procedures to connect comorbidity and genetic associations
8 Genotype-phenotype connections Phenotype connections are triggered by various types of molecular connections
9 Integrative approach to predict phenotype connections
10 The human disease network Construction of the diseasome bipartite network PNAS May 22, 2007 vol. 104 no
11 Disease Gene Network
12 Example: Diabetes in the Human disease network
13 Protein subcellular localization and Human diseases
14 Relationships between disease-associated proteins and their subcellular localizations Mol Sys Biol :494.
15 Correlation between disease classes and subcellular localizations Mol Sys Biol :494.
16 The implication of subcellular localization for disease comorbidity Subcellular localization similarity of human diseases
17 The implication of subcellular localization for disease comorbidity Mol Sys Biol :494.
18 Subcellular localization and human diseases Construction of functional interaction networks through consensus localization predictions of the human proteome. Park et.al..j. Proteome Res., 2009, 8 (7), pp > Protein localization information facilitates the identification of disease associated genes
19 Network position reveals spatial and functional organization of mitochondrial proteins
20 Eye diseases Aging Heart failure Cancer Liver failure Dysfunction of mitochondria is related over 400 disease phenotypes Alzhaimer PLoS Comput Biol 5(4): e
21 Extensive experiments and bioinformatics approaches have been applied to identify mitochondrial proteome Experiments Bioinformatics EMBO reports 7, 9, (2006) Organellar proteomics: turning inventories into insights Jens S Andersen 1 & Matthias Mann 2 Park, S., Yang, J.S., Jang, S.K. and Kim, S. (2009) Construction of functional interaction networks through consensus localization predictions of the human proteome, J Proteome Res, 8, Identification of mitochondrial proteins
22 Identifying spatial organization of mitochondrial proteins provide key clues for functions
23 Assigning network position of mitochondrial proteins in functional interaction network
24 Network position reflects spatial organization of mitochondrial proteins
25 Network position reflects spatial organization of mitochondrial proteins
26 Network position reflects spatial organization of mitochondrial proteins
27 Network position reflects functional organization of mitochondrial proteins
28 Network positions are similar between same disease associated protein pairs
29 Network position can help to find mitochondrial disease candidates
30 Network position can help to find mitochondrial disease candidates Underlined genes in the disease candidates are known to be associated with mitochondrial diseases
31 Integrative approaches for network medicine of human diseases
32 Structural Bioinformatics Laboratory Pohang University of Science and Technology Acknowledgement SBI lab Jou-hyun Jeon Jae-seong Yang Solip Park Yonghwan Choi Yoonsup Choi Jinho Kim HyunJun Nam JiHye Hwang Inhae Kim Youngeun Shin Sung gyu Han
The Role of Network Science in Biology and Medicine. Tiffany J. Callahan Computational Bioscience Program Hunter/Kahn Labs
The Role of Network Science in Biology and Medicine Tiffany J. Callahan Computational Bioscience Program Hunter/Kahn Labs Network Analysis Working Group 09.28.2017 Network-Enabled Wisdom (NEW) empirically
More informationComputational Biology From The Perspective Of A Physical Scientist
Computational Biology From The Perspective Of A Physical Scientist Dr. Arthur Dong PP1@TUM 26 November 2013 Bioinformatics Education Curriculum Math, Physics, Computer Science (Statistics and Programming)
More informationMSc Drug Design. Module Structure: (15 credits each) Lectures and Tutorials Assessment: 50% coursework, 50% unseen examination.
Module Structure: (15 credits each) Lectures and Assessment: 50% coursework, 50% unseen examination. Module Title Module 1: Bioinformatics and structural biology as applied to drug design MEDC0075 In the
More informationGenome-wide multilevel spatial interactome model of rice
Sino-German Workshop on Multiscale Spatial Computational Systems Biology, Beijing, Oct 8-12, 2015 Genome-wide multilevel spatial interactome model of rice Ming CHEN ( 陈铭 ) mchen@zju.edu.cn College of Life
More informationNETWORK BIOLOGY AND COMPLEX DISEASES. Ahto Salumets
NETWORK BIOLOGY AND COMPLEX DISEASES Ahto Salumets CENTRAL DOGMA OF BIOLOGY https://en.wikipedia.org/wiki/central_dogma_of_molecular_biology http://www.qaraqalpaq.com/genetics.html CHROMOSOMES SINGLE-NUCLEOTIDE
More informationErzsébet Ravasz Advisor: Albert-László Barabási
Hierarchical Networks Erzsébet Ravasz Advisor: Albert-László Barabási Introduction to networks How to model complex networks? Clustering and hierarchy Hierarchical organization of cellular metabolism The
More informationMATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME
MATHEMATICAL MODELING AND THE HUMAN GENOME Hilary S. Booth Australian National University, Australia Keywords: Human genome, DNA, bioinformatics, sequence analysis, evolution. Contents 1. Introduction:
More informationModeling. FRANCK DELAPLACE IBISC GENOPOLE EVRY UNIVERSITY
1 Modeling FRANCK DELAPLACE Franck.delaplace@ibisc.univ-evry.fr IBISC GENOPOLE EVRY UNIVERSITY 2 R. Thom : «On essaye de dominer des situations à l aide de la modélisation, [..] en construisant un système
More informationLecture Notes for Fall Network Modeling. Ernest Fraenkel
Lecture Notes for 20.320 Fall 2012 Network Modeling Ernest Fraenkel In this lecture we will explore ways in which network models can help us to understand better biological data. We will explore how networks
More informationClustering and Network
Clustering and Network Jing-Dong Jackie Han jdhan@picb.ac.cn http://www.picb.ac.cn/~jdhan Copy Right: Jing-Dong Jackie Han What is clustering? A way of grouping together data samples that are similar in
More informationGSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H*" ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION
FIFTH EDITION IV I ^HHk ^ttm IZTI/^Q i I II MPHBBMWBBIHB '-llwmpbi^hbwm^^pfc ' GSBHSRSBRSRRk LlML I I \l 1MB ^HP'^^MMMP" jflp^^^^^^^^st I Iv^O FROM GENES TO GENOMES %^MiM^PM^^MWi99Mi$9i0^^ ^^^^^^^^^^^^^V^^^fii^^t^i^^^^^
More informationAn Information-Theoretic Approach to Methylation Data Analysis
An Information-Theoretic Approach to Methylation Data Analysis John Goutsias Whitaker Biomedical Engineering Institute The Johns Hopkins University Baltimore, MD 21218 Objective Present an information-theoretic
More informationUsing phylogenetics to estimate species divergence times... Basics and basic issues for Bayesian inference of divergence times (plus some digression)
Using phylogenetics to estimate species divergence times... More accurately... Basics and basic issues for Bayesian inference of divergence times (plus some digression) "A comparison of the structures
More informationBiology Scope and Sequence Student Outcomes (Objectives Skills/Verbs)
C-4 N.12.A 1-6 N.12.B.1-4 Scientific Literacy/ Nature of (embedded throughout course) Scientific Inquiry is the process by which humans systematically examine the natural world. Scientific inquiry is a
More informationSuper Flexible, High-efficiency Perovskite Solar Cells Employing Graphene Electrodes: Toward Future Foldable Power Sources
Electronic Supplementary Material (ESI) for Energy & Environmental Science. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information Super Flexible, High-efficiency Perovskite
More informationWhat are mitochondria?
What are mitochondria? What are mitochondria? An intracellular organelle. There are 100 to 1000s of mitochondria/cell. Most mitochondria come from the mother. Mitochondria have their own DNA Mitochondria
More informationTitle: Evolutionary dynamics of the protein structure-function relation and the origin of the genetic code
Blue Waters Illinois Allocation Report 2016 Primary contact email and name: NAME: Dr. Gustavo Caetano-Anolles EMAIL: gca@illinois.edu Title: Evolutionary dynamics of the protein structure-function relation
More informationUpdated: 10/11/2018 Page 1 of 5
A. Academic Division: Health Sciences B. Discipline: Biology C. Course Number and Title: BIOL1230 Biology I MASTER SYLLABUS 2018-2019 D. Course Coordinator: Justin Tickhill Assistant Dean: Melinda Roepke,
More informationMitochondrial phosphoproteome
Mitochondrial phosphoproteome Claire Lemaire UMR8221, CNRS, CEA, Université Paris-Sud CEA Saclay/ ibitec-s/sb2sm/lpm Mai 2014 1 Importance of the regulation by phosphorylation A large proportion of the
More informationFRAUNHOFER IME SCREENINGPORT
FRAUNHOFER IME SCREENINGPORT Design of screening projects General remarks Introduction Screening is done to identify new chemical substances against molecular mechanisms of a disease It is a question of
More informationWhat is Systems Biology
What is Systems Biology 2 CBS, Department of Systems Biology 3 CBS, Department of Systems Biology Data integration In the Big Data era Combine different types of data, describing different things or the
More information09/30/2017. Kyu-Sun Lee, Ph.D. Metabolism & Neurophysiology Research Group Hazard Monitoring BNT Res Center
09/30/2017 Kyu-Sun Lee, Ph.D. Metabolism & Neurophysiology Research Group Hazard Monitoring BNT Res Center Conflict of interest disclosure None Committee of Scientific Affairs Committee of Scientific Affairs
More informationDesign, Synthesis and Biological Evaluation of Novel. Deguelin-Based Heat Shock Protein 90 (HSP90) Inhibitors
Design, Synthesis and Biological Evaluation of Novel Deguelin-Based Heat Shock Protein 90 (HSP90) Inhibitors Targeting Proliferation and Angiogenesis Dong-Jo Chang, Hongchan An, Kyoung-suk Kim, Hyun Ho
More informationUndergraduate Curriculum in Biology
Fall Courses *114: Principles of Biology *116: Introduction to Anatomy and Physiology I 302: Human Learning and the Brain (o, DS) 336: Aquatic Biology (p/e) 339: Aquatic Biology Lab (L) 351: Principles
More informationMechanical Engineering Science Requirements
Mechanical Engineering Requirements This file is a representation of all courses that Mechanical Engineering students can take to satisfy the requirement. ME students are required to take Physics II and
More informationMitochondrial dynamics in ischemia and reperfusion
Mitochondrial dynamics in ischemia and reperfusion Derek J Hausenloy Reader in Cardiovascular Medicine, British Heart Foundation Senior Clinical Research Fellow, The Hatter Cardiovascular Institute, University
More informationFour specialisations. Cell and System Biology. Evolution and Behaviour. Ecology and Environment
Master in Biology Four specialisations Cell and System Biology Evolution and Behaviour Ecology and Environment 1 Three professional profiles Research Education Management 2 two years - 120 ECTS points
More informationBiochemistry-BS Program Study Abroad Pathway
Biochemistry-BS Program Study Abroad Pathway (last revised September 2016) Table 1a: Undergraduate Program Schedule These undergraduate program schedules are subject to change. Please verify information
More informationExpression QTLs and Mapping of Complex Trait Loci. Paul Schliekelman Statistics Department University of Georgia
Expression QTLs and Mapping of Complex Trait Loci Paul Schliekelman Statistics Department University of Georgia Definitions: Genes, Loci and Alleles A gene codes for a protein. Proteins due everything.
More informationGene regulation: From biophysics to evolutionary genetics
Gene regulation: From biophysics to evolutionary genetics Michael Lässig Institute for Theoretical Physics University of Cologne Thanks Ville Mustonen Johannes Berg Stana Willmann Curt Callan (Princeton)
More informationProteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering
Proteomics 2 nd semester, 2013 1 Text book Principles of Proteomics by R. M. Twyman, BIOS Scientific Publications Other Reference books 1) Proteomics by C. David O Connor and B. David Hames, Scion Publishing
More informationPredicting Protein Functions and Domain Interactions from Protein Interactions
Predicting Protein Functions and Domain Interactions from Protein Interactions Fengzhu Sun, PhD Center for Computational and Experimental Genomics University of Southern California Outline High-throughput
More informationPathway Association Analysis Trey Ideker UCSD
Pathway Association Analysis Trey Ideker UCSD A working network map of the cell Network evolutionary comparison / cross-species alignment to identify conserved modules The Working Map Network-based classification
More information# shared OGs (spa, spb) Size of the smallest genome. dist (spa, spb) = 1. Neighbor joining. OG1 OG2 OG3 OG4 sp sp sp
Bioinformatics and Evolutionary Genomics: Genome Evolution in terms of Gene Content 3/10/2014 1 Gene Content Evolution What about HGT / genome sizes? Genome trees based on gene content: shared genes Haemophilus
More informationSystems biology and biological networks
Systems Biology Workshop Systems biology and biological networks Center for Biological Sequence Analysis Networks in electronics Radio kindly provided by Lazebnik, Cancer Cell, 2002 Systems Biology Workshop,
More informationStatistical mass spectrometry-based proteomics
1 Statistical mass spectrometry-based proteomics Olga Vitek www.stat.purdue.edu Outline What is proteomics? Biological questions and technologies Protein quantification in label-free workflows Joint analysis
More informationYear: Subject Area: Biochemistry, Genetics and Molecular Biology. Subject Category: Aging.
Year: 2011. Subject Category: Aging. 1 Aging Cell 2 Ageing Research Reviews 3 Psychology and Aging 4 Journals of Gerontology - Series A Biological Sciences and Medical Sciences 5 Mechanisms of Ageing and
More informationTE content correlates positively with genome size
TE content correlates positively with genome size Mb 3000 Genomic DNA 2500 2000 1500 1000 TE DNA Protein-coding DNA 500 0 Feschotte & Pritham 2006 Transposable elements. Variation in gene numbers cannot
More informationCardiolipin Remodeling by ALCAT1 Regulates Dilated Cardiomyopathy Through Oxidative Stress and Mitophagy. Yuguang (Roger) Shi
Cardiolipin Remodeling by ALCAT1 Regulates Dilated Cardiomyopathy Through xidative Stress and Mitophagy Yuguang (Roger) Shi yus11@psu.eud Cardiolipin Biosynthetic and Remodeling Pathways Phosphatidic Acid
More informationBioinformatics. Genotype -> Phenotype DNA. Jason H. Moore, Ph.D. GECCO 2007 Tutorial / Bioinformatics.
Bioinformatics Jason H. Moore, Ph.D. Frank Lane Research Scholar in Computational Genetics Associate Professor of Genetics Adjunct Associate Professor of Biological Sciences Adjunct Associate Professor
More informationUndergraduate Curriculum in Biology
Fall Courses *114: Principles of Biology *116: Introduction to Anatomy and Physiology I 302: Human Learning and the Brain (o, DS) 336: Aquatic Biology (p/e) 339: Aquatic Biology Lab (L) 351: Principles
More informationThe geneticist s questions
The geneticist s questions a) What is consequence of reduced gene function? 1) gene knockout (deletion, RNAi) b) What is the consequence of increased gene function? 2) gene overexpression c) What does
More informationTaxonomy. Content. How to determine & classify a species. Phylogeny and evolution
Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature
More informationProportional Variance Explained by QLT and Statistical Power. Proportional Variance Explained by QTL and Statistical Power
Proportional Variance Explained by QTL and Statistical Power Partitioning the Genetic Variance We previously focused on obtaining variance components of a quantitative trait to determine the proportion
More informationMiller & Levine Biology
A Correlation of To the Science Biology A Correlation of, 2014 to the, Table of Contents From Molecules to Organisms: Structures and Processes... 3 Ecosystems: Interactions, Energy, and Dynamics... 4 Heredity:
More informationAn introduction to SYSTEMS BIOLOGY
An introduction to SYSTEMS BIOLOGY Paolo Tieri CNR Consiglio Nazionale delle Ricerche, Rome, Italy 10 February 2015 Universidade Federal de Minas Gerais, Belo Horizonte, Brasil Course outline Day 1: intro
More informationCurriculum Guide for 8th_ Grade (UPDATED 6/4/2013)
Curriculum Guide for 8th_ Grade (UPDATED 6//01) NGSS T.E. Book Title Critical Content (Big Idea written as a question) Student chapter & Section Objectives/Key Concepts (Please write as a statement.).1.1
More informationIntroduction to Systems Biology
Introduction to Systems Biology References: Watson s Molecular Biology of the Gene, Chapter 22 Alberts Molecular Biology of the Cell, Chapter 7 Yousof Gheisari ygheisari@med.mui.ac.ir Why is this picture
More informationBIOL-UA38: Genome Biology
Lectures Recitation Text Instructors 75 minutes, twice per week (Mondays and Wednesdays, 9:30-10:45am) 75 minutes, once per week (Wednesday 5:00pm-6:15pm) A Primer of Genome Science, 3rd edition Greg Gibson
More informationSupplementary information. A proposal for a novel impact factor as an alternative to the JCR impact factor
Supplementary information A proposal for a novel impact factor as an alternative to the JCR impact factor Zu-Guo Yang a and Chun-Ting Zhang b, * a Library, Tianjin University, Tianjin 300072, China b Department
More informationYifei Bao. Beatrix. Manor Askenazi
Detection and Correction of Interference in MS1 Quantitation of Peptides Using their Isotope Distributions Yifei Bao Department of Computer Science Stevens Institute of Technology Beatrix Ueberheide Department
More informationCarri-Lyn Mead Thursday, January 13, 2005 Terry Fox Laboratory, Dr. Dixie Mager
Investigating Trends in Transposable Element Insertion within Regulatory Regions Carri-Lyn Mead cmead@bcgsc.ca Thursday, January 13, 2005 Terry Fox Laboratory, Dr. Dixie Mager Outline Transposable Element
More informationMolecular Biology Of The Cell 6th Edition Alberts
We have made it easy for you to find a PDF Ebooks without any digging. And by having access to our ebooks online or by storing it on your computer, you have convenient answers with molecular biology of
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Breker et al., http://www.jcb.org/cgi/content/full/jcb.201301120/dc1 Figure S1. Single-cell proteomics of stress responses. (a) Using
More informationCONCEPT Year Schedule Master Biomolecular Sciences Specialization Molecular Cell Biology
Course Project Elective Elective (6 ec) Exams Holidays CONCEPT Year Schedule Master Sciences 2017-2018 Specialization Cell Biology Scientific Writing in English (AM_BMOL) (3 1156 modified: 6-7-2017 period
More informationBioinformatics 2. Yeast two hybrid. Proteomics. Proteomics
GENOME Bioinformatics 2 Proteomics protein-gene PROTEOME protein-protein METABOLISM Slide from http://www.nd.edu/~networks/ Citrate Cycle Bio-chemical reactions What is it? Proteomics Reveal protein Protein
More informationGenetic dissection of the Arabidopsis thaliana ionome
Genetic dissection of the Arabidopsis thaliana ionome Genome Ionome Landscape distribution David E Salt Purdue University, USA What is the Ionome Environment Transcriptome Proteome Ionome The elemental
More informationConstructing a Pedigree
Constructing a Pedigree Use the appropriate symbols: Unaffected Male Unaffected Female Affected Male Affected Female Male carrier of trait Mating of Offspring 2. Label each generation down the left hand
More informationUSING BLAST TO IDENTIFY PROTEINS THAT ARE EVOLUTIONARILY RELATED ACROSS SPECIES
USING BLAST TO IDENTIFY PROTEINS THAT ARE EVOLUTIONARILY RELATED ACROSS SPECIES HOW CAN BIOINFORMATICS BE USED AS A TOOL TO DETERMINE EVOLUTIONARY RELATIONSHPS AND TO BETTER UNDERSTAND PROTEIN HERITAGE?
More informationUE Praktikum Bioinformatik
UE Praktikum Bioinformatik WS 08/09 University of Vienna 7SK snrna 7SK was discovered as an abundant small nuclear RNA in the mid 70s but a possible function has only recently been suggested. Two independent
More informationCoding sequence array Office hours Wednesday 3-4pm 304A Stanley Hall
Coding sequence array Office hours Wednesday 3-4pm 304A Stanley Hall Review session 5pm Thursday, Dec. 11 GPB100 Fig. 1.13 RNA-seq Expression effects of cancer AAAAA AAAAA AAAAA Solexa sequencing counts
More informationBIOLOGY Chair Associate Chair Faculty with Research Interests Degree Programs Other Degree Programs in Biology Research Honors Program
Biology 1 BIOLOGY Robert A. Pritzker Science Center, Room 182 3101 S. Dearborn St. Chicago, IL 60616 312.567.3480 kersh@iit.edu science.iit.edu/biology Chair Thomas Irving Associate Chair Tanya Bekyarova
More informationExecutive Summary. IP Owner Summary. Personal Description of Researcher. Market Feasibility. Key Technology Highlights. Trend & Partnership
POSTECH Executive Summary Dr. Kimoon Kim, a professor of Postech, has researched supramolecular chemistry using cucurbituril and developed cucurbit[n]uril (CB[n], n=5-10) and functionalized CB[n] with
More informationThe minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
More informationGraduate Funding Information Center
Graduate Funding Information Center UNC-Chapel Hill, The Graduate School Graduate Student Proposal Sponsor: Program Title: NESCent Graduate Fellowship Department: Biology Funding Type: Fellowship Year:
More informationSTATE UNIVERSITY OF NEW YORK COLLEGE OF TECHNOLOGY CANTON, NEW YORK. COURSE OUTLINE BIOL 310 The Human Genome. Prepared By: Ron Tavernier
STATE UNIVERSITY OF NEW YORK COLLEGE OF TECHNOLOGY CANTON, NEW YORK COURSE OUTLINE BIOL 310 The Human Genome Prepared By: Ron Tavernier SCHOOL OF SCIENCE, HEALTH & CRIMINAL JUSTICE SCIENCE DEPARTMENT May
More informationMiller & Levine Biology 2014
A Correlation of Miller & Levine Biology To the Essential Standards for Biology High School Introduction This document demonstrates how meets the North Carolina Essential Standards for Biology, grades
More informationEducation RESEARCH CAREER
Prof. Sun Tae KIM Assistant Professor, Department of Plant Bioscience College of Natural Resources & Life Science Pusan National University, 50 Cheonghak, Samrangjin, Miryang, 627-706, Korea TEL: +82-055-350-5505
More informationSubcellular Localisation of Proteins in Living Cells Using a Genetic Algorithm and an Incremental Neural Network
Subcellular Localisation of Proteins in Living Cells Using a Genetic Algorithm and an Incremental Neural Network Marko Tscherepanow and Franz Kummert Applied Computer Science, Faculty of Technology, Bielefeld
More informationEvidence for dynamically organized modularity in the yeast protein-protein interaction network
Evidence for dynamically organized modularity in the yeast protein-protein interaction network Sari Bombino Helsinki 27.3.2007 UNIVERSITY OF HELSINKI Department of Computer Science Seminar on Computational
More informationNetwork Biology: Understanding the cell s functional organization. Albert-László Barabási Zoltán N. Oltvai
Network Biology: Understanding the cell s functional organization Albert-László Barabási Zoltán N. Oltvai Outline: Evolutionary origin of scale-free networks Motifs, modules and hierarchical networks Network
More information1.1. KEY CONCEPT Biologists study life in all its forms. 4 Reinforcement Unit 1 Resource Book. Biology in the 21st Century CHAPTER 1
1.1 THE STUDY OF LIFE KEY CONCEPT Biologists study life in all its forms. Biology is the scientific study of all forms of life. Living things are found almost everywhere on Earth, from very hot environments
More informationComputational methods for predicting protein-protein interactions
Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational
More informationProteomics Systems Biology
Dr. Sanjeeva Srivastava IIT Bombay Proteomics Systems Biology IIT Bombay 2 1 DNA Genomics RNA Transcriptomics Global Cellular Protein Proteomics Global Cellular Metabolite Metabolomics Global Cellular
More informationDevelopment of a Non-invasive Ultrasonic Measurement System for tissue elasticity
J Biomed Eng Res : 469-475 29 이균정 1 최우혁 1 유재원 1 서종범 1 최서형 2 신태민 1 1 Development of a Non-invasive Ultrasonic Measurement System for tissue elasticity G J Lee 1 W H choi 1 J W Yu 1 J B Seo 1 S H Choi 2
More informationBiology I Level - 2nd Semester Final Review
Biology I Level - 2nd Semester Final Review The 2 nd Semester Final encompasses all material that was discussed during second semester. It s important that you review ALL notes and worksheets from the
More informationIntroduction to Bioinformatics. Shifra Ben-Dor Irit Orr
Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A
More informationChapter 16. Table of Contents. Section 1 Genetic Equilibrium. Section 2 Disruption of Genetic Equilibrium. Section 3 Formation of Species
Population Genetics and Speciation Table of Contents Section 1 Genetic Equilibrium Section 2 Disruption of Genetic Equilibrium Section 3 Formation of Species Section 1 Genetic Equilibrium Objectives Identify
More informationIdentify stages of plant life cycle Botany Oral/written pres, exams
DPI Standards Biology Education (for students) 1. Characteristics of organisms Know Properties of living organisms, including: Acquire and use energy and materials Sense and respond to stimuli Reproduce
More informationA DNA Sequence 2017/12/6 1
A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta
More informationGENETICS - CLUTCH CH.1 INTRODUCTION TO GENETICS.
!! www.clutchprep.com CONCEPT: HISTORY OF GENETICS The earliest use of genetics was through of plants and animals (8000-1000 B.C.) Selective breeding (artificial selection) is the process of breeding organisms
More informationInferring Transcriptional Regulatory Networks from Gene Expression Data II
Inferring Transcriptional Regulatory Networks from Gene Expression Data II Lectures 9 Oct 26, 2011 CSE 527 Computational Biology, Fall 2011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday
More informationTHE ROLE OF BBSRC IN BIODIVERSITY RESEARCH
THE ROLE OF BBSRC IN BIODIVERSITY RESEARCH INTRODUCTION The aim of this document is to explain the role of biodiversity research in the delivery of the BBSRC mission, and thereby to provide guidance to
More informationInnovative Nanosensor for Disease Diagnosis
Supporting Information Innovative Nanosensor for Disease Diagnosis Sang Joon Kim,, Seon Jin Choi,,, Ji Soo Jang, Hee Jin Cho, and Il Doo Kim,* Department of Materials Science and Engineering, Korea Advanced
More informationDropping Your Genes. A Simulation of Meiosis and Fertilization and An Introduction to Probability
Dropping Your Genes A Simulation of Meiosis and Fertilization and An Introduction to To fully understand Mendelian genetics (and, eventually, population genetics), you need to understand certain aspects
More informationDrosophila melanogaster and D. simulans, two fruit fly species that are nearly
Comparative Genomics: Human versus chimpanzee 1. Introduction The chimpanzee is the closest living relative to humans. The two species are nearly identical in DNA sequence (>98% identity), yet vastly different
More informationProtein function studies: history, current status and future trends
19 3 2007 6 Chinese Bulletin of Life Sciences Vol. 19, No. 3 Jun., 2007 1004-0374(2007)03-0294-07 ( 100871) Q51A Protein function studies: history, current status and future trends MA Jing, GE Xi, CHANG
More informationEffective Capacitance Enhancement Methods for 90-nm DRAM Capacitors
Journal of the Korean Physical Society, Vol. 44, No. 1, January 2004, pp. 112 116 Effective Capacitance Enhancement Methods for 90-nm DRAM Capacitors Y. K. Park, Y. S. Ahn, S. B. Kim, K. H. Lee, C. H.
More informationLecture 4: Yeast as a model organism for functional and evolutionary genomics. Part II
Lecture 4: Yeast as a model organism for functional and evolutionary genomics Part II A brief review What have we discussed: Yeast genome in a glance Gene expression can tell us about yeast functions Transcriptional
More informationSWEEPFINDER2: Increased sensitivity, robustness, and flexibility
SWEEPFINDER2: Increased sensitivity, robustness, and flexibility Michael DeGiorgio 1,*, Christian D. Huber 2, Melissa J. Hubisz 3, Ines Hellmann 4, and Rasmus Nielsen 5 1 Department of Biology, Pennsylvania
More informationFormative/Summative Assessments (Tests, Quizzes, reflective writing, Journals, Presentations)
Biology Curriculum Map 2017-18 2 Weeks- Introduction to Biology: Scientific method, lab safety, organizing and analyzing data, and psuedoscience. This unit establishes the fundamental nature of scientific
More informationTypes of biological networks. I. Intra-cellurar networks
Types of biological networks I. Intra-cellurar networks 1 Some intra-cellular networks: 1. Metabolic networks 2. Transcriptional regulation networks 3. Cell signalling networks 4. Protein-protein interaction
More informationGene Ontology and Functional Enrichment. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein
Gene Ontology and Functional Enrichment Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein The parsimony principle: A quick review Find the tree that requires the fewest
More informationBioinformatics. Dept. of Computational Biology & Bioinformatics
Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS
More informationEero Vuorio 5 th EPSO Conference, Olos, Aug 29, 2010
Eero Vuorio 5 th EPSO Conference, Olos, Aug 29, 2010 Biocenter Finland in a nutshell Founded in August 2006 by six Finnish Universities the Biocenter Finland today functions as an umbrella organization
More informationElectronic Supplementary information (ESI) for. High-Performance Electrothermal and Anticorrosive Transparent
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary information (ESI) for High-Performance Electrothermal
More informationProteomics. Yeast two hybrid. Proteomics - PAGE techniques. Data obtained. What is it?
Proteomics What is it? Reveal protein interactions Protein profiling in a sample Yeast two hybrid screening High throughput 2D PAGE Automatic analysis of 2D Page Yeast two hybrid Use two mating strains
More informationNatural Selection results in increase in one (or more) genotypes relative to other genotypes.
Natural Selection results in increase in one (or more) genotypes relative to other genotypes. Fitness - The fitness of a genotype is the average per capita lifetime contribution of individuals of that
More informationHORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS
HORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS OVERVIEW INTRODUCTION MECHANISMS OF HGT IDENTIFICATION TECHNIQUES EXAMPLES - Wolbachia pipientis - Fungus - Plants - Drosophila ananassae
More informationTEST SUMMARY AND FRAMEWORK TEST SUMMARY
Washington Educator Skills Tests Endorsements (WEST E) TEST SUMMARY AND FRAMEWORK TEST SUMMARY BIOLOGY Copyright 2014 by the Washington Professional Educator Standards Board 1 Washington Educator Skills
More information