What is Systems Biology

Size: px
Start display at page:

Download "What is Systems Biology"

Transcription

1 What is Systems Biology

2 2 CBS, Department of Systems Biology

3 3 CBS, Department of Systems Biology

4 Data integration In the Big Data era Combine different types of data, describing different things or the same thing with different error City guide analogy: Road maps Arial pictures of buildings Google Maps Street-level pictures Restaurant reviews 4 CBS, Department of Systems Biology

5 Reduction vs Holistic Reductionism seeks to find individual factors that explain/cause a phenomenon Typically study one factor at a time Which cells -> which organelle -> which molecules -> which sites on these molecules -> which atoms and H-bonds involved? Holistic approach looks at many or all components of the system and the interplay between them E.g. map of whole city (as opposed to map of one road) Understanding cancer (requires understanding of many different biological processes) 5 CBS, Department of Systems Biology

6 Increasing Interest in Systems Biology PubMed Term Publications Bioinformatics Systems Biology Cell Cycle Yeast genome completed Nobel Prize for Cell Cycle Human genome completed Year 6 CBS, Department of Systems Biology

7 Also, systems Biology is a top-down science Systems Biology Integration Normal Biology Reducitonist 7 CBS, Department of Systems Biology

8 Systems biology and emerging properties 8 CBS, Department of Systems Biology

9 Integration of whole x-ome to understand life in health and disease genome metabolome LIFE etceterome transcriptome lipidome proteome 9 CBS, Department of Systems Biology

10 10 CBS, Department of Systems Biology

11 From components to models

12 Transcriptional regulation of the Cell Cycle Simon et al. Cell CBS, Department of Systems Biology

13 13 CBS, Department of Systems Biology

14 14 CBS, Department of Systems Biology Tyson JJ, Novak B, J. Theor. Biol. 2001

15 Carbohydrate metabolic map 15 CBS, Department of Systems Biology

16 Mathematical abstraction of biochemistry 16 CBS, Department of Systems Biology

17 The hierarchy of models 17 CBS, Department of Systems Biology

18 The hierarchy of models 18 CBS, Department of Systems Biology

19 From components to models

20 One framework for Systems Biology (part 1) 1. The components. Discover all of the genes in the genome and the subset of genes, proteins, and other small molecules constituting the pathway of interest. If possible, define an initial model of the molecular interactions governing pathway function (how?). 2. Pathway perturbation. Perturb each pathway component through a series of genetic or environmental manipulations. Detect and quantify the corresponding global cellular response to each perturbation. 20 CBS, Department of Systems Biology

21 One framework for Systems Biology (part 2) 3. Model Reconciliation. Integrate the observed mrna and protein responses with the current, pathwayspecific model and with the global network of proteinprotein, protein-dna, and other known physical interactions. 4. Model verification/expansion. Formulate new hypotheses to explain observations not predicted by the model. Design additional perturbation experiments to test these and iteratively repeat steps (2), (3), and (4). 21 CBS, Department of Systems Biology

22 From model to experiment and back again 22 CBS, Department of Systems Biology

23 Systems Biology to address the knowledge/data problem Genome sequencing

24 The human genome sequencing project (HGP) CBS, Department of Systems Biology

25 Sequencing costs over time Drop in costs is faster than Moore s Law (Computer power doubles every 2 years) 25 CBS, Department of Systems Biology

26 Sequencing capability: throughput per machine Kilobases per day per machine 1,000,000, ,000,000 10,000,000 1,000, , ,000 1, Manual slab gel Sanger Chain-termination method 26 CBS, Department of Systems Biology ~3X coverage of a human genome Gel-based systems Automated slab gel Capillary sequencing First-generation capillary Year Human genome Massively parallel sequencing Microwell pyrosequencing Second-generation capillary sequencer 2005 Single molecule? Short-read sequencers 2010 Future

27 Right now, upstairs in DMAC Output: ~30 Gbp/day Human genome is 3.2 Gbp 27 CBS, Department of Systems Biology

28 Completely sequenced genomes by year 28 CBS, Department of Systems Biology

29 Bioinformatics And the wealth of information

30 TCCAAACCCAGGCTCTCTCCCAAACCAGTTTGCGGCAGATGGCCAGTGGAACCTCACTCTCCTCATCAGTAAAAAGGGGGCAGAGTGAGGGTCCTGAGAGCTAGTACAGGGACTGTG TGAAGTAGACAATGCCCAGTGTTTAGCGTAAGAATCAGGGTCCAGCTGGTGCTCCCTAAACAGCAGCTGCTGTTCACTGTTGAAAGGCGCTCTGGAAGGCCAGGCGCGGTGGCTCAT GCTTGTAATCCCAGCACTGTGGGAGGCCGAGGTGGGCGGATCACCTGAGGTAGGGAGTTCGAGACCAGCCTGACCAACGTGGAGAAACCCCATCTCTCCTAAAAATACAAAATTAGC CAGGCGTGGTAGCACATACCTGTAATCCCAGCGACTCGGGAGGCTGAGGCAAGAGAATTGCTTGAAACCAGCAGGGGAGGTTGTGGTGAGCCAAGATCGAGCCATTGCACTCCAGCC AGGGCAACAAGAGGCAAAATGGCGAAACTCCATCTCCGAGAAAAAAAAAAAAAAAGAATACTTTCTGAAAGTATTTATTCATACAAATAAAGACTTGACCCATAAGGTAGGAACGCA AATGGGCCACGGAATCACTCATTCCACAGTATACACCGAGTGCCCTTGAAGTGCTGGGCACTGCTCCAGGATTGGGGGCATATTGGTGAAAAGAGAAGCAAGCCTGCCTGCTCAGAT GGCAGGGAATGGGGAAAAACAGGGAGACAGTTTCCTGTTTGAGATGTTGGGAGTCTGCTTCGAGTAGTATATTTACTGGAAATAGACCACTAACTTGGATGTCCCTTTTTGGAAATG TGCCTGCGTCCAGGGCTGGGTTGGGGCCCCAATGAACTTTGGCTCTGACATAGCTGTTGCCACACTCAGTGGAACTGAATCCATGTTTGCCTTCACCCGGCATCCTTCACCCCAACT CTCCCCGCCACAACATACATCCCATGCCAGCCTGGGGACCCTCAAAGGTGCTTCATCATTAGGTTTGTGGCTGGGTCCTACTGAAGTAAGTCTTGGCACTCAGAGGGATAGGAATTG AATGAAGACATGAGATTCCTCTGCGGGAGGCCTCTCTAGGAAATCTGTGGACTCACACGTTTACTAATGTTGCTGCAGCCCCGCACCCACCTTGGCCTTGGGCAGCCATACTCTAGG GCTTTTGTAACCTCTCCATGTGAGGAACTCAAATTAGACCTGGGTTTGGAGGCGGTGCTCCGAGCTGGCCTTTGGGGGAGGTTTTGTGCGAGGCATTTCCCAAGTGCTGGCAGGATT GTGTCACAGACACAGAGTAAACTTTTGCTGGGCTCCAAGTGACCGCCCATAGTTTATTATAAAGGTGACTGCACCCTGCAGCCACCAGCACTGCCTGGCTCCACGTGCCTCCTGGTC TCAGTATGGCGCTGTCCTGGGTTCTTACAGTCCTGAGCCTCCTACCTCTGCTGGAAGCCCAGATCCCATTGTGTGCCAACCTAGTACCGGTGCCCATCACCAACGCCACCCTGGACC GGGTGAGTGCCTGGGCTAGCCCTGTCCTGAGCACATGGGCAGCTGCCTCCCTTCTCTGGGCTTCCCTTTACCTGCTGGCTGTGGTCGCACCCCCACTCCCAGCTCTGCCTTTTTCTC TTCTGGGTCCCCAGGGTGAAATTCTCACCAGCCCAGGGGACTCTGGAGGCACCCCCTGCCTCCAAACACAGAAGCCTCACTGCAGAGTCCTTCACGGAGGACGGTTCTGTGCTGGGC CTGGAGGGGCTGCCTGGGGGGCAATGACTGATCCTCAGGGTGAGCTCCTGCATGCGCACTGCCCACCAGGGGCCTCATCTCCCCATCTGCAAAATCAGGGAGAGATCTGCCTGAGTC TCCTCCCAGCTGACAGTCAAAGATTCAGCATCAAGCCCCCATCACCAGCTCCCCCCTTCTCCCCAGATCACTGGCAAGTGGTTTTATATCGCATCGGCCTTTCGAAACGAGGAGTAC AATAAGTCGGTTCAGGAGATCCAAGCAACCTTCTTTTACTTTACCCCCAACAAGACAGAGGACACGATCTTTCTCAGAGAGTACCAGACCCGGTGAGAGCCCCCATTCCAATGCACC CCCGATCTCAGCTGTCTGGCCAGAAGACCTGAGCAAGTCCCTCCTTCTTCCTGGCCTTGGCCTTCCCATGGGTGGAACCGGGAGGGTTGGCTTTAATCTCCACCAGAACTCTTGCCC CGGGACTGTGATGGGCGATTGGCCACTTCTCCTCGATAACATTACTGTTTTTCTTCCGCCTTCTGGTTGACTTTAGCCAGAACCAGTGCTTCTATAACTCCAGTTACCTGAATGTCC AGCGGGAGAATGGGACCGTCTCCAGATACGGTGAGGGCCAGCCCTCAGGCAGGAGGGTTCACCGTGGGAACAGGGCAGGCCAGCATAAGGTGGGGGCTGGATGTAGAGCCCTGGAGG CTTTGGGCACAGAGAAATAACCACTAACATTTTTGAGCTCTTACCACGTGCTCAGAAAAAATCCCTAAGAAGACACTGAGAGAATTAGATGAGGAAACATAAGAACAGAGACCTCAA ATAGTTTCCCCAAGGTCACACAGCTTATAATTAGAACTAGAATTGGAACTCCAGGCTGGCTTCAGATCTGCCTCTCTCTCACGCCCTCTTTAAGATCCTTTGCAAACCAATGGTAGA AGCCTGTATGTTGGAGAGGTGGTACCTTCAACTATGTCCCCCATCACCGCAGAGGTGGCACATGGCAGGGATCTGATGGAGCTGAACTGACATCATTTAGCATCCCGAGCCTCCTCT CTGGGCCTCATTTTCCTCCTCTGTAAAACGGGGAGAAAGGCCCTGACAGCCACAGTCTGTGTGAGGCTCCTGAGATCTCATGTACAGAAAGTGCTTGGCGTGGAGCTGGGCACGCAG CAGGGGCTGGGCACACGGTGGCCCAAAGGAGACCCGGGCCTTCACTGATGGGCTTTGTGGCCCCGGACACATTTCTCTTCCAGAGGGAGGCCGAGAACATGTTGCTCACCTGCGTTC CTTAGGGACACCCCTAGGACTCCTCACCTGTAAGACAGGCACCATTGTGCCATCCCATGTTCTCACCCAGAGGCTCTTAAGACCTTGATGTTTGGTTCCTACCTGGACGATGAGAAG AACTGGGGGCTGTCTTTCTATGGTAGGCATGCTTAGCAGCCCCAAACTCATGCCCCTCTCAGGCCTCACCCCCCATTCACCCACCCCTGGGCTGGCCCCTAGAACCCCAGCCCTCCC TGGCCTCCGCCGGGCCCCACCATGTCCCCAGTCAGTCTCCTTGCTCCCCCTGCAGCTGACAAGCCAGAGACGACCAAGGAGCAACTGGGAGAGTTCTACGAAGCTCTCGACTGCTTG TGCATTCCCAGGTCAGATGTCATGTACACCGACTGGAAAAAGGTAAACGCAAGGGATTGGACATTGCCCACCTTGTCCATGGCCCAACTTGGGCAGCCCCAGAGGCCCAGAGCAGGA AAGCTGCCAGGCAAGGCTGCACAGCTAGGCAGATCTTCTGCTTTTAGGCACCTGCCTCACTGTAGGGACAGCTGAGCTCTACAGAGGCCCAGGGGTGGTGGATGAGAGCCCAGGAGG GAGAAGTCCCTGTGAAACCAGGGAGGACCTGAAAGCTAACAGGAGGGAACAGCGTGAGCCACGGGGTTGGGGGATTGGCAATTGGAGGGGACGTAATGCGGGGAGTTACCACCTACA GACGCGTCCCAAACCCCAGGCTTTCACCCCAACCTCCACTCCCCGCTCATTTTTAATACCCGTGCAGTGGGGAATTGATACTGTGGTTTTCAATGTCACCCACACTGCAGCACGGCC ACAGTCACCATCCCGATTTTTGCTACAAATGAAAATTACTGTATAATGAGCTCCTTAACACTTTTCTTTAAACCTGTGTTTGGAAGACTTGTGTTGGTGTGGCCCTGTGCCCTAATA CCTGTGAAATCACAGCACCGATGAGCTGGTTCCAATTTTTAAAATATATACATGCAGTACTTCCATGACTATTCAAAGAAAAACAATTCCTTCCATTTGCCACCTGAGATGACCACC AGGGATGTGAACTACCTCCTGCCCCATCCCCAGCCCCAGGATCCTGGGACAGGGCTTATGAACGCAACCACTGTAGTCAGCTCACTTGATCCACAGCCTGGCACCTCCACTGTCTGG CTAGGGAGCCTCGAATGGGTCCCAAGGCCACCCTGCTCCTCAGTTACATCATCTGCATAGTAGTGGTGGTTGTGAGGAATTCAGGAGCTGCAGCATAAGGGCCCTGCAGGTACTATG TGCTCAGTAAATGCCAGTGGTTCTTAAGGGTCTGAGCTCCCATTGTAGAGGCAAGTAAGCTGAGGTTCAGAGAAGAAAATGACTTGCCCAAGATCACCCAGCTGGGAAGTGACAGTG CCAGGGTTGGAGCCCTGGTTGAGCTGGTTCCACAGGCCAGAGCTCATTCTGCCCTCTCCCCGGAAGACCTCCCACCCTGTCCCCATGCCTCTGCTTCTCCCTCACCCCAATTCCCCG CTGCCTTCTAGGATAAGTGTGAGCCACTGGAGAAGCAGCACGAGAAGGAGAGGAAACAGGAGGAGGGGGAATCCTAGCAGGACACAGCCTTGGATCAGGACAGAGACTTGGGGGCCA TCCTGCCCCTCCAACCCGACATGTGTACCTCAGCTTTTTCCCTCACTTGCATCAATAAAGCTTCGCATCGGCCTTTCGAAACGAGGAGTACAATAAGTCGGTTCAGGAGCCCTCAGG CAGGAGGGTTCACCGTGGGAACAGGGCAGGCCAGCATAAGGTGGGGGCTGGATGTAGAGCCCTGGAGGCTTTGGGCACAGAGGCCACCCTGGACCGGGTGAGTGCCTGGGCTAGCCC TGTCCTGAGCACATGGGCAGCTGCCTCCCTTCTCTGGGCTTCCCTTTACCTGCTGGCTGTGGTCGCACCCCCACTCCCAGCCCCCAACTCTCCCCGCCACAACATACATCCCATGCC 30 CBS, Department of Systems Biology CAGGAGGGTTCACCGTGGGAACAGGGCAGGCCAGCATAAGGTGGGGGCTGGATGTAGAGCCCTGGAGGCTTTGGGCACAGAGGCCACCCTGGACCGGGTGAGTGCCTGGGCTAGCCC

31 31 CBS, Department of Systems Biology Source:

32 32 CBS, Department of Systems Biology

33 Current state-of-the art: Cores - 8 Tb RAM Fastest commercial computer 33 CBS, Department of Systems Biology

Proteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering

Proteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering Proteomics 2 nd semester, 2013 1 Text book Principles of Proteomics by R. M. Twyman, BIOS Scientific Publications Other Reference books 1) Proteomics by C. David O Connor and B. David Hames, Scion Publishing

More information

Introduction to Bioinformatics

Introduction to Bioinformatics CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics

More information

Introduction Biology before Systems Biology: Reductionism Reduce the study from the whole organism to inner most details like protein or the DNA.

Introduction Biology before Systems Biology: Reductionism Reduce the study from the whole organism to inner most details like protein or the DNA. Systems Biology-Models and Approaches Introduction Biology before Systems Biology: Reductionism Reduce the study from the whole organism to inner most details like protein or the DNA. Taxonomy Study external

More information

Proteomics. Yeast two hybrid. Proteomics - PAGE techniques. Data obtained. What is it?

Proteomics. Yeast two hybrid. Proteomics - PAGE techniques. Data obtained. What is it? Proteomics What is it? Reveal protein interactions Protein profiling in a sample Yeast two hybrid screening High throughput 2D PAGE Automatic analysis of 2D Page Yeast two hybrid Use two mating strains

More information

Introduction to Systems Biology

Introduction to Systems Biology Introduction to Systems Biology References: Watson s Molecular Biology of the Gene, Chapter 22 Alberts Molecular Biology of the Cell, Chapter 7 Yousof Gheisari ygheisari@med.mui.ac.ir Why is this picture

More information

Bioinformatics 2. Yeast two hybrid. Proteomics. Proteomics

Bioinformatics 2. Yeast two hybrid. Proteomics. Proteomics GENOME Bioinformatics 2 Proteomics protein-gene PROTEOME protein-protein METABOLISM Slide from http://www.nd.edu/~networks/ Citrate Cycle Bio-chemical reactions What is it? Proteomics Reveal protein Protein

More information

Updated: 10/11/2018 Page 1 of 5

Updated: 10/11/2018 Page 1 of 5 A. Academic Division: Health Sciences B. Discipline: Biology C. Course Number and Title: BIOL1230 Biology I MASTER SYLLABUS 2018-2019 D. Course Coordinator: Justin Tickhill Assistant Dean: Melinda Roepke,

More information

BIOLOGY 111. CHAPTER 1: An Introduction to the Science of Life

BIOLOGY 111. CHAPTER 1: An Introduction to the Science of Life BIOLOGY 111 CHAPTER 1: An Introduction to the Science of Life An Introduction to the Science of Life: Chapter Learning Outcomes 1.1) Describe the properties of life common to all living things. (Module

More information

CONJOINT 541. Translating a Transcriptome at Specific Times and Places. David Morris. Department of Biochemistry

CONJOINT 541. Translating a Transcriptome at Specific Times and Places. David Morris. Department of Biochemistry CONJOINT 541 Translating a Transcriptome at Specific Times and Places David Morris Department of Biochemistry http://faculty.washington.edu/dmorris/ Lecture 1 The Biology and Experimental Analysis of mrna

More information

An introduction to SYSTEMS BIOLOGY

An introduction to SYSTEMS BIOLOGY An introduction to SYSTEMS BIOLOGY Paolo Tieri CNR Consiglio Nazionale delle Ricerche, Rome, Italy 10 February 2015 Universidade Federal de Minas Gerais, Belo Horizonte, Brasil Course outline Day 1: intro

More information

Computational Cell Biology Lecture 4

Computational Cell Biology Lecture 4 Computational Cell Biology Lecture 4 Case Study: Basic Modeling in Gene Expression Yang Cao Department of Computer Science DNA Structure and Base Pair Gene Expression Gene is just a small part of DNA.

More information

Identify stages of plant life cycle Botany Oral/written pres, exams

Identify stages of plant life cycle Botany Oral/written pres, exams DPI Standards Biology Education (for students) 1. Characteristics of organisms Know Properties of living organisms, including: Acquire and use energy and materials Sense and respond to stimuli Reproduce

More information

Computational methods for predicting protein-protein interactions

Computational methods for predicting protein-protein interactions Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational

More information

Systems biology and complexity research

Systems biology and complexity research Systems biology and complexity research Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Interdisciplinary Challenges for

More information

Introduction to Bioinformatics. Shifra Ben-Dor Irit Orr

Introduction to Bioinformatics. Shifra Ben-Dor Irit Orr Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A

More information

Computational Biology: Basics & Interesting Problems

Computational Biology: Basics & Interesting Problems Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information

More information

Chapter 15 Active Reading Guide Regulation of Gene Expression

Chapter 15 Active Reading Guide Regulation of Gene Expression Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,

More information

Automated Assignment of Backbone NMR Data using Artificial Intelligence

Automated Assignment of Backbone NMR Data using Artificial Intelligence Automated Assignment of Backbone NMR Data using Artificial Intelligence John Emmons στ, Steven Johnson τ, Timothy Urness*, and Adina Kilpatrick* Department of Computer Science and Mathematics Department

More information

Bioinformatics. Dept. of Computational Biology & Bioinformatics

Bioinformatics. Dept. of Computational Biology & Bioinformatics Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS

More information

BME 5742 Biosystems Modeling and Control

BME 5742 Biosystems Modeling and Control BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various

More information

1.1. KEY CONCEPT Biologists study life in all its forms. 4 Reinforcement Unit 1 Resource Book. Biology in the 21st Century CHAPTER 1

1.1. KEY CONCEPT Biologists study life in all its forms. 4 Reinforcement Unit 1 Resource Book. Biology in the 21st Century CHAPTER 1 1.1 THE STUDY OF LIFE KEY CONCEPT Biologists study life in all its forms. Biology is the scientific study of all forms of life. Living things are found almost everywhere on Earth, from very hot environments

More information

Biological Concepts and Information Technology (Systems Biology)

Biological Concepts and Information Technology (Systems Biology) Biological Concepts and Information Technology (Systems Biology) Janaina de Andréa Dernowsek Postdoctoral at Center for Information Technology Renato Archer Janaina.dernowsek@cti.gov.br Division of 3D

More information

Course Descriptions Biology

Course Descriptions Biology Course Descriptions Biology BIOL 1010 (F/S) Human Anatomy and Physiology I. An introductory study of the structure and function of the human organ systems including the nervous, sensory, muscular, skeletal,

More information

Basic modeling approaches for biological systems. Mahesh Bule

Basic modeling approaches for biological systems. Mahesh Bule Basic modeling approaches for biological systems Mahesh Bule The hierarchy of life from atoms to living organisms Modeling biological processes often requires accounting for action and feedback involving

More information

CELL BIOLOGY. by the numbers. Ron Milo. Rob Phillips. illustrated by. Nigel Orme

CELL BIOLOGY. by the numbers. Ron Milo. Rob Phillips. illustrated by. Nigel Orme CELL BIOLOGY by the numbers Ron Milo Rob Phillips illustrated by Nigel Orme viii Detailed Table of Contents List of Estimates xii Preface xv Acknowledgments xiii The Path to Biological Numeracy Why We

More information

COMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry.

COMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry. North Carolina Draft Standard Course of Study and Grade Level Competencies, Biology BIOLOGY COMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry. 1.01

More information

Peddie Summer Day School

Peddie Summer Day School Peddie Summer Day School Course Syllabus: BIOLOGY Teacher: Mr. Jeff Tuliszewski Text: Biology by Miller and Levine, Prentice Hall, 2010 edition ISBN 9780133669510 Guided Reading Workbook for Biology ISBN

More information

Computational Biology From The Perspective Of A Physical Scientist

Computational Biology From The Perspective Of A Physical Scientist Computational Biology From The Perspective Of A Physical Scientist Dr. Arthur Dong PP1@TUM 26 November 2013 Bioinformatics Education Curriculum Math, Physics, Computer Science (Statistics and Programming)

More information

Chapter 1. Topic: Overview of basic principles

Chapter 1. Topic: Overview of basic principles Chapter 1 Topic: Overview of basic principles Four major themes of biochemistry I. What are living organism made from? II. How do organism acquire and use energy? III. How does an organism maintain its

More information

Proteomics Systems Biology

Proteomics Systems Biology Dr. Sanjeeva Srivastava IIT Bombay Proteomics Systems Biology IIT Bombay 2 1 DNA Genomics RNA Transcriptomics Global Cellular Protein Proteomics Global Cellular Metabolite Metabolomics Global Cellular

More information

RNA & PROTEIN SYNTHESIS. Making Proteins Using Directions From DNA

RNA & PROTEIN SYNTHESIS. Making Proteins Using Directions From DNA RNA & PROTEIN SYNTHESIS Making Proteins Using Directions From DNA RNA & Protein Synthesis v Nitrogenous bases in DNA contain information that directs protein synthesis v DNA remains in nucleus v in order

More information

What Can Physics Say About Life Itself?

What Can Physics Say About Life Itself? What Can Physics Say About Life Itself? Science at the Interface of Physics and Biology Michael Manhart Department of Physics and Astronomy BioMaPS Institute for Quantitative Biology Source: UIUC, Wikimedia

More information

11/24/13. Science, then, and now. Computational Structural Bioinformatics. Learning curve. ECS129 Instructor: Patrice Koehl

11/24/13. Science, then, and now. Computational Structural Bioinformatics. Learning curve. ECS129 Instructor: Patrice Koehl Computational Structural Bioinformatics ECS129 Instructor: Patrice Koehl http://www.cs.ucdavis.edu/~koehl/teaching/ecs129/index.html koehl@cs.ucdavis.edu Learning curve Math / CS Biology/ Chemistry Pre-requisite

More information

HAWAII CONTENT AND PERFORMANCE STANDARDS BIOLOGICAL SCIENCE

HAWAII CONTENT AND PERFORMANCE STANDARDS BIOLOGICAL SCIENCE HAWAII CONTENT AND PERFORMANCE STANDARDS BIOLOGICAL SCIENCE Correlated to BIOLOGY: CYCLES OF LIFE 2006 5910 Rice Creek Parkway, Suite 1000 Shoreview, Minnesota 55126 Telephone (800) 328-2560 www.agsglobe.com

More information

GACE Biology Assessment Test I (026) Curriculum Crosswalk

GACE Biology Assessment Test I (026) Curriculum Crosswalk Subarea I. Cell Biology: Cell Structure and Function (50%) Objective 1: Understands the basic biochemistry and metabolism of living organisms A. Understands the chemical structures and properties of biologically

More information

Miller & Levine Biology

Miller & Levine Biology A Correlation of To the Science Biology A Correlation of, 2014 to the, Table of Contents From Molecules to Organisms: Structures and Processes... 3 Ecosystems: Interactions, Energy, and Dynamics... 4 Heredity:

More information

Molecular and cellular biology is about studying cell structure and function

Molecular and cellular biology is about studying cell structure and function Chapter 1 Exploring the World of the Cell In This Chapter Discovering the microscopic world Getting matter and energy Reading the genetic code Molecular and cellular biology is about studying cell structure

More information

Analysis and Simulation of Biological Systems

Analysis and Simulation of Biological Systems Analysis and Simulation of Biological Systems Dr. Carlo Cosentino School of Computer and Biomedical Engineering Department of Experimental and Clinical Medicine Università degli Studi Magna Graecia Catanzaro,

More information

October 08-11, Co-Organizer Dr. S D Samantaray Professor & Head,

October 08-11, Co-Organizer Dr. S D Samantaray Professor & Head, A Journey towards Systems system Biology biology :: Biocomputing of of Hi-throughput Omics omics Data data October 08-11, 2018 Coordinator Dr. Anil Kumar Gaur Professor & Head Department of Molecular Biology

More information

Biology Assessment. Eligible Texas Essential Knowledge and Skills

Biology Assessment. Eligible Texas Essential Knowledge and Skills Biology Assessment Eligible Texas Essential Knowledge and Skills STAAR Biology Assessment Reporting Category 1: Cell Structure and Function The student will demonstrate an understanding of biomolecules

More information

STAAR Biology Assessment

STAAR Biology Assessment STAAR Biology Assessment Reporting Category 1: Cell Structure and Function The student will demonstrate an understanding of biomolecules as building blocks of cells, and that cells are the basic unit of

More information

Chapter 1: Introduction: Themes in the Study of Life

Chapter 1: Introduction: Themes in the Study of Life Name Period Begin your study of biology this year by reading Chapter 1. It will serve as a reminder about biological concepts that you may have learned in an earlier course and give you an overview of

More information

Warm Up. What are some examples of living things? Describe the characteristics of living things

Warm Up. What are some examples of living things? Describe the characteristics of living things Warm Up What are some examples of living things? Describe the characteristics of living things Objectives Identify the levels of biological organization and explain their relationships Describe cell structure

More information

Midterm Review Guide. Unit 1 : Biochemistry: 1. Give the ph values for an acid and a base. 2. What do buffers do? 3. Define monomer and polymer.

Midterm Review Guide. Unit 1 : Biochemistry: 1. Give the ph values for an acid and a base. 2. What do buffers do? 3. Define monomer and polymer. Midterm Review Guide Name: Unit 1 : Biochemistry: 1. Give the ph values for an acid and a base. 2. What do buffers do? 3. Define monomer and polymer. 4. Fill in the Organic Compounds chart : Elements Monomer

More information

MSc Drug Design. Module Structure: (15 credits each) Lectures and Tutorials Assessment: 50% coursework, 50% unseen examination.

MSc Drug Design. Module Structure: (15 credits each) Lectures and Tutorials Assessment: 50% coursework, 50% unseen examination. Module Structure: (15 credits each) Lectures and Assessment: 50% coursework, 50% unseen examination. Module Title Module 1: Bioinformatics and structural biology as applied to drug design MEDC0075 In the

More information

Missouri Educator Gateway Assessments

Missouri Educator Gateway Assessments Missouri Educator Gateway Assessments June 2014 Content Domain Range of Competencies Approximate Percentage of Test Score I. Science and Engineering Practices 0001 0003 21% II. Biochemistry and Cell Biology

More information

Advanced Cell Biology. Lecture 1

Advanced Cell Biology. Lecture 1 Advanced Cell Biology. Lecture 1 Alexey Shipunov Minot State University January 9, 2013 Shipunov (MSU) Advanced Cell Biology. Lecture 1 January 9, 2013 1 / 27 Outline Course in general Description Grading

More information

Virginia Western Community College BIO 101 General Biology I

Virginia Western Community College BIO 101 General Biology I BIO 101 General Biology I Prerequisites Successful completion of MTE 1, 2, 3, 4, and 5; and a placement recommendation for ENG 111, co-enrollment in ENF 3/ENG 111, or successful completion of all developmental

More information

Gene Ontology and overrepresentation analysis

Gene Ontology and overrepresentation analysis Gene Ontology and overrepresentation analysis Kjell Petersen J Express Microarray analysis course Oslo December 2009 Presentation adapted from Endre Anderssen and Vidar Beisvåg NMC Trondheim Overview How

More information

Welcome to AP BIOLOGY!!!! NOTES: Chapter 1 Exploring Life

Welcome to AP BIOLOGY!!!! NOTES: Chapter 1 Exploring Life Welcome to AP BIOLOGY!!!! NOTES: Chapter 1 Exploring Life The phenomenon we call life defies a simple, onesentence definition Exploring LIFE: We recognize life by what living things DO Some Properties

More information

Clustering and Network

Clustering and Network Clustering and Network Jing-Dong Jackie Han jdhan@picb.ac.cn http://www.picb.ac.cn/~jdhan Copy Right: Jing-Dong Jackie Han What is clustering? A way of grouping together data samples that are similar in

More information

Curriculum Map. Biology, Quarter 1 Big Ideas: From Molecules to Organisms: Structures and Processes (BIO1.LS1)

Curriculum Map. Biology, Quarter 1 Big Ideas: From Molecules to Organisms: Structures and Processes (BIO1.LS1) 1 Biology, Quarter 1 Big Ideas: From Molecules to Organisms: Structures and Processes (BIO1.LS1) Focus Standards BIO1.LS1.2 Evaluate comparative models of various cell types with a focus on organic molecules

More information

SCOTCAT Credits: 20 SCQF Level 7 Semester 1 Academic year: 2018/ am, Practical classes one per week pm Mon, Tue, or Wed

SCOTCAT Credits: 20 SCQF Level 7 Semester 1 Academic year: 2018/ am, Practical classes one per week pm Mon, Tue, or Wed Biology (BL) modules BL1101 Biology 1 SCOTCAT Credits: 20 SCQF Level 7 Semester 1 10.00 am; Practical classes one per week 2.00-5.00 pm Mon, Tue, or Wed This module is an introduction to molecular and

More information

EASTERN ARIZONA COLLEGE General Biology I

EASTERN ARIZONA COLLEGE General Biology I EASTERN ARIZONA COLLEGE General Biology I Course Design 2013-2014 Course Information Division Science Course Number BIO 181 (SUN# BIO 1181) Title General Biology I Credits 4 Developed by David J. Henson

More information

Molecular Biology Of The Cell 6th Edition Alberts

Molecular Biology Of The Cell 6th Edition Alberts We have made it easy for you to find a PDF Ebooks without any digging. And by having access to our ebooks online or by storing it on your computer, you have convenient answers with molecular biology of

More information

Genom, transkriptom in proteom

Genom, transkriptom in proteom Genom, transkriptom in proteom The conceptual relationship of the genome, transcriptome, proteome and metabolome Fenotipi/Phenotypes Morphological phenotypes are fixed in distinct dog breeds. Fizikalna

More information

Big Idea 1: Does the process of evolution drive the diversity and unit of life?

Big Idea 1: Does the process of evolution drive the diversity and unit of life? AP Biology Syllabus 2016-2017 Course Overview: AP Biology is equivalent to an introductory college level biology program in order to develop student led inquiry into science. The class is designed to go

More information

Causal Discovery by Computer

Causal Discovery by Computer Causal Discovery by Computer Clark Glymour Carnegie Mellon University 1 Outline 1. A century of mistakes about causation and discovery: 1. Fisher 2. Yule 3. Spearman/Thurstone 2. Search for causes is statistical

More information

(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.

(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid. 1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the

More information

Dynamical Modeling in Biology: a semiotic perspective. Junior Barrera BIOINFO-USP

Dynamical Modeling in Biology: a semiotic perspective. Junior Barrera BIOINFO-USP Dynamical Modeling in Biology: a semiotic perspective Junior Barrera BIOINFO-USP Layout Introduction Dynamical Systems System Families System Identification Genetic networks design Cell Cycle Modeling

More information

Berg Tymoczko Stryer Biochemistry Sixth Edition Chapter 1:

Berg Tymoczko Stryer Biochemistry Sixth Edition Chapter 1: Berg Tymoczko Stryer Biochemistry Sixth Edition Chapter 1: Biochemistry: An Evolving Science Tips on note taking... Remember copies of my lectures are available on my webpage If you forget to print them

More information

TEACHER CERTIFICATION STUDY GUIDE. Table of Contents I. BASIC PRINCIPLES OF SCIENCE (HISTORY AND NATURAL SCIENCE)

TEACHER CERTIFICATION STUDY GUIDE. Table of Contents I. BASIC PRINCIPLES OF SCIENCE (HISTORY AND NATURAL SCIENCE) Table of Contents I. BASIC PRINCIPLES OF SCIENCE (HISTORY AND NATURAL SCIENCE) A. Nature of scientific knowledge, inquiry, and historical perspectives 1. Scientific methods...1 2. Processes involved in

More information

Dr. Dennis Gervin Sections: 4252, 4253, 7734,

Dr. Dennis Gervin Sections: 4252, 4253, 7734, BIOLOGY 111 Dr. Dennis Gervin Sections: 4252, 4253, 7734, 7736 http://www.mjc.edu/ http://gervind.faculty.mjc.edu/default.html A Guide to the Natural World How Does Science Impact Your Everyday World?

More information

Curriculum Links. AQA GCE Biology. AS level

Curriculum Links. AQA GCE Biology. AS level Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2

More information

Bioinformatics and Computerscience

Bioinformatics and Computerscience Bioinformatics and Computerscience Systems Biology Data collection Network Inference Network-based dataintegration 1. ARRAY BASED 2. NEXT-GEN SEQUENCING RNA-Seq analysis ChIP-seq Bulked segregant analysis

More information

UNIT 1: INTRODUCING BIOLOGY. Chapter 1: Biology in the 21st Century

UNIT 1: INTRODUCING BIOLOGY. Chapter 1: Biology in the 21st Century UNIT 1: INTRODUCING BIOLOGY Chapter 1: Biology in the 21st Century UNIT 1: INTRODUCING BIOLOGY Chapter 1: Biology in the 21st Century I. The Study of Life (1.1) A. Earth is home to an incredible diversity

More information

Honors Biology Fall Final Exam Study Guide

Honors Biology Fall Final Exam Study Guide Honors Biology Fall Final Exam Study Guide Helpful Information: Exam has 100 multiple choice questions. Be ready with pencils and a four-function calculator on the day of the test. Review ALL vocabulary,

More information

Formative/Summative Assessments (Tests, Quizzes, reflective writing, Journals, Presentations)

Formative/Summative Assessments (Tests, Quizzes, reflective writing, Journals, Presentations) Biology Curriculum Map 2017-18 2 Weeks- Introduction to Biology: Scientific method, lab safety, organizing and analyzing data, and psuedoscience. This unit establishes the fundamental nature of scientific

More information

Videos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.

Videos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu. Translation Translation Videos Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.be/itsb2sqr-r0 Translation Translation The

More information

Multiple Choice Review- Eukaryotic Gene Expression

Multiple Choice Review- Eukaryotic Gene Expression Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule

More information

AP* Biology Prep Course

AP* Biology Prep Course AP* Biology Prep Course SYLLABUS Welcome to the FlinnPREP AP* Biology Online Prep Course! Your enrollment in this course is your first step toward a 5 on the AP* Biology exam. FlinnPREP covers fundamental

More information

I. Molecules & Cells. A. Unit One: The Nature of Science. B. Unit Two: The Chemistry of Life. C. Unit Three: The Biology of the Cell.

I. Molecules & Cells. A. Unit One: The Nature of Science. B. Unit Two: The Chemistry of Life. C. Unit Three: The Biology of the Cell. I. Molecules & Cells A. Unit One: The Nature of Science a. How is the scientific method used to solve problems? b. What is the importance of controls? c. How does Darwin s theory of evolution illustrate

More information

Biology A 1 st Marking Period

Biology A 1 st Marking Period Biology Curriculum Map WOHS (Western Career Prep HS) 2016-17 Biology A 1 st Marking Period 2 weeks Introduction to Biology: Understand what it means to ask questions and design valid and reliable ways

More information

The following pages outline the major elements of the course and when you can expect each to be covered. Assessment

The following pages outline the major elements of the course and when you can expect each to be covered. Assessment A level biology The course we offer at Robert Smyth Academy is OCR Biology A which a two year linear course. Details of the course can be found at http://www.ocr.org.uk/qualifications/as-a-levelgce-biology-a-h020-h420-from-2015/

More information

Protein function studies: history, current status and future trends

Protein function studies: history, current status and future trends 19 3 2007 6 Chinese Bulletin of Life Sciences Vol. 19, No. 3 Jun., 2007 1004-0374(2007)03-0294-07 ( 100871) Q51A Protein function studies: history, current status and future trends MA Jing, GE Xi, CHANG

More information

Biology II : Embedded Inquiry

Biology II : Embedded Inquiry Biology II : Embedded Inquiry Conceptual Strand Understandings about scientific inquiry and the ability to conduct inquiry are essential for living in the 21 st century. Guiding Question What tools, skills,

More information

CHAPTER 1 Life: Biological Principles and the Science of Zoology

CHAPTER 1 Life: Biological Principles and the Science of Zoology CHAPTER 1 Life: Biological Principles and the Science of Zoology 1-1 Zoology: The Uses of Principles The scientific study of animal life Does Life Have Defining Properties? No simple definition The history

More information

Grundlagen der Systembiologie und der Modellierung epigenetischer Prozesse

Grundlagen der Systembiologie und der Modellierung epigenetischer Prozesse Grundlagen der Systembiologie und der Modellierung epigenetischer Prozesse Sonja J. Prohaska Bioinformatics Group Institute of Computer Science University of Leipzig October 25, 2010 Genome-scale in silico

More information

Range of Competencies

Range of Competencies BIOLOGY Content Domain Range of Competencies l. Nature of Science 0001 0003 20% ll. Biochemistry and Cell Biology 0004 0005 13% lll. Genetics and Evolution 0006 0009 27% lv. Biological Unity and Diversity

More information

BIOINFORMATICS LAB AP BIOLOGY

BIOINFORMATICS LAB AP BIOLOGY BIOINFORMATICS LAB AP BIOLOGY Bioinformatics is the science of collecting and analyzing complex biological data. Bioinformatics combines computer science, statistics and biology to allow scientists to

More information

Prokaryotic Gene Expression (Learning Objectives)

Prokaryotic Gene Expression (Learning Objectives) Prokaryotic Gene Expression (Learning Objectives) 1. Learn how bacteria respond to changes of metabolites in their environment: short-term and longer-term. 2. Compare and contrast transcriptional control

More information

Lassen Community College Course Outline

Lassen Community College Course Outline Lassen Community College Course Outline BIOL-1 Principles of Molecular and Cellular Biology 4.0 Units I. Catalog Description A course in principles of biology, with special emphasis given to molecular

More information

Identifying Signaling Pathways

Identifying Signaling Pathways These slides, excluding third-party material, are licensed under CC BY-NC 4.0 by Anthony Gitter, Mark Craven, Colin Dewey Identifying Signaling Pathways BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018

More information

ADVANCED PLACEMENT BIOLOGY

ADVANCED PLACEMENT BIOLOGY ADVANCED PLACEMENT BIOLOGY Description Advanced Placement Biology is designed to be the equivalent of a two-semester college introductory course for Biology majors. The course meets seven periods per week

More information

GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H*" ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION

GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H* ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION FIFTH EDITION IV I ^HHk ^ttm IZTI/^Q i I II MPHBBMWBBIHB '-llwmpbi^hbwm^^pfc ' GSBHSRSBRSRRk LlML I I \l 1MB ^HP'^^MMMP" jflp^^^^^^^^st I Iv^O FROM GENES TO GENOMES %^MiM^PM^^MWi99Mi$9i0^^ ^^^^^^^^^^^^^V^^^fii^^t^i^^^^^

More information

UNIVERSITY OF CALIFORNIA SANTA BARBARA DEPARTMENT OF CHEMICAL ENGINEERING. CHE 154: Engineering Approaches to Systems Biology Spring Quarter 2004

UNIVERSITY OF CALIFORNIA SANTA BARBARA DEPARTMENT OF CHEMICAL ENGINEERING. CHE 154: Engineering Approaches to Systems Biology Spring Quarter 2004 UNIVERSITY OF CALIFORNIA SANTA BARBARA DEPARTMENT OF CHEMICAL ENGINEERING CHE 154: Engineering Approaches to Systems Biology Spring Quarter 2004 Lecture: Tue/Thu 9:30-10:45am Engr-II Room 3301 Instructor

More information

Gene Ontology. Shifra Ben-Dor. Weizmann Institute of Science

Gene Ontology. Shifra Ben-Dor. Weizmann Institute of Science Gene Ontology Shifra Ben-Dor Weizmann Institute of Science Outline of Session What is GO (Gene Ontology)? What tools do we use to work with it? Combination of GO with other analyses What is Ontology? 1700s

More information

AP Biology UNIT 1: CELL BIOLOGY. Advanced Placement

AP Biology UNIT 1: CELL BIOLOGY. Advanced Placement Advanced Placement AP Biology builds students' understanding of biology on both the micro and macro scales. After studying cell biology, students move on to understand how evolution drives the diversity

More information

2. Cellular and Molecular Biology

2. Cellular and Molecular Biology 2. Cellular and Molecular Biology 2.1 Cell Structure 2.2 Transport Across Cell Membranes 2.3 Cellular Metabolism 2.4 DNA Replication 2.5 Cell Division 2.6 Biosynthesis 2.1 Cell Structure What is a cell?

More information

Network Biology: Understanding the cell s functional organization. Albert-László Barabási Zoltán N. Oltvai

Network Biology: Understanding the cell s functional organization. Albert-László Barabási Zoltán N. Oltvai Network Biology: Understanding the cell s functional organization Albert-László Barabási Zoltán N. Oltvai Outline: Evolutionary origin of scale-free networks Motifs, modules and hierarchical networks Network

More information

Vance County Early College High School Pacing Guide Course: Introduction to Biology (Semester I)

Vance County Early College High School Pacing Guide Course: Introduction to Biology (Semester I) Vance County Early College High School Pacing Guide Course: Introduction to Biology (Semester I) Week(s ) Dates Unit Unit Title Essential Questions / Topic Questions 1 1 Introduction to Biology 1. How

More information

REQUIREMENTS FOR THE BIOCHEMISTRY MAJOR

REQUIREMENTS FOR THE BIOCHEMISTRY MAJOR REQUIREMENTS FOR THE BIOCHEMISTRY MAJOR Grade Requirement: All courses required for the Biochemistry major (CH, MATH, PHYS, BI courses) must be graded and passed with a grade of C- or better. Core Chemistry

More information

Case study: spider mimicry

Case study: spider mimicry Pounce rate (% of trials in which spider jumped on fly) Case study: spider mimicry Control group (untreated flies) Experimental group (wing markings masked) Pounce rate (% of trials in which spider jumped

More information

Chapter Chemical Uniqueness 1/23/2009. The Uses of Principles. Zoology: the Study of Animal Life. Fig. 1.1

Chapter Chemical Uniqueness 1/23/2009. The Uses of Principles. Zoology: the Study of Animal Life. Fig. 1.1 Fig. 1.1 Chapter 1 Life: Biological Principles and the Science of Zoology BIO 2402 General Zoology Copyright The McGraw Hill Companies, Inc. Permission required for reproduction or display. The Uses of

More information

An Introduction to the Science of Botany. Chapter 1

An Introduction to the Science of Botany. Chapter 1 An Introduction to the Science of Botany Chapter 1 TTU MS 43131 LEARNING OBJECTIVES Briefly describe the field of botany, and give short definitions of at least five subdisciplines of plant biology Summarize

More information

MATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME

MATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME MATHEMATICAL MODELING AND THE HUMAN GENOME Hilary S. Booth Australian National University, Australia Keywords: Human genome, DNA, bioinformatics, sequence analysis, evolution. Contents 1. Introduction:

More information

Computational Genomics. Reconstructing dynamic regulatory networks in multiple species

Computational Genomics. Reconstructing dynamic regulatory networks in multiple species 02-710 Computational Genomics Reconstructing dynamic regulatory networks in multiple species Methods for reconstructing networks in cells CRH1 SLT2 SLR3 YPS3 YPS1 Amit et al Science 2009 Pe er et al Recomb

More information

Biochemistry-BS Program Study Abroad Pathway

Biochemistry-BS Program Study Abroad Pathway Biochemistry-BS Program Study Abroad Pathway (last revised September 2016) Table 1a: Undergraduate Program Schedule These undergraduate program schedules are subject to change. Please verify information

More information

BIOLOGY Chair Associate Chair Faculty with Research Interests Degree Programs Other Degree Programs in Biology Research Honors Program

BIOLOGY Chair Associate Chair Faculty with Research Interests Degree Programs Other Degree Programs in Biology Research Honors Program Biology 1 BIOLOGY Robert A. Pritzker Science Center, Room 182 3101 S. Dearborn St. Chicago, IL 60616 312.567.3480 kersh@iit.edu science.iit.edu/biology Chair Thomas Irving Associate Chair Tanya Bekyarova

More information

Bundle at a Glance Biology 2015/16

Bundle at a Glance Biology 2015/16 Introduction: Scientific Investigation and Reasoning Skills (3 A/B days) Biology Process TEKS: 1A demonstrate safe practices during laboratory and field investigations. 1B demonstrate an understanding

More information