What is Systems Biology
|
|
- Georgina York
- 6 years ago
- Views:
Transcription
1 What is Systems Biology
2 2 CBS, Department of Systems Biology
3 3 CBS, Department of Systems Biology
4 Data integration In the Big Data era Combine different types of data, describing different things or the same thing with different error City guide analogy: Road maps Arial pictures of buildings Google Maps Street-level pictures Restaurant reviews 4 CBS, Department of Systems Biology
5 Reduction vs Holistic Reductionism seeks to find individual factors that explain/cause a phenomenon Typically study one factor at a time Which cells -> which organelle -> which molecules -> which sites on these molecules -> which atoms and H-bonds involved? Holistic approach looks at many or all components of the system and the interplay between them E.g. map of whole city (as opposed to map of one road) Understanding cancer (requires understanding of many different biological processes) 5 CBS, Department of Systems Biology
6 Increasing Interest in Systems Biology PubMed Term Publications Bioinformatics Systems Biology Cell Cycle Yeast genome completed Nobel Prize for Cell Cycle Human genome completed Year 6 CBS, Department of Systems Biology
7 Also, systems Biology is a top-down science Systems Biology Integration Normal Biology Reducitonist 7 CBS, Department of Systems Biology
8 Systems biology and emerging properties 8 CBS, Department of Systems Biology
9 Integration of whole x-ome to understand life in health and disease genome metabolome LIFE etceterome transcriptome lipidome proteome 9 CBS, Department of Systems Biology
10 10 CBS, Department of Systems Biology
11 From components to models
12 Transcriptional regulation of the Cell Cycle Simon et al. Cell CBS, Department of Systems Biology
13 13 CBS, Department of Systems Biology
14 14 CBS, Department of Systems Biology Tyson JJ, Novak B, J. Theor. Biol. 2001
15 Carbohydrate metabolic map 15 CBS, Department of Systems Biology
16 Mathematical abstraction of biochemistry 16 CBS, Department of Systems Biology
17 The hierarchy of models 17 CBS, Department of Systems Biology
18 The hierarchy of models 18 CBS, Department of Systems Biology
19 From components to models
20 One framework for Systems Biology (part 1) 1. The components. Discover all of the genes in the genome and the subset of genes, proteins, and other small molecules constituting the pathway of interest. If possible, define an initial model of the molecular interactions governing pathway function (how?). 2. Pathway perturbation. Perturb each pathway component through a series of genetic or environmental manipulations. Detect and quantify the corresponding global cellular response to each perturbation. 20 CBS, Department of Systems Biology
21 One framework for Systems Biology (part 2) 3. Model Reconciliation. Integrate the observed mrna and protein responses with the current, pathwayspecific model and with the global network of proteinprotein, protein-dna, and other known physical interactions. 4. Model verification/expansion. Formulate new hypotheses to explain observations not predicted by the model. Design additional perturbation experiments to test these and iteratively repeat steps (2), (3), and (4). 21 CBS, Department of Systems Biology
22 From model to experiment and back again 22 CBS, Department of Systems Biology
23 Systems Biology to address the knowledge/data problem Genome sequencing
24 The human genome sequencing project (HGP) CBS, Department of Systems Biology
25 Sequencing costs over time Drop in costs is faster than Moore s Law (Computer power doubles every 2 years) 25 CBS, Department of Systems Biology
26 Sequencing capability: throughput per machine Kilobases per day per machine 1,000,000, ,000,000 10,000,000 1,000, , ,000 1, Manual slab gel Sanger Chain-termination method 26 CBS, Department of Systems Biology ~3X coverage of a human genome Gel-based systems Automated slab gel Capillary sequencing First-generation capillary Year Human genome Massively parallel sequencing Microwell pyrosequencing Second-generation capillary sequencer 2005 Single molecule? Short-read sequencers 2010 Future
27 Right now, upstairs in DMAC Output: ~30 Gbp/day Human genome is 3.2 Gbp 27 CBS, Department of Systems Biology
28 Completely sequenced genomes by year 28 CBS, Department of Systems Biology
29 Bioinformatics And the wealth of information
30 TCCAAACCCAGGCTCTCTCCCAAACCAGTTTGCGGCAGATGGCCAGTGGAACCTCACTCTCCTCATCAGTAAAAAGGGGGCAGAGTGAGGGTCCTGAGAGCTAGTACAGGGACTGTG TGAAGTAGACAATGCCCAGTGTTTAGCGTAAGAATCAGGGTCCAGCTGGTGCTCCCTAAACAGCAGCTGCTGTTCACTGTTGAAAGGCGCTCTGGAAGGCCAGGCGCGGTGGCTCAT GCTTGTAATCCCAGCACTGTGGGAGGCCGAGGTGGGCGGATCACCTGAGGTAGGGAGTTCGAGACCAGCCTGACCAACGTGGAGAAACCCCATCTCTCCTAAAAATACAAAATTAGC CAGGCGTGGTAGCACATACCTGTAATCCCAGCGACTCGGGAGGCTGAGGCAAGAGAATTGCTTGAAACCAGCAGGGGAGGTTGTGGTGAGCCAAGATCGAGCCATTGCACTCCAGCC AGGGCAACAAGAGGCAAAATGGCGAAACTCCATCTCCGAGAAAAAAAAAAAAAAAGAATACTTTCTGAAAGTATTTATTCATACAAATAAAGACTTGACCCATAAGGTAGGAACGCA AATGGGCCACGGAATCACTCATTCCACAGTATACACCGAGTGCCCTTGAAGTGCTGGGCACTGCTCCAGGATTGGGGGCATATTGGTGAAAAGAGAAGCAAGCCTGCCTGCTCAGAT GGCAGGGAATGGGGAAAAACAGGGAGACAGTTTCCTGTTTGAGATGTTGGGAGTCTGCTTCGAGTAGTATATTTACTGGAAATAGACCACTAACTTGGATGTCCCTTTTTGGAAATG TGCCTGCGTCCAGGGCTGGGTTGGGGCCCCAATGAACTTTGGCTCTGACATAGCTGTTGCCACACTCAGTGGAACTGAATCCATGTTTGCCTTCACCCGGCATCCTTCACCCCAACT CTCCCCGCCACAACATACATCCCATGCCAGCCTGGGGACCCTCAAAGGTGCTTCATCATTAGGTTTGTGGCTGGGTCCTACTGAAGTAAGTCTTGGCACTCAGAGGGATAGGAATTG AATGAAGACATGAGATTCCTCTGCGGGAGGCCTCTCTAGGAAATCTGTGGACTCACACGTTTACTAATGTTGCTGCAGCCCCGCACCCACCTTGGCCTTGGGCAGCCATACTCTAGG GCTTTTGTAACCTCTCCATGTGAGGAACTCAAATTAGACCTGGGTTTGGAGGCGGTGCTCCGAGCTGGCCTTTGGGGGAGGTTTTGTGCGAGGCATTTCCCAAGTGCTGGCAGGATT GTGTCACAGACACAGAGTAAACTTTTGCTGGGCTCCAAGTGACCGCCCATAGTTTATTATAAAGGTGACTGCACCCTGCAGCCACCAGCACTGCCTGGCTCCACGTGCCTCCTGGTC TCAGTATGGCGCTGTCCTGGGTTCTTACAGTCCTGAGCCTCCTACCTCTGCTGGAAGCCCAGATCCCATTGTGTGCCAACCTAGTACCGGTGCCCATCACCAACGCCACCCTGGACC GGGTGAGTGCCTGGGCTAGCCCTGTCCTGAGCACATGGGCAGCTGCCTCCCTTCTCTGGGCTTCCCTTTACCTGCTGGCTGTGGTCGCACCCCCACTCCCAGCTCTGCCTTTTTCTC TTCTGGGTCCCCAGGGTGAAATTCTCACCAGCCCAGGGGACTCTGGAGGCACCCCCTGCCTCCAAACACAGAAGCCTCACTGCAGAGTCCTTCACGGAGGACGGTTCTGTGCTGGGC CTGGAGGGGCTGCCTGGGGGGCAATGACTGATCCTCAGGGTGAGCTCCTGCATGCGCACTGCCCACCAGGGGCCTCATCTCCCCATCTGCAAAATCAGGGAGAGATCTGCCTGAGTC TCCTCCCAGCTGACAGTCAAAGATTCAGCATCAAGCCCCCATCACCAGCTCCCCCCTTCTCCCCAGATCACTGGCAAGTGGTTTTATATCGCATCGGCCTTTCGAAACGAGGAGTAC AATAAGTCGGTTCAGGAGATCCAAGCAACCTTCTTTTACTTTACCCCCAACAAGACAGAGGACACGATCTTTCTCAGAGAGTACCAGACCCGGTGAGAGCCCCCATTCCAATGCACC CCCGATCTCAGCTGTCTGGCCAGAAGACCTGAGCAAGTCCCTCCTTCTTCCTGGCCTTGGCCTTCCCATGGGTGGAACCGGGAGGGTTGGCTTTAATCTCCACCAGAACTCTTGCCC CGGGACTGTGATGGGCGATTGGCCACTTCTCCTCGATAACATTACTGTTTTTCTTCCGCCTTCTGGTTGACTTTAGCCAGAACCAGTGCTTCTATAACTCCAGTTACCTGAATGTCC AGCGGGAGAATGGGACCGTCTCCAGATACGGTGAGGGCCAGCCCTCAGGCAGGAGGGTTCACCGTGGGAACAGGGCAGGCCAGCATAAGGTGGGGGCTGGATGTAGAGCCCTGGAGG CTTTGGGCACAGAGAAATAACCACTAACATTTTTGAGCTCTTACCACGTGCTCAGAAAAAATCCCTAAGAAGACACTGAGAGAATTAGATGAGGAAACATAAGAACAGAGACCTCAA ATAGTTTCCCCAAGGTCACACAGCTTATAATTAGAACTAGAATTGGAACTCCAGGCTGGCTTCAGATCTGCCTCTCTCTCACGCCCTCTTTAAGATCCTTTGCAAACCAATGGTAGA AGCCTGTATGTTGGAGAGGTGGTACCTTCAACTATGTCCCCCATCACCGCAGAGGTGGCACATGGCAGGGATCTGATGGAGCTGAACTGACATCATTTAGCATCCCGAGCCTCCTCT CTGGGCCTCATTTTCCTCCTCTGTAAAACGGGGAGAAAGGCCCTGACAGCCACAGTCTGTGTGAGGCTCCTGAGATCTCATGTACAGAAAGTGCTTGGCGTGGAGCTGGGCACGCAG CAGGGGCTGGGCACACGGTGGCCCAAAGGAGACCCGGGCCTTCACTGATGGGCTTTGTGGCCCCGGACACATTTCTCTTCCAGAGGGAGGCCGAGAACATGTTGCTCACCTGCGTTC CTTAGGGACACCCCTAGGACTCCTCACCTGTAAGACAGGCACCATTGTGCCATCCCATGTTCTCACCCAGAGGCTCTTAAGACCTTGATGTTTGGTTCCTACCTGGACGATGAGAAG AACTGGGGGCTGTCTTTCTATGGTAGGCATGCTTAGCAGCCCCAAACTCATGCCCCTCTCAGGCCTCACCCCCCATTCACCCACCCCTGGGCTGGCCCCTAGAACCCCAGCCCTCCC TGGCCTCCGCCGGGCCCCACCATGTCCCCAGTCAGTCTCCTTGCTCCCCCTGCAGCTGACAAGCCAGAGACGACCAAGGAGCAACTGGGAGAGTTCTACGAAGCTCTCGACTGCTTG TGCATTCCCAGGTCAGATGTCATGTACACCGACTGGAAAAAGGTAAACGCAAGGGATTGGACATTGCCCACCTTGTCCATGGCCCAACTTGGGCAGCCCCAGAGGCCCAGAGCAGGA AAGCTGCCAGGCAAGGCTGCACAGCTAGGCAGATCTTCTGCTTTTAGGCACCTGCCTCACTGTAGGGACAGCTGAGCTCTACAGAGGCCCAGGGGTGGTGGATGAGAGCCCAGGAGG GAGAAGTCCCTGTGAAACCAGGGAGGACCTGAAAGCTAACAGGAGGGAACAGCGTGAGCCACGGGGTTGGGGGATTGGCAATTGGAGGGGACGTAATGCGGGGAGTTACCACCTACA GACGCGTCCCAAACCCCAGGCTTTCACCCCAACCTCCACTCCCCGCTCATTTTTAATACCCGTGCAGTGGGGAATTGATACTGTGGTTTTCAATGTCACCCACACTGCAGCACGGCC ACAGTCACCATCCCGATTTTTGCTACAAATGAAAATTACTGTATAATGAGCTCCTTAACACTTTTCTTTAAACCTGTGTTTGGAAGACTTGTGTTGGTGTGGCCCTGTGCCCTAATA CCTGTGAAATCACAGCACCGATGAGCTGGTTCCAATTTTTAAAATATATACATGCAGTACTTCCATGACTATTCAAAGAAAAACAATTCCTTCCATTTGCCACCTGAGATGACCACC AGGGATGTGAACTACCTCCTGCCCCATCCCCAGCCCCAGGATCCTGGGACAGGGCTTATGAACGCAACCACTGTAGTCAGCTCACTTGATCCACAGCCTGGCACCTCCACTGTCTGG CTAGGGAGCCTCGAATGGGTCCCAAGGCCACCCTGCTCCTCAGTTACATCATCTGCATAGTAGTGGTGGTTGTGAGGAATTCAGGAGCTGCAGCATAAGGGCCCTGCAGGTACTATG TGCTCAGTAAATGCCAGTGGTTCTTAAGGGTCTGAGCTCCCATTGTAGAGGCAAGTAAGCTGAGGTTCAGAGAAGAAAATGACTTGCCCAAGATCACCCAGCTGGGAAGTGACAGTG CCAGGGTTGGAGCCCTGGTTGAGCTGGTTCCACAGGCCAGAGCTCATTCTGCCCTCTCCCCGGAAGACCTCCCACCCTGTCCCCATGCCTCTGCTTCTCCCTCACCCCAATTCCCCG CTGCCTTCTAGGATAAGTGTGAGCCACTGGAGAAGCAGCACGAGAAGGAGAGGAAACAGGAGGAGGGGGAATCCTAGCAGGACACAGCCTTGGATCAGGACAGAGACTTGGGGGCCA TCCTGCCCCTCCAACCCGACATGTGTACCTCAGCTTTTTCCCTCACTTGCATCAATAAAGCTTCGCATCGGCCTTTCGAAACGAGGAGTACAATAAGTCGGTTCAGGAGCCCTCAGG CAGGAGGGTTCACCGTGGGAACAGGGCAGGCCAGCATAAGGTGGGGGCTGGATGTAGAGCCCTGGAGGCTTTGGGCACAGAGGCCACCCTGGACCGGGTGAGTGCCTGGGCTAGCCC TGTCCTGAGCACATGGGCAGCTGCCTCCCTTCTCTGGGCTTCCCTTTACCTGCTGGCTGTGGTCGCACCCCCACTCCCAGCCCCCAACTCTCCCCGCCACAACATACATCCCATGCC 30 CBS, Department of Systems Biology CAGGAGGGTTCACCGTGGGAACAGGGCAGGCCAGCATAAGGTGGGGGCTGGATGTAGAGCCCTGGAGGCTTTGGGCACAGAGGCCACCCTGGACCGGGTGAGTGCCTGGGCTAGCCC
31 31 CBS, Department of Systems Biology Source:
32 32 CBS, Department of Systems Biology
33 Current state-of-the art: Cores - 8 Tb RAM Fastest commercial computer 33 CBS, Department of Systems Biology
Proteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering
Proteomics 2 nd semester, 2013 1 Text book Principles of Proteomics by R. M. Twyman, BIOS Scientific Publications Other Reference books 1) Proteomics by C. David O Connor and B. David Hames, Scion Publishing
More informationIntroduction to Bioinformatics
CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics
More informationIntroduction Biology before Systems Biology: Reductionism Reduce the study from the whole organism to inner most details like protein or the DNA.
Systems Biology-Models and Approaches Introduction Biology before Systems Biology: Reductionism Reduce the study from the whole organism to inner most details like protein or the DNA. Taxonomy Study external
More informationProteomics. Yeast two hybrid. Proteomics - PAGE techniques. Data obtained. What is it?
Proteomics What is it? Reveal protein interactions Protein profiling in a sample Yeast two hybrid screening High throughput 2D PAGE Automatic analysis of 2D Page Yeast two hybrid Use two mating strains
More informationIntroduction to Systems Biology
Introduction to Systems Biology References: Watson s Molecular Biology of the Gene, Chapter 22 Alberts Molecular Biology of the Cell, Chapter 7 Yousof Gheisari ygheisari@med.mui.ac.ir Why is this picture
More informationBioinformatics 2. Yeast two hybrid. Proteomics. Proteomics
GENOME Bioinformatics 2 Proteomics protein-gene PROTEOME protein-protein METABOLISM Slide from http://www.nd.edu/~networks/ Citrate Cycle Bio-chemical reactions What is it? Proteomics Reveal protein Protein
More informationUpdated: 10/11/2018 Page 1 of 5
A. Academic Division: Health Sciences B. Discipline: Biology C. Course Number and Title: BIOL1230 Biology I MASTER SYLLABUS 2018-2019 D. Course Coordinator: Justin Tickhill Assistant Dean: Melinda Roepke,
More informationBIOLOGY 111. CHAPTER 1: An Introduction to the Science of Life
BIOLOGY 111 CHAPTER 1: An Introduction to the Science of Life An Introduction to the Science of Life: Chapter Learning Outcomes 1.1) Describe the properties of life common to all living things. (Module
More informationCONJOINT 541. Translating a Transcriptome at Specific Times and Places. David Morris. Department of Biochemistry
CONJOINT 541 Translating a Transcriptome at Specific Times and Places David Morris Department of Biochemistry http://faculty.washington.edu/dmorris/ Lecture 1 The Biology and Experimental Analysis of mrna
More informationAn introduction to SYSTEMS BIOLOGY
An introduction to SYSTEMS BIOLOGY Paolo Tieri CNR Consiglio Nazionale delle Ricerche, Rome, Italy 10 February 2015 Universidade Federal de Minas Gerais, Belo Horizonte, Brasil Course outline Day 1: intro
More informationComputational Cell Biology Lecture 4
Computational Cell Biology Lecture 4 Case Study: Basic Modeling in Gene Expression Yang Cao Department of Computer Science DNA Structure and Base Pair Gene Expression Gene is just a small part of DNA.
More informationIdentify stages of plant life cycle Botany Oral/written pres, exams
DPI Standards Biology Education (for students) 1. Characteristics of organisms Know Properties of living organisms, including: Acquire and use energy and materials Sense and respond to stimuli Reproduce
More informationComputational methods for predicting protein-protein interactions
Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational
More informationSystems biology and complexity research
Systems biology and complexity research Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Interdisciplinary Challenges for
More informationIntroduction to Bioinformatics. Shifra Ben-Dor Irit Orr
Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationChapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
More informationAutomated Assignment of Backbone NMR Data using Artificial Intelligence
Automated Assignment of Backbone NMR Data using Artificial Intelligence John Emmons στ, Steven Johnson τ, Timothy Urness*, and Adina Kilpatrick* Department of Computer Science and Mathematics Department
More informationBioinformatics. Dept. of Computational Biology & Bioinformatics
Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS
More informationBME 5742 Biosystems Modeling and Control
BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various
More information1.1. KEY CONCEPT Biologists study life in all its forms. 4 Reinforcement Unit 1 Resource Book. Biology in the 21st Century CHAPTER 1
1.1 THE STUDY OF LIFE KEY CONCEPT Biologists study life in all its forms. Biology is the scientific study of all forms of life. Living things are found almost everywhere on Earth, from very hot environments
More informationBiological Concepts and Information Technology (Systems Biology)
Biological Concepts and Information Technology (Systems Biology) Janaina de Andréa Dernowsek Postdoctoral at Center for Information Technology Renato Archer Janaina.dernowsek@cti.gov.br Division of 3D
More informationCourse Descriptions Biology
Course Descriptions Biology BIOL 1010 (F/S) Human Anatomy and Physiology I. An introductory study of the structure and function of the human organ systems including the nervous, sensory, muscular, skeletal,
More informationBasic modeling approaches for biological systems. Mahesh Bule
Basic modeling approaches for biological systems Mahesh Bule The hierarchy of life from atoms to living organisms Modeling biological processes often requires accounting for action and feedback involving
More informationCELL BIOLOGY. by the numbers. Ron Milo. Rob Phillips. illustrated by. Nigel Orme
CELL BIOLOGY by the numbers Ron Milo Rob Phillips illustrated by Nigel Orme viii Detailed Table of Contents List of Estimates xii Preface xv Acknowledgments xiii The Path to Biological Numeracy Why We
More informationCOMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry.
North Carolina Draft Standard Course of Study and Grade Level Competencies, Biology BIOLOGY COMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry. 1.01
More informationPeddie Summer Day School
Peddie Summer Day School Course Syllabus: BIOLOGY Teacher: Mr. Jeff Tuliszewski Text: Biology by Miller and Levine, Prentice Hall, 2010 edition ISBN 9780133669510 Guided Reading Workbook for Biology ISBN
More informationComputational Biology From The Perspective Of A Physical Scientist
Computational Biology From The Perspective Of A Physical Scientist Dr. Arthur Dong PP1@TUM 26 November 2013 Bioinformatics Education Curriculum Math, Physics, Computer Science (Statistics and Programming)
More informationChapter 1. Topic: Overview of basic principles
Chapter 1 Topic: Overview of basic principles Four major themes of biochemistry I. What are living organism made from? II. How do organism acquire and use energy? III. How does an organism maintain its
More informationProteomics Systems Biology
Dr. Sanjeeva Srivastava IIT Bombay Proteomics Systems Biology IIT Bombay 2 1 DNA Genomics RNA Transcriptomics Global Cellular Protein Proteomics Global Cellular Metabolite Metabolomics Global Cellular
More informationRNA & PROTEIN SYNTHESIS. Making Proteins Using Directions From DNA
RNA & PROTEIN SYNTHESIS Making Proteins Using Directions From DNA RNA & Protein Synthesis v Nitrogenous bases in DNA contain information that directs protein synthesis v DNA remains in nucleus v in order
More informationWhat Can Physics Say About Life Itself?
What Can Physics Say About Life Itself? Science at the Interface of Physics and Biology Michael Manhart Department of Physics and Astronomy BioMaPS Institute for Quantitative Biology Source: UIUC, Wikimedia
More information11/24/13. Science, then, and now. Computational Structural Bioinformatics. Learning curve. ECS129 Instructor: Patrice Koehl
Computational Structural Bioinformatics ECS129 Instructor: Patrice Koehl http://www.cs.ucdavis.edu/~koehl/teaching/ecs129/index.html koehl@cs.ucdavis.edu Learning curve Math / CS Biology/ Chemistry Pre-requisite
More informationHAWAII CONTENT AND PERFORMANCE STANDARDS BIOLOGICAL SCIENCE
HAWAII CONTENT AND PERFORMANCE STANDARDS BIOLOGICAL SCIENCE Correlated to BIOLOGY: CYCLES OF LIFE 2006 5910 Rice Creek Parkway, Suite 1000 Shoreview, Minnesota 55126 Telephone (800) 328-2560 www.agsglobe.com
More informationGACE Biology Assessment Test I (026) Curriculum Crosswalk
Subarea I. Cell Biology: Cell Structure and Function (50%) Objective 1: Understands the basic biochemistry and metabolism of living organisms A. Understands the chemical structures and properties of biologically
More informationMiller & Levine Biology
A Correlation of To the Science Biology A Correlation of, 2014 to the, Table of Contents From Molecules to Organisms: Structures and Processes... 3 Ecosystems: Interactions, Energy, and Dynamics... 4 Heredity:
More informationMolecular and cellular biology is about studying cell structure and function
Chapter 1 Exploring the World of the Cell In This Chapter Discovering the microscopic world Getting matter and energy Reading the genetic code Molecular and cellular biology is about studying cell structure
More informationAnalysis and Simulation of Biological Systems
Analysis and Simulation of Biological Systems Dr. Carlo Cosentino School of Computer and Biomedical Engineering Department of Experimental and Clinical Medicine Università degli Studi Magna Graecia Catanzaro,
More informationOctober 08-11, Co-Organizer Dr. S D Samantaray Professor & Head,
A Journey towards Systems system Biology biology :: Biocomputing of of Hi-throughput Omics omics Data data October 08-11, 2018 Coordinator Dr. Anil Kumar Gaur Professor & Head Department of Molecular Biology
More informationBiology Assessment. Eligible Texas Essential Knowledge and Skills
Biology Assessment Eligible Texas Essential Knowledge and Skills STAAR Biology Assessment Reporting Category 1: Cell Structure and Function The student will demonstrate an understanding of biomolecules
More informationSTAAR Biology Assessment
STAAR Biology Assessment Reporting Category 1: Cell Structure and Function The student will demonstrate an understanding of biomolecules as building blocks of cells, and that cells are the basic unit of
More informationChapter 1: Introduction: Themes in the Study of Life
Name Period Begin your study of biology this year by reading Chapter 1. It will serve as a reminder about biological concepts that you may have learned in an earlier course and give you an overview of
More informationWarm Up. What are some examples of living things? Describe the characteristics of living things
Warm Up What are some examples of living things? Describe the characteristics of living things Objectives Identify the levels of biological organization and explain their relationships Describe cell structure
More informationMidterm Review Guide. Unit 1 : Biochemistry: 1. Give the ph values for an acid and a base. 2. What do buffers do? 3. Define monomer and polymer.
Midterm Review Guide Name: Unit 1 : Biochemistry: 1. Give the ph values for an acid and a base. 2. What do buffers do? 3. Define monomer and polymer. 4. Fill in the Organic Compounds chart : Elements Monomer
More informationMSc Drug Design. Module Structure: (15 credits each) Lectures and Tutorials Assessment: 50% coursework, 50% unseen examination.
Module Structure: (15 credits each) Lectures and Assessment: 50% coursework, 50% unseen examination. Module Title Module 1: Bioinformatics and structural biology as applied to drug design MEDC0075 In the
More informationMissouri Educator Gateway Assessments
Missouri Educator Gateway Assessments June 2014 Content Domain Range of Competencies Approximate Percentage of Test Score I. Science and Engineering Practices 0001 0003 21% II. Biochemistry and Cell Biology
More informationAdvanced Cell Biology. Lecture 1
Advanced Cell Biology. Lecture 1 Alexey Shipunov Minot State University January 9, 2013 Shipunov (MSU) Advanced Cell Biology. Lecture 1 January 9, 2013 1 / 27 Outline Course in general Description Grading
More informationVirginia Western Community College BIO 101 General Biology I
BIO 101 General Biology I Prerequisites Successful completion of MTE 1, 2, 3, 4, and 5; and a placement recommendation for ENG 111, co-enrollment in ENF 3/ENG 111, or successful completion of all developmental
More informationGene Ontology and overrepresentation analysis
Gene Ontology and overrepresentation analysis Kjell Petersen J Express Microarray analysis course Oslo December 2009 Presentation adapted from Endre Anderssen and Vidar Beisvåg NMC Trondheim Overview How
More informationWelcome to AP BIOLOGY!!!! NOTES: Chapter 1 Exploring Life
Welcome to AP BIOLOGY!!!! NOTES: Chapter 1 Exploring Life The phenomenon we call life defies a simple, onesentence definition Exploring LIFE: We recognize life by what living things DO Some Properties
More informationClustering and Network
Clustering and Network Jing-Dong Jackie Han jdhan@picb.ac.cn http://www.picb.ac.cn/~jdhan Copy Right: Jing-Dong Jackie Han What is clustering? A way of grouping together data samples that are similar in
More informationCurriculum Map. Biology, Quarter 1 Big Ideas: From Molecules to Organisms: Structures and Processes (BIO1.LS1)
1 Biology, Quarter 1 Big Ideas: From Molecules to Organisms: Structures and Processes (BIO1.LS1) Focus Standards BIO1.LS1.2 Evaluate comparative models of various cell types with a focus on organic molecules
More informationSCOTCAT Credits: 20 SCQF Level 7 Semester 1 Academic year: 2018/ am, Practical classes one per week pm Mon, Tue, or Wed
Biology (BL) modules BL1101 Biology 1 SCOTCAT Credits: 20 SCQF Level 7 Semester 1 10.00 am; Practical classes one per week 2.00-5.00 pm Mon, Tue, or Wed This module is an introduction to molecular and
More informationEASTERN ARIZONA COLLEGE General Biology I
EASTERN ARIZONA COLLEGE General Biology I Course Design 2013-2014 Course Information Division Science Course Number BIO 181 (SUN# BIO 1181) Title General Biology I Credits 4 Developed by David J. Henson
More informationMolecular Biology Of The Cell 6th Edition Alberts
We have made it easy for you to find a PDF Ebooks without any digging. And by having access to our ebooks online or by storing it on your computer, you have convenient answers with molecular biology of
More informationGenom, transkriptom in proteom
Genom, transkriptom in proteom The conceptual relationship of the genome, transcriptome, proteome and metabolome Fenotipi/Phenotypes Morphological phenotypes are fixed in distinct dog breeds. Fizikalna
More informationBig Idea 1: Does the process of evolution drive the diversity and unit of life?
AP Biology Syllabus 2016-2017 Course Overview: AP Biology is equivalent to an introductory college level biology program in order to develop student led inquiry into science. The class is designed to go
More informationCausal Discovery by Computer
Causal Discovery by Computer Clark Glymour Carnegie Mellon University 1 Outline 1. A century of mistakes about causation and discovery: 1. Fisher 2. Yule 3. Spearman/Thurstone 2. Search for causes is statistical
More information(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.
1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the
More informationDynamical Modeling in Biology: a semiotic perspective. Junior Barrera BIOINFO-USP
Dynamical Modeling in Biology: a semiotic perspective Junior Barrera BIOINFO-USP Layout Introduction Dynamical Systems System Families System Identification Genetic networks design Cell Cycle Modeling
More informationBerg Tymoczko Stryer Biochemistry Sixth Edition Chapter 1:
Berg Tymoczko Stryer Biochemistry Sixth Edition Chapter 1: Biochemistry: An Evolving Science Tips on note taking... Remember copies of my lectures are available on my webpage If you forget to print them
More informationTEACHER CERTIFICATION STUDY GUIDE. Table of Contents I. BASIC PRINCIPLES OF SCIENCE (HISTORY AND NATURAL SCIENCE)
Table of Contents I. BASIC PRINCIPLES OF SCIENCE (HISTORY AND NATURAL SCIENCE) A. Nature of scientific knowledge, inquiry, and historical perspectives 1. Scientific methods...1 2. Processes involved in
More informationDr. Dennis Gervin Sections: 4252, 4253, 7734,
BIOLOGY 111 Dr. Dennis Gervin Sections: 4252, 4253, 7734, 7736 http://www.mjc.edu/ http://gervind.faculty.mjc.edu/default.html A Guide to the Natural World How Does Science Impact Your Everyday World?
More informationCurriculum Links. AQA GCE Biology. AS level
Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2
More informationBioinformatics and Computerscience
Bioinformatics and Computerscience Systems Biology Data collection Network Inference Network-based dataintegration 1. ARRAY BASED 2. NEXT-GEN SEQUENCING RNA-Seq analysis ChIP-seq Bulked segregant analysis
More informationUNIT 1: INTRODUCING BIOLOGY. Chapter 1: Biology in the 21st Century
UNIT 1: INTRODUCING BIOLOGY Chapter 1: Biology in the 21st Century UNIT 1: INTRODUCING BIOLOGY Chapter 1: Biology in the 21st Century I. The Study of Life (1.1) A. Earth is home to an incredible diversity
More informationHonors Biology Fall Final Exam Study Guide
Honors Biology Fall Final Exam Study Guide Helpful Information: Exam has 100 multiple choice questions. Be ready with pencils and a four-function calculator on the day of the test. Review ALL vocabulary,
More informationFormative/Summative Assessments (Tests, Quizzes, reflective writing, Journals, Presentations)
Biology Curriculum Map 2017-18 2 Weeks- Introduction to Biology: Scientific method, lab safety, organizing and analyzing data, and psuedoscience. This unit establishes the fundamental nature of scientific
More informationVideos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.
Translation Translation Videos Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.be/itsb2sqr-r0 Translation Translation The
More informationMultiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
More informationAP* Biology Prep Course
AP* Biology Prep Course SYLLABUS Welcome to the FlinnPREP AP* Biology Online Prep Course! Your enrollment in this course is your first step toward a 5 on the AP* Biology exam. FlinnPREP covers fundamental
More informationI. Molecules & Cells. A. Unit One: The Nature of Science. B. Unit Two: The Chemistry of Life. C. Unit Three: The Biology of the Cell.
I. Molecules & Cells A. Unit One: The Nature of Science a. How is the scientific method used to solve problems? b. What is the importance of controls? c. How does Darwin s theory of evolution illustrate
More informationBiology A 1 st Marking Period
Biology Curriculum Map WOHS (Western Career Prep HS) 2016-17 Biology A 1 st Marking Period 2 weeks Introduction to Biology: Understand what it means to ask questions and design valid and reliable ways
More informationThe following pages outline the major elements of the course and when you can expect each to be covered. Assessment
A level biology The course we offer at Robert Smyth Academy is OCR Biology A which a two year linear course. Details of the course can be found at http://www.ocr.org.uk/qualifications/as-a-levelgce-biology-a-h020-h420-from-2015/
More informationProtein function studies: history, current status and future trends
19 3 2007 6 Chinese Bulletin of Life Sciences Vol. 19, No. 3 Jun., 2007 1004-0374(2007)03-0294-07 ( 100871) Q51A Protein function studies: history, current status and future trends MA Jing, GE Xi, CHANG
More informationBiology II : Embedded Inquiry
Biology II : Embedded Inquiry Conceptual Strand Understandings about scientific inquiry and the ability to conduct inquiry are essential for living in the 21 st century. Guiding Question What tools, skills,
More informationCHAPTER 1 Life: Biological Principles and the Science of Zoology
CHAPTER 1 Life: Biological Principles and the Science of Zoology 1-1 Zoology: The Uses of Principles The scientific study of animal life Does Life Have Defining Properties? No simple definition The history
More informationGrundlagen der Systembiologie und der Modellierung epigenetischer Prozesse
Grundlagen der Systembiologie und der Modellierung epigenetischer Prozesse Sonja J. Prohaska Bioinformatics Group Institute of Computer Science University of Leipzig October 25, 2010 Genome-scale in silico
More informationRange of Competencies
BIOLOGY Content Domain Range of Competencies l. Nature of Science 0001 0003 20% ll. Biochemistry and Cell Biology 0004 0005 13% lll. Genetics and Evolution 0006 0009 27% lv. Biological Unity and Diversity
More informationBIOINFORMATICS LAB AP BIOLOGY
BIOINFORMATICS LAB AP BIOLOGY Bioinformatics is the science of collecting and analyzing complex biological data. Bioinformatics combines computer science, statistics and biology to allow scientists to
More informationProkaryotic Gene Expression (Learning Objectives)
Prokaryotic Gene Expression (Learning Objectives) 1. Learn how bacteria respond to changes of metabolites in their environment: short-term and longer-term. 2. Compare and contrast transcriptional control
More informationLassen Community College Course Outline
Lassen Community College Course Outline BIOL-1 Principles of Molecular and Cellular Biology 4.0 Units I. Catalog Description A course in principles of biology, with special emphasis given to molecular
More informationIdentifying Signaling Pathways
These slides, excluding third-party material, are licensed under CC BY-NC 4.0 by Anthony Gitter, Mark Craven, Colin Dewey Identifying Signaling Pathways BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018
More informationADVANCED PLACEMENT BIOLOGY
ADVANCED PLACEMENT BIOLOGY Description Advanced Placement Biology is designed to be the equivalent of a two-semester college introductory course for Biology majors. The course meets seven periods per week
More informationGSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H*" ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION
FIFTH EDITION IV I ^HHk ^ttm IZTI/^Q i I II MPHBBMWBBIHB '-llwmpbi^hbwm^^pfc ' GSBHSRSBRSRRk LlML I I \l 1MB ^HP'^^MMMP" jflp^^^^^^^^st I Iv^O FROM GENES TO GENOMES %^MiM^PM^^MWi99Mi$9i0^^ ^^^^^^^^^^^^^V^^^fii^^t^i^^^^^
More informationUNIVERSITY OF CALIFORNIA SANTA BARBARA DEPARTMENT OF CHEMICAL ENGINEERING. CHE 154: Engineering Approaches to Systems Biology Spring Quarter 2004
UNIVERSITY OF CALIFORNIA SANTA BARBARA DEPARTMENT OF CHEMICAL ENGINEERING CHE 154: Engineering Approaches to Systems Biology Spring Quarter 2004 Lecture: Tue/Thu 9:30-10:45am Engr-II Room 3301 Instructor
More informationGene Ontology. Shifra Ben-Dor. Weizmann Institute of Science
Gene Ontology Shifra Ben-Dor Weizmann Institute of Science Outline of Session What is GO (Gene Ontology)? What tools do we use to work with it? Combination of GO with other analyses What is Ontology? 1700s
More informationAP Biology UNIT 1: CELL BIOLOGY. Advanced Placement
Advanced Placement AP Biology builds students' understanding of biology on both the micro and macro scales. After studying cell biology, students move on to understand how evolution drives the diversity
More information2. Cellular and Molecular Biology
2. Cellular and Molecular Biology 2.1 Cell Structure 2.2 Transport Across Cell Membranes 2.3 Cellular Metabolism 2.4 DNA Replication 2.5 Cell Division 2.6 Biosynthesis 2.1 Cell Structure What is a cell?
More informationNetwork Biology: Understanding the cell s functional organization. Albert-László Barabási Zoltán N. Oltvai
Network Biology: Understanding the cell s functional organization Albert-László Barabási Zoltán N. Oltvai Outline: Evolutionary origin of scale-free networks Motifs, modules and hierarchical networks Network
More informationVance County Early College High School Pacing Guide Course: Introduction to Biology (Semester I)
Vance County Early College High School Pacing Guide Course: Introduction to Biology (Semester I) Week(s ) Dates Unit Unit Title Essential Questions / Topic Questions 1 1 Introduction to Biology 1. How
More informationREQUIREMENTS FOR THE BIOCHEMISTRY MAJOR
REQUIREMENTS FOR THE BIOCHEMISTRY MAJOR Grade Requirement: All courses required for the Biochemistry major (CH, MATH, PHYS, BI courses) must be graded and passed with a grade of C- or better. Core Chemistry
More informationCase study: spider mimicry
Pounce rate (% of trials in which spider jumped on fly) Case study: spider mimicry Control group (untreated flies) Experimental group (wing markings masked) Pounce rate (% of trials in which spider jumped
More informationChapter Chemical Uniqueness 1/23/2009. The Uses of Principles. Zoology: the Study of Animal Life. Fig. 1.1
Fig. 1.1 Chapter 1 Life: Biological Principles and the Science of Zoology BIO 2402 General Zoology Copyright The McGraw Hill Companies, Inc. Permission required for reproduction or display. The Uses of
More informationAn Introduction to the Science of Botany. Chapter 1
An Introduction to the Science of Botany Chapter 1 TTU MS 43131 LEARNING OBJECTIVES Briefly describe the field of botany, and give short definitions of at least five subdisciplines of plant biology Summarize
More informationMATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME
MATHEMATICAL MODELING AND THE HUMAN GENOME Hilary S. Booth Australian National University, Australia Keywords: Human genome, DNA, bioinformatics, sequence analysis, evolution. Contents 1. Introduction:
More informationComputational Genomics. Reconstructing dynamic regulatory networks in multiple species
02-710 Computational Genomics Reconstructing dynamic regulatory networks in multiple species Methods for reconstructing networks in cells CRH1 SLT2 SLR3 YPS3 YPS1 Amit et al Science 2009 Pe er et al Recomb
More informationBiochemistry-BS Program Study Abroad Pathway
Biochemistry-BS Program Study Abroad Pathway (last revised September 2016) Table 1a: Undergraduate Program Schedule These undergraduate program schedules are subject to change. Please verify information
More informationBIOLOGY Chair Associate Chair Faculty with Research Interests Degree Programs Other Degree Programs in Biology Research Honors Program
Biology 1 BIOLOGY Robert A. Pritzker Science Center, Room 182 3101 S. Dearborn St. Chicago, IL 60616 312.567.3480 kersh@iit.edu science.iit.edu/biology Chair Thomas Irving Associate Chair Tanya Bekyarova
More informationBundle at a Glance Biology 2015/16
Introduction: Scientific Investigation and Reasoning Skills (3 A/B days) Biology Process TEKS: 1A demonstrate safe practices during laboratory and field investigations. 1B demonstrate an understanding
More information