HORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS
|
|
- Gabriel Sanders
- 5 years ago
- Views:
Transcription
1 HORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS
2 OVERVIEW INTRODUCTION MECHANISMS OF HGT IDENTIFICATION TECHNIQUES EXAMPLES - Wolbachia pipientis - Fungus - Plants - Drosophila ananassae - You are what you eat RELEVANCE AND CONTROVERSY CONCLUSIONS REFERENCES
3 INTRODUCTION Biological evolution proceeds from ancestry to descendants with modifications (Darwin) à Non-anastomosing phylogenetic trees Horizontal Gene Transfer (HGT) refers to the transfer of genes between organisms. It leads to evolutionary reticulations à Anastomosing phylogenetic trees Acquisition of foreign genes (evolutionary potential) Prokaryotes Eukaryotes Unicellular Multicellular
4 Wijayawardena et al. (2013)
5 MECHANISMS Donor and recipient must have a close relationship Phagocytosis/symbiosis (Mitochondria and plastids) Parasitism Mobile genetic elements Plasmids Viruses Transposable elements (TEs) The foreign genetic material has to successfully integrate into the germline Evasion of immune system, nucleases and proteases Genomic compatibility Population genetic processes: mutation, natural selection, genetic flow and genetic drift
6 Wijayawardena et al. (2013)
7 DETECTION TECHNIQUES Phylogenetic methods: Incongruence Phylogenetic-independent methods Codon-based approaches BLAST Wijayawardena et al. (2013) PCR- based approaches Fluorescent in situ hybridization (FISH), Southern, comparisons of protein structures, Chromosome/genome walking Comparative genome studies Biogeographical and ecological data COMBINATION!
8 PROKARYOTE! EUKARYOTE The presence of endosymbionts Wolbachia pipientis, within some eukaryotic germlines may facilitate bacterial gene transfers to eukaryotic host genomes. Transfers into the genomes of four insect and four nematode. Verified by molecular techniques as FISH in a Drosophila chromosome using a probe for a Wolbachia gene. Hotopp et al. (2007)
9 EUKARYOTE! EUKARYOTE Stagonospora nodorum ToxA Pyrenophora tritici-repentis The gene has not been found in closely related species. The mechanism of transfer could be related with the fusion of hyphae, the nucleuses were very close and the transfer took place. Sanders et al. (2006)
10 EUKARYOTE! EUKARYOTE Plant mitochondria genomes experience frequent horizontal transfer of genes. Mitochondria à Mitochondria Active DNA uptake system but no such system is known in plastids (propensity to fuse). Pseudogenes vs. functional genes Amborella trichopoda: massive HGT (20 of the 30 mitochondrial genes) à special opportunities for studying the evolutionary dynamics of HGT at the populations level. Richardson et al. (2006)
11 EUKARYOTE! EUKARYOTE Many TEs have been horizontally transferred among Drosophila species. Hundred-one events of HT have been proposed in Drosophila for 21 different elements: 5% non-ltr 42,6% LTR 52,4% DNA transposons The mechanism of HT vary from very simple ones, such a direct transfer (LTR), to more complex systems involving intermediate vectors. TEs-rich regions are specially prone to HGT, what suggests a functional role for TEs. Loreto et al. (2008)
12 Loreto et al. (2008)
13 YOU ARE WHAT YOU EAT, WHAT YOU LIVE ON, WHAT LIVES ON YOU, AND WHAT LIVES IN YOU Keeling et al. (2008)
14 RELEVANCE AND CONTROVERSY RELEVANCE: History of eukaryotic evolution (information) It may provide genes of novel function to the recipient genome The whole acquisition of intact genes and/or regulatory regions may allow species to evolve genes. Important contributor to genomic diversity. CONTROVERSY: Role of HGT? Vectors, donors and recipients? Unknown mechanisms Insufficient methodologies
15 CONCLUSIONS 1. HGT forms anastomosing phylogenetic trees. 2. The HGT has evolutionary potential because it allows the acquisition of foreign genes (generation of new biological diversity). 3. HGT is more frequent in prokaryotes but it also occurs in eukaryotes, where plays a more important role than it was though. 4. Transferred gene evolves according to the population genetic factors. 5. Detection techniques must be combined in order to detect the presence of HGT with no mistake. 6. The range of eukaryotic organisms subjected to HGT is really high. 7. Several behaviours and life-styles can enhance HGT.
16 REFERENCES Hotopp JC et al Widespread lateral gene transfer from intracellular bacteria to multicellular eukaryotes. Science. 317(5845): Keeling PJ, Palmer JD Horizontal transfer in eukaryotic evolution. Nat Rev Genet. 9(8): Review. Loreto EL, Carareto CM, Capy P Revisiting horizontal transfer of transposable elements in Drosophila. Heredity. 100(6): Richardson AO, Palmer JD Horizontal transfer in plants. J Exp Bot. 58(1):1-9. Sanders IR Rapid disease emergence through horizontal gene transfer between eukaryotes. Trends Ecology Evolut. 21: Wijayawardena BK, Minchella DJ, DeWoody JA Hosts, parasites, and horizontal gene transfer. Trends Parasitol.29(7):
17 THANK YOU FOR YOUR ATTENTION KIMBERLEY MC GRAIL FERNÁNDEZ
Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.
Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:
More informationBiology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p.
READING: 14.2 Bacterial Genomes p. 481 14.3 Gene Transfer Mechanisms in Bacteria p. 486 Suggested Problems: 1, 7, 13, 14, 15, 20, 22 BACTERIAL GENETICS AND GENOMICS We still consider the E. coli genome
More informationA DNA Sequence 2017/12/6 1
A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta
More informationPrinciples of Genetics
Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics
More informationChapters AP Biology Objectives. Objectives: You should know...
Objectives: You should know... Notes 1. Scientific evidence supports the idea that evolution has occurred in all species. 2. Scientific evidence supports the idea that evolution continues to occur. 3.
More informationOutline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/1/18
Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection
More informationOutline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16
Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection
More informationOrigins of Life. Fundamental Properties of Life. Conditions on Early Earth. Evolution of Cells. The Tree of Life
The Tree of Life Chapter 26 Origins of Life The Earth formed as a hot mass of molten rock about 4.5 billion years ago (BYA) -As it cooled, chemically-rich oceans were formed from water condensation Life
More informationMicrobes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationMicrobial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationBiology 112 Practice Midterm Questions
Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,
More informationA. Correct! Taxonomy is the science of classification. B. Incorrect! Taxonomy is the science of classification.
DAT - Problem Drill 07: Diversity of Life Question No. 1 of 10 Instructions: (1) Read the problem and answer choices carefully, (2) Work the problems on paper as 1. What is taxonomy? Question #01 (A) Taxonomy
More informationBIOLOGY Grades Summer Units: 10 high school credits UC Requirement Category: d. General Description:
Summer 2015 Units: 10 high school credits UC Requirement Category: d General Description: BIOLOGY Grades 9-12 Summer session biology will be an intense, fast paced course. Students will gain an understanding
More informationGenomes and Their Evolution
Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationEvaluate evidence provided by data from many scientific disciplines to support biological evolution. [LO 1.9, SP 5.3]
Learning Objectives Evaluate evidence provided by data from many scientific disciplines to support biological evolution. [LO 1.9, SP 5.3] Refine evidence based on data from many scientific disciplines
More informationMiller & Levine Biology 2014
A Correlation of Miller & Levine Biology To the Essential Standards for Biology High School Introduction This document demonstrates how meets the North Carolina Essential Standards for Biology, grades
More informationGenetic Basis of Variation in Bacteria
Mechanisms of Infectious Disease Fall 2009 Genetics I Jonathan Dworkin, PhD Department of Microbiology jonathan.dworkin@columbia.edu Genetic Basis of Variation in Bacteria I. Organization of genetic material
More informationWolbachia PCR: Discover the Microbes Within!
Wolbachia PCR: Discover the Microbes Within! Overview of the Wolbachia Lab Insect identification DNA extraction PCR? Wolbachia lecture Bioinformatics ACAGATGTC TTGTAATCCG GCCGTTGGT GGCATAGGG AAAGGACAT
More informationChapter Chemical Uniqueness 1/23/2009. The Uses of Principles. Zoology: the Study of Animal Life. Fig. 1.1
Fig. 1.1 Chapter 1 Life: Biological Principles and the Science of Zoology BIO 2402 General Zoology Copyright The McGraw Hill Companies, Inc. Permission required for reproduction or display. The Uses of
More informationCOMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry.
North Carolina Draft Standard Course of Study and Grade Level Competencies, Biology BIOLOGY COMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry. 1.01
More informationBacterial Genetics & Operons
Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the
More informationThe minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
More informationText of objective. Investigate and describe the structure and functions of cells including: Cell organelles
This document is designed to help North Carolina educators teach the s (Standard Course of Study). NCDPI staff are continually updating and improving these tools to better serve teachers. Biology 2009-to-2004
More informationMicrobial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationChapter 27: Bacteria and Archaea
Name Period Overview 1. The chapter opens with amazing tales of life at the extreme edge. What are the masters of adaptation? Describe the one case you thought most dramatic. Concept 27.1 Structural and
More informationReadings Lecture Topics Class Activities Labs Projects Chapter 1: Biology 6 th ed. Campbell and Reese Student Selected Magazine Article
Unit Subtopics and Duration Unit 1: Principles of Science Themes in science Research and Lab techniques 6 days Readings Lecture Topics Class Activities Labs Projects Chapter 1: Biology 6 th ed. Campbell
More informationIntro to Prokaryotes Lecture 1 Spring 2014
Intro to Prokaryotes Lecture 1 Spring 2014 Meet the Prokaryotes 1 Meet the Prokaryotes 2 Meet the Prokaryotes 3 Why study prokaryotes? Deep Time 4 Fig. 25.7 Fossilized stromatolite (above) and living stromatolite
More informationChapter 26 Phylogeny and the Tree of Life
Chapter 26 Phylogeny and the Tree of Life Chapter focus Shifting from the process of how evolution works to the pattern evolution produces over time. Phylogeny Phylon = tribe, geny = genesis or origin
More informationORIGIN OF CELLULARITY AND CELLULAR DIVERSITY
ORIGIN OF CELLULARITY AND CELLULAR DIVERSITY Geological stratigraphy, together with radioactive dating, show the sequence of events in the history of the Earth. Note the entry for cyanobacteria and stromatolites
More informationAP Biology Exam #7 (PRACTICE) Subunit #7: Diversity of Life
AP Biology Exam #7 (PRACTICE) Subunit #7: Diversity of Life Multiple Choice Questions: Choose the best answer then bubble your answer on your scantron sheet. 1. Armadillos and spiny anteaters are not related.
More informationChapter 18 Active Reading Guide Genomes and Their Evolution
Name: AP Biology Mr. Croft Chapter 18 Active Reading Guide Genomes and Their Evolution Most AP Biology teachers think this chapter involves an advanced topic. The questions posed here will help you understand
More informationFundamentals of Biology Valencia College BSC1010C
1 Fundamentals of Biology Valencia College BSC1010C 1 Studying Life Chapter objectives: What Is Biology? Is All Life on Earth Related? How Do Biologists Investigate Life? How Does Biology Influence Public
More informationHorizontal transfer and pathogenicity
Horizontal transfer and pathogenicity Victoria Moiseeva Genomics, Master on Advanced Genetics UAB, Barcelona, 2014 INDEX Horizontal Transfer Horizontal gene transfer mechanisms Detection methods of HGT
More informationGuided Notes: Evolution. is the change in traits through generations over! Occurs in, NOT individual organisms
Guided Notes: Evolution The Theory of Evolution is the change in traits through generations over! Occurs in, NOT individual organisms How Have Organisms Changed? At the time life emerged, the Earth was
More information2. What was the Avery-MacLeod-McCarty experiment and why was it significant? 3. What was the Hershey-Chase experiment and why was it significant?
Name Date Period AP Exam Review Part 6: Molecular Genetics I. DNA and RNA Basics A. History of finding out what DNA really is 1. What was Griffith s experiment and why was it significant? 1 2. What was
More informationChapter 1 Biology 103
Chapter 1 Biology 103 Properties of Life Living organisms: are composed of cells are complex and ordered respond to their environment can grow and reproduce obtain and use energy maintain internal balance
More information9/8/2017. Bacteria and Archaea. Three domain system: The present tree of life. Structural and functional adaptations contribute to prokaryotic success
5 m 2 m 9/8/2017 Three domain system: The present tree of life Bacteria and Archaea Chapter 27 Structural and functional adaptations contribute to prokaryotic success Unicellular Small Variety of shapes
More informationFrequently Asked Questions (FAQs)
Frequently Asked Questions (FAQs) Q1. What is meant by Satellite and Repetitive DNA? Ans: Satellite and repetitive DNA generally refers to DNA whose base sequence is repeated many times throughout the
More informationIntroduction to Molecular and Cell Biology
Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What
More informationBio 119 Bacterial Genomics 6/26/10
BACTERIAL GENOMICS Reading in BOM-12: Sec. 11.1 Genetic Map of the E. coli Chromosome p. 279 Sec. 13.2 Prokaryotic Genomes: Sizes and ORF Contents p. 344 Sec. 13.3 Prokaryotic Genomes: Bioinformatic Analysis
More informationMicrobial Taxonomy and the Evolution of Diversity
19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy
More information2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology
2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the
More informationI. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes.
I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes. A. Chemistry of Life B. Cells 1. Water How do the unique chemical
More informationAP Biology. Read college-level text for understanding and be able to summarize main concepts
St. Mary's College AP Biology Continuity and Change Consider how specific changes to an ecosystem (geological, climatic, introduction of new organisms, etc.) can affect the organisms that live within it.
More informationCHAPTER : Prokaryotic Genetics
CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering
More informationBio 1B Lecture Outline (please print and bring along) Fall, 2007
Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution
More informationGSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H*" ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION
FIFTH EDITION IV I ^HHk ^ttm IZTI/^Q i I II MPHBBMWBBIHB '-llwmpbi^hbwm^^pfc ' GSBHSRSBRSRRk LlML I I \l 1MB ^HP'^^MMMP" jflp^^^^^^^^st I Iv^O FROM GENES TO GENOMES %^MiM^PM^^MWi99Mi$9i0^^ ^^^^^^^^^^^^^V^^^fii^^t^i^^^^^
More informationI. Molecules & Cells. A. Unit One: The Nature of Science. B. Unit Two: The Chemistry of Life. C. Unit Three: The Biology of the Cell.
I. Molecules & Cells A. Unit One: The Nature of Science a. How is the scientific method used to solve problems? b. What is the importance of controls? c. How does Darwin s theory of evolution illustrate
More informationVCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design
VCE BIOLOGY 2006 2014 Relationship between the key knowledge and key skills of the 2000 2005 Study Design and the 2006 2014 Study Design The following table provides a comparison of the key knowledge (and
More informationOrganization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p
Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p.110-114 Arrangement of information in DNA----- requirements for RNA Common arrangement of protein-coding genes in prokaryotes=
More informationAP Biology Review Packet 5- Natural Selection and Evolution & Speciation and Phylogeny
AP Biology Review Packet 5- Natural Selection and Evolution & Speciation and Phylogeny 1A1- Natural selection is a major mechanism of evolution. 1A2: Natural selection acts on phenotypic variations in
More informationOrigin of Sexual Reproduction
Origin of Sexual Reproduction Lukas Schärer! Evolutionary Biology Zoological Institute University of Basel 1 11.10.2017 Advanced-level Evolutionary Biology What is sexual reproduction? 2 from various websites
More information1. The basic structural and physiological unit of all living organisms is the A) aggregate. B) organelle. C) organism. D) membrane. E) cell.
Name: Date: Test File Questions 1. The basic structural and physiological unit of all living organisms is the A) aggregate. B) organelle. C) organism. D) membrane. E) cell. 2. A cell A) can be composed
More informationTE content correlates positively with genome size
TE content correlates positively with genome size Mb 3000 Genomic DNA 2500 2000 1500 1000 TE DNA Protein-coding DNA 500 0 Feschotte & Pritham 2006 Transposable elements. Variation in gene numbers cannot
More informationCh 10. Classification of Microorganisms
Ch 10 Classification of Microorganisms Student Learning Outcomes Define taxonomy, taxon, and phylogeny. List the characteristics of the Bacteria, Archaea, and Eukarya domains. Differentiate among eukaryotic,
More informationMicrobiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms
1 2 Bergey s Manual of Systematic Bacteriology differs from Bergey s Manual of Determinative Bacteriology in that the former a. groups bacteria into species. b. groups bacteria according to phylogenetic
More informationModern cellular organisms. From
Modern cellular organisms From http://www.ucmp.berkeley.edu/exhibit/phylogeny.html Endothelial cell Lysosomes, mitochondria and nucleus See the cellular cytoskeleton, ER and nucleus Modern cells are complex
More information3) What are the names of the SIX kingdoms? Next to each one, write whether it is prokaryotic or Eukaryotic
Topic #1: Taxonomy 1) What is taxonomy? system of naming and classifying organisms 2) Name the eight levels of taxonomic categories, starting with the most general and ending with the most specific. Domain,
More informationIntroduction to Bioinformatics Integrated Science, 11/9/05
1 Introduction to Bioinformatics Integrated Science, 11/9/05 Morris Levy Biological Sciences Research: Evolutionary Ecology, Plant- Fungal Pathogen Interactions Coordinator: BIOL 495S/CS490B/STAT490B Introduction
More information13.1 Biological Classification - Kingdoms and Domains Modern species are divided into three large groups, or domains. Bacteria Archaea Eukarya
Chapter 13 Prospecting for Biological Gold Biodiversity and Classification 13.1 Biological Classification- How Many Species Exist? Biodiversity is the variety within and among living species Number of
More informationNOTES Ch 17: Genes and. Variation
NOTES Ch 17: Genes and Vocabulary Fitness Genetic Drift Punctuated Equilibrium Gene flow Adaptive radiation Divergent evolution Convergent evolution Gradualism Variation 17.1 Genes & Variation Darwin developed
More informationSPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES.
THE TERMS RUN AND TUMBLE ARE GENERALLY ASSOCIATED WITH A) cell wall fluidity. B) cell membrane structures. C) taxic movements of the cell. D) clustering properties of certain rod-shaped bacteria. A MAJOR
More informationMolecular Evolution & the Origin of Variation
Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants
More informationMolecular Evolution & the Origin of Variation
Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants
More informationThe Science of Biology. Chapter 1
The Science of Biology Chapter 1 Properties of Life Living organisms: are composed of cells are complex and ordered respond to their environment can grow and reproduce obtain and use energy maintain internal
More informationCHAPTER 13 MEIOSIS AND SEXUAL LIFE CYCLES. Section A: An Introduction to Heredity
CHAPTER 13 MEIOSIS AND SEXUAL LIFE CYCLES Section A: An Introduction to Heredity 1. Offspring acquire genes from parents by inheriting chromosomes 2. Like begets like, more or less: a comparison of asexual
More informationValley Central School District 944 State Route 17K Montgomery, NY Telephone Number: (845) ext Fax Number: (845)
Valley Central School District 944 State Route 17K Montgomery, NY 12549 Telephone Number: (845)457-2400 ext. 18121 Fax Number: (845)457-4254 Advance Placement Biology Presented to the Board of Education
More information8/23/2014. Phylogeny and the Tree of Life
Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major
More informationCurriculum Links. AQA GCE Biology. AS level
Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2
More informationWhat can sequences tell us?
Bioinformatics What can sequences tell us? AGACCTGAGATAACCGATAC By themselves? Not a heck of a lot...* *Indeed, one of the key results learned from the Human Genome Project is that disease is much more
More informationPDF // IS BACTERIA A PROKARYOTE OR EUKARYOTE
19 January, 2018 PDF // IS BACTERIA A PROKARYOTE OR EUKARYOTE Document Filetype: PDF 222.61 KB 0 PDF // IS BACTERIA A PROKARYOTE OR EUKARYOTE How to Tell the Difference Between Prokaryotes and Eukaryotes.
More informationThis syllabus is based on 15 weeks (45 class periods), MWF.
Sample Syllabi for Chapters 1-15 of, by AM Campbell, L J Heyer, C J Paradise, focusing on the molecular, cellular and organismal levels of the biological hierarchy This syllabus is based on 15 weeks (45
More informationMolecular evolution - Part 1. Pawan Dhar BII
Molecular evolution - Part 1 Pawan Dhar BII Theodosius Dobzhansky Nothing in biology makes sense except in the light of evolution Age of life on earth: 3.85 billion years Formation of planet: 4.5 billion
More informationWhat do we mean by a species? Morphological species concept. Morphological species concept BIOL2007 SPECIES AND BIODIVERSITY. Kanchon Dasmahapatra
BIOL2007 SPECIES AND BIODIVERSITY Kanchon Dasmahapatra What are species? How do species differ from each other? Biodiversity: How many species are there? What do we mean by a species? Darwin proved species
More informationStudying Life. Lesson Overview. Lesson Overview. 1.3 Studying Life
Lesson Overview 1.3 Characteristics of Living Things What characteristics do all living things share? Living things are made up of basic units called cells, are based on a universal genetic code, obtain
More informationThe Microbial World. Chapter 5
The Microbial World Chapter 5 Viruses Non-cellular infectious agents that have two basic characteristics: Not capable of reproduction without a host cell Structure: Nucleic acid core- can be DNA or RNA
More informationVirginia Western Community College BIO 101 General Biology I
BIO 101 General Biology I Prerequisites Successful completion of MTE 1, 2, 3, 4, and 5; and a placement recommendation for ENG 111, co-enrollment in ENF 3/ENG 111, or successful completion of all developmental
More informationWest Windsor-Plainsboro Regional School District AP Biology Grades 11-12
West Windsor-Plainsboro Regional School District AP Biology Grades 11-12 Unit 1: Chemistry of Life Content Area: Science Course & Grade Level: AP Biology, 11 12 Summary and Rationale The structural levels
More informationBACTERIA AND ARCHAEA 10/15/2012
BACTERIA AND ARCHAEA Chapter 27 KEY CONCEPTS: Structural and functional adaptations contribute to prokaryotic success Rapid reproduction, mutation, and genetic recombination promote genetic diversity in
More informationBIOLOGY YEAR AT A GLANCE RESOURCE ( )
BIOLOGY YEAR AT A GLANCE RESOURCE (2016-17) DATES TOPIC/BENCHMARKS QUARTER 1 LAB/ACTIVITIES 8/22 8/25/16 I. Introduction to Biology Lab 1: Seed Germination A. What is Biology B. Science in the real world
More informationMap of AP-Aligned Bio-Rad Kits with Learning Objectives
Map of AP-Aligned Bio-Rad Kits with Learning Objectives Cover more than one AP Biology Big Idea with these AP-aligned Bio-Rad kits. Big Idea 1 Big Idea 2 Big Idea 3 Big Idea 4 ThINQ! pglo Transformation
More informationActivity Activity Title. Chapter Title Chapter Description Lesson Title Lesson Description Introduction to Living Things
Introduction to Living Things Students will explore the characteristics of living things, life cycles, stimuli and behavior, and how organisms maintain homeostasis. Characteristics of Living Things differentiate
More informationno.1 Raya Ayman Anas Abu-Humaidan
no.1 Raya Ayman Anas Abu-Humaidan Introduction to microbiology Let's start! As you might have concluded, microbiology is the study of all organisms that are too small to be seen with the naked eye, Ex:
More informationBIOLOGY YEAR AT A GLANCE RESOURCE ( ) REVISED FOR HURRICANE DAYS
BIOLOGY YEAR AT A GLANCE RESOURCE (2017-18) REVISED FOR HURRICANE DAYS DATES TOPIC/BENCHMARKS QUARTER 1 LAB/ACTIVITIES 8/21 8/24/17 I. Introduction to Biology A. What is Biology B. Science in the real
More informationFUNDAMENTALS OF MOLECULAR EVOLUTION
FUNDAMENTALS OF MOLECULAR EVOLUTION Second Edition Dan Graur TELAVIV UNIVERSITY Wen-Hsiung Li UNIVERSITY OF CHICAGO SINAUER ASSOCIATES, INC., Publishers Sunderland, Massachusetts Contents Preface xiii
More informationTaxonomy. Content. How to determine & classify a species. Phylogeny and evolution
Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature
More informationBig Idea 1: The process of evolution drives the diversity and unity of life.
Big Idea 1: The process of evolution drives the diversity and unity of life. understanding 1.A: Change in the genetic makeup of a population over time is evolution. 1.A.1: Natural selection is a major
More informationMiller & Levine Biology
A Correlation of To the Science Biology A Correlation of, 2014 to the, Table of Contents From Molecules to Organisms: Structures and Processes... 3 Ecosystems: Interactions, Energy, and Dynamics... 4 Heredity:
More informationAP Curriculum Framework with Learning Objectives
Big Ideas Big Idea 1: The process of evolution drives the diversity and unity of life. AP Curriculum Framework with Learning Objectives Understanding 1.A: Change in the genetic makeup of a population over
More informationCalifornia Subject Examinations for Teachers
California Subject Examinations for Teachers TEST GUIDE SCIENCE SUBTEST II: LIFE SCIENCES Subtest Description This document contains the Life Sciences subject matter requirements arranged according to
More informationTEACH EVOLUTION LEARN SCIENCE
TEACH EVOLUTION LEARN SCIENCE Why Evolution Education Matters The Federation of American Societies for Experimental Biology Evolution Education Matters Evolution is one of the most thoroughly studied and
More informationStudent Performance Q&A:
Student Performance Q&A: 2011 AP Biology Free-Response Questions The following comments on the 2011 free-response questions for AP Biology were written by the Chief Reader, John Lepri of the University
More informationBiology EOCT Review. Milton High School
Biology EOCT Review Milton High School Cell Organelles Nucleus holds DNA Cell membrane what comes in and goes out Mitochondria powerhouse of the cell Ribosomes protein synthesis Lysosomes digestion Cell
More informationPHYLOGENY AND SYSTEMATICS
AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study
More informationProtists: Molds Lecture 3 Spring 2014
Meet the Protists 1 Protists: Molds Lecture 3 Spring 2014 Domain Eukarya What unites them as a group? The Origin of Eukaryotic Cells Evolution of the endomembrane system Which organelles are included in
More informationProtists: Molds Lecture 3 Spring 2014
Protists: Molds Lecture 3 Spring 2014 Meet the Protists 1 Domain Eukarya What unites them as a group? The Origin of Eukaryotic Cells 2 Evolution of the endomembrane system Which organelles are included
More information2 A single allele that controls more than one character is said to be. A. linked B. photogenic C. pleiotropic D. Polygenic E.
Bio101 Sample Questions_Exam 5 1 Flower color in snapdragons is an example of incomplete dominance. If a red-flowered plant is crossed with a white-flowered plant, the F 1 generation has pink flowers.
More informationSection 18-1 Finding Order in Diversity
Name Class Date Section 18-1 Finding Order in Diversity (pages 447-450) Key Concepts How are living things organized for study? What is binomial nomenclature? What is Linnaeus s system of classification?
More informationSPRING GROVE AREA SCHOOL DISTRICT. Course Description. Instructional Strategies, Learning Practices, Activities, and Experiences.
SPRING GROVE AREA SCHOOL DISTRICT PLANNED COURSE OVERVIEW Course Title: Advanced Placement Biology Grade Level(s): 12 Units of Credit: 1.50 Classification: Elective Length of Course: 30 cycles Periods
More informationThe Prokaryotic World
The Prokaryotic World A. An overview of prokaryotic life There is no doubt that prokaryotes are everywhere. By everywhere, I mean living in every geographic region, in extremes of environmental conditions,
More information