HORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS

Size: px
Start display at page:

Download "HORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS"

Transcription

1 HORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS

2 OVERVIEW INTRODUCTION MECHANISMS OF HGT IDENTIFICATION TECHNIQUES EXAMPLES - Wolbachia pipientis - Fungus - Plants - Drosophila ananassae - You are what you eat RELEVANCE AND CONTROVERSY CONCLUSIONS REFERENCES

3 INTRODUCTION Biological evolution proceeds from ancestry to descendants with modifications (Darwin) à Non-anastomosing phylogenetic trees Horizontal Gene Transfer (HGT) refers to the transfer of genes between organisms. It leads to evolutionary reticulations à Anastomosing phylogenetic trees Acquisition of foreign genes (evolutionary potential) Prokaryotes Eukaryotes Unicellular Multicellular

4 Wijayawardena et al. (2013)

5 MECHANISMS Donor and recipient must have a close relationship Phagocytosis/symbiosis (Mitochondria and plastids) Parasitism Mobile genetic elements Plasmids Viruses Transposable elements (TEs) The foreign genetic material has to successfully integrate into the germline Evasion of immune system, nucleases and proteases Genomic compatibility Population genetic processes: mutation, natural selection, genetic flow and genetic drift

6 Wijayawardena et al. (2013)

7 DETECTION TECHNIQUES Phylogenetic methods: Incongruence Phylogenetic-independent methods Codon-based approaches BLAST Wijayawardena et al. (2013) PCR- based approaches Fluorescent in situ hybridization (FISH), Southern, comparisons of protein structures, Chromosome/genome walking Comparative genome studies Biogeographical and ecological data COMBINATION!

8 PROKARYOTE! EUKARYOTE The presence of endosymbionts Wolbachia pipientis, within some eukaryotic germlines may facilitate bacterial gene transfers to eukaryotic host genomes. Transfers into the genomes of four insect and four nematode. Verified by molecular techniques as FISH in a Drosophila chromosome using a probe for a Wolbachia gene. Hotopp et al. (2007)

9 EUKARYOTE! EUKARYOTE Stagonospora nodorum ToxA Pyrenophora tritici-repentis The gene has not been found in closely related species. The mechanism of transfer could be related with the fusion of hyphae, the nucleuses were very close and the transfer took place. Sanders et al. (2006)

10 EUKARYOTE! EUKARYOTE Plant mitochondria genomes experience frequent horizontal transfer of genes. Mitochondria à Mitochondria Active DNA uptake system but no such system is known in plastids (propensity to fuse). Pseudogenes vs. functional genes Amborella trichopoda: massive HGT (20 of the 30 mitochondrial genes) à special opportunities for studying the evolutionary dynamics of HGT at the populations level. Richardson et al. (2006)

11 EUKARYOTE! EUKARYOTE Many TEs have been horizontally transferred among Drosophila species. Hundred-one events of HT have been proposed in Drosophila for 21 different elements: 5% non-ltr 42,6% LTR 52,4% DNA transposons The mechanism of HT vary from very simple ones, such a direct transfer (LTR), to more complex systems involving intermediate vectors. TEs-rich regions are specially prone to HGT, what suggests a functional role for TEs. Loreto et al. (2008)

12 Loreto et al. (2008)

13 YOU ARE WHAT YOU EAT, WHAT YOU LIVE ON, WHAT LIVES ON YOU, AND WHAT LIVES IN YOU Keeling et al. (2008)

14 RELEVANCE AND CONTROVERSY RELEVANCE: History of eukaryotic evolution (information) It may provide genes of novel function to the recipient genome The whole acquisition of intact genes and/or regulatory regions may allow species to evolve genes. Important contributor to genomic diversity. CONTROVERSY: Role of HGT? Vectors, donors and recipients? Unknown mechanisms Insufficient methodologies

15 CONCLUSIONS 1. HGT forms anastomosing phylogenetic trees. 2. The HGT has evolutionary potential because it allows the acquisition of foreign genes (generation of new biological diversity). 3. HGT is more frequent in prokaryotes but it also occurs in eukaryotes, where plays a more important role than it was though. 4. Transferred gene evolves according to the population genetic factors. 5. Detection techniques must be combined in order to detect the presence of HGT with no mistake. 6. The range of eukaryotic organisms subjected to HGT is really high. 7. Several behaviours and life-styles can enhance HGT.

16 REFERENCES Hotopp JC et al Widespread lateral gene transfer from intracellular bacteria to multicellular eukaryotes. Science. 317(5845): Keeling PJ, Palmer JD Horizontal transfer in eukaryotic evolution. Nat Rev Genet. 9(8): Review. Loreto EL, Carareto CM, Capy P Revisiting horizontal transfer of transposable elements in Drosophila. Heredity. 100(6): Richardson AO, Palmer JD Horizontal transfer in plants. J Exp Bot. 58(1):1-9. Sanders IR Rapid disease emergence through horizontal gene transfer between eukaryotes. Trends Ecology Evolut. 21: Wijayawardena BK, Minchella DJ, DeWoody JA Hosts, parasites, and horizontal gene transfer. Trends Parasitol.29(7):

17 THANK YOU FOR YOUR ATTENTION KIMBERLEY MC GRAIL FERNÁNDEZ

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17. Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:

More information

Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p.

Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p. READING: 14.2 Bacterial Genomes p. 481 14.3 Gene Transfer Mechanisms in Bacteria p. 486 Suggested Problems: 1, 7, 13, 14, 15, 20, 22 BACTERIAL GENETICS AND GENOMICS We still consider the E. coli genome

More information

A DNA Sequence 2017/12/6 1

A DNA Sequence 2017/12/6 1 A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta

More information

Principles of Genetics

Principles of Genetics Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics

More information

Chapters AP Biology Objectives. Objectives: You should know...

Chapters AP Biology Objectives. Objectives: You should know... Objectives: You should know... Notes 1. Scientific evidence supports the idea that evolution has occurred in all species. 2. Scientific evidence supports the idea that evolution continues to occur. 3.

More information

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/1/18

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/1/18 Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection

More information

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16 Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection

More information

Origins of Life. Fundamental Properties of Life. Conditions on Early Earth. Evolution of Cells. The Tree of Life

Origins of Life. Fundamental Properties of Life. Conditions on Early Earth. Evolution of Cells. The Tree of Life The Tree of Life Chapter 26 Origins of Life The Earth formed as a hot mass of molten rock about 4.5 billion years ago (BYA) -As it cooled, chemically-rich oceans were formed from water condensation Life

More information

Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.

Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible. Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional

More information

Microbial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.

Microbial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; fast- clock molecules for fine-structure. Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional

More information

Biology 112 Practice Midterm Questions

Biology 112 Practice Midterm Questions Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,

More information

A. Correct! Taxonomy is the science of classification. B. Incorrect! Taxonomy is the science of classification.

A. Correct! Taxonomy is the science of classification. B. Incorrect! Taxonomy is the science of classification. DAT - Problem Drill 07: Diversity of Life Question No. 1 of 10 Instructions: (1) Read the problem and answer choices carefully, (2) Work the problems on paper as 1. What is taxonomy? Question #01 (A) Taxonomy

More information

BIOLOGY Grades Summer Units: 10 high school credits UC Requirement Category: d. General Description:

BIOLOGY Grades Summer Units: 10 high school credits UC Requirement Category: d. General Description: Summer 2015 Units: 10 high school credits UC Requirement Category: d General Description: BIOLOGY Grades 9-12 Summer session biology will be an intense, fast paced course. Students will gain an understanding

More information

Genomes and Their Evolution

Genomes and Their Evolution Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

Evaluate evidence provided by data from many scientific disciplines to support biological evolution. [LO 1.9, SP 5.3]

Evaluate evidence provided by data from many scientific disciplines to support biological evolution. [LO 1.9, SP 5.3] Learning Objectives Evaluate evidence provided by data from many scientific disciplines to support biological evolution. [LO 1.9, SP 5.3] Refine evidence based on data from many scientific disciplines

More information

Miller & Levine Biology 2014

Miller & Levine Biology 2014 A Correlation of Miller & Levine Biology To the Essential Standards for Biology High School Introduction This document demonstrates how meets the North Carolina Essential Standards for Biology, grades

More information

Genetic Basis of Variation in Bacteria

Genetic Basis of Variation in Bacteria Mechanisms of Infectious Disease Fall 2009 Genetics I Jonathan Dworkin, PhD Department of Microbiology jonathan.dworkin@columbia.edu Genetic Basis of Variation in Bacteria I. Organization of genetic material

More information

Wolbachia PCR: Discover the Microbes Within!

Wolbachia PCR: Discover the Microbes Within! Wolbachia PCR: Discover the Microbes Within! Overview of the Wolbachia Lab Insect identification DNA extraction PCR? Wolbachia lecture Bioinformatics ACAGATGTC TTGTAATCCG GCCGTTGGT GGCATAGGG AAAGGACAT

More information

Chapter Chemical Uniqueness 1/23/2009. The Uses of Principles. Zoology: the Study of Animal Life. Fig. 1.1

Chapter Chemical Uniqueness 1/23/2009. The Uses of Principles. Zoology: the Study of Animal Life. Fig. 1.1 Fig. 1.1 Chapter 1 Life: Biological Principles and the Science of Zoology BIO 2402 General Zoology Copyright The McGraw Hill Companies, Inc. Permission required for reproduction or display. The Uses of

More information

COMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry.

COMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry. North Carolina Draft Standard Course of Study and Grade Level Competencies, Biology BIOLOGY COMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry. 1.01

More information

Bacterial Genetics & Operons

Bacterial Genetics & Operons Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the

More information

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG

More information

Text of objective. Investigate and describe the structure and functions of cells including: Cell organelles

Text of objective. Investigate and describe the structure and functions of cells including: Cell organelles This document is designed to help North Carolina educators teach the s (Standard Course of Study). NCDPI staff are continually updating and improving these tools to better serve teachers. Biology 2009-to-2004

More information

Microbial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.

Microbial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible. Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional

More information

Chapter 27: Bacteria and Archaea

Chapter 27: Bacteria and Archaea Name Period Overview 1. The chapter opens with amazing tales of life at the extreme edge. What are the masters of adaptation? Describe the one case you thought most dramatic. Concept 27.1 Structural and

More information

Readings Lecture Topics Class Activities Labs Projects Chapter 1: Biology 6 th ed. Campbell and Reese Student Selected Magazine Article

Readings Lecture Topics Class Activities Labs Projects Chapter 1: Biology 6 th ed. Campbell and Reese Student Selected Magazine Article Unit Subtopics and Duration Unit 1: Principles of Science Themes in science Research and Lab techniques 6 days Readings Lecture Topics Class Activities Labs Projects Chapter 1: Biology 6 th ed. Campbell

More information

Intro to Prokaryotes Lecture 1 Spring 2014

Intro to Prokaryotes Lecture 1 Spring 2014 Intro to Prokaryotes Lecture 1 Spring 2014 Meet the Prokaryotes 1 Meet the Prokaryotes 2 Meet the Prokaryotes 3 Why study prokaryotes? Deep Time 4 Fig. 25.7 Fossilized stromatolite (above) and living stromatolite

More information

Chapter 26 Phylogeny and the Tree of Life

Chapter 26 Phylogeny and the Tree of Life Chapter 26 Phylogeny and the Tree of Life Chapter focus Shifting from the process of how evolution works to the pattern evolution produces over time. Phylogeny Phylon = tribe, geny = genesis or origin

More information

ORIGIN OF CELLULARITY AND CELLULAR DIVERSITY

ORIGIN OF CELLULARITY AND CELLULAR DIVERSITY ORIGIN OF CELLULARITY AND CELLULAR DIVERSITY Geological stratigraphy, together with radioactive dating, show the sequence of events in the history of the Earth. Note the entry for cyanobacteria and stromatolites

More information

AP Biology Exam #7 (PRACTICE) Subunit #7: Diversity of Life

AP Biology Exam #7 (PRACTICE) Subunit #7: Diversity of Life AP Biology Exam #7 (PRACTICE) Subunit #7: Diversity of Life Multiple Choice Questions: Choose the best answer then bubble your answer on your scantron sheet. 1. Armadillos and spiny anteaters are not related.

More information

Chapter 18 Active Reading Guide Genomes and Their Evolution

Chapter 18 Active Reading Guide Genomes and Their Evolution Name: AP Biology Mr. Croft Chapter 18 Active Reading Guide Genomes and Their Evolution Most AP Biology teachers think this chapter involves an advanced topic. The questions posed here will help you understand

More information

Fundamentals of Biology Valencia College BSC1010C

Fundamentals of Biology Valencia College BSC1010C 1 Fundamentals of Biology Valencia College BSC1010C 1 Studying Life Chapter objectives: What Is Biology? Is All Life on Earth Related? How Do Biologists Investigate Life? How Does Biology Influence Public

More information

Horizontal transfer and pathogenicity

Horizontal transfer and pathogenicity Horizontal transfer and pathogenicity Victoria Moiseeva Genomics, Master on Advanced Genetics UAB, Barcelona, 2014 INDEX Horizontal Transfer Horizontal gene transfer mechanisms Detection methods of HGT

More information

Guided Notes: Evolution. is the change in traits through generations over! Occurs in, NOT individual organisms

Guided Notes: Evolution. is the change in traits through generations over! Occurs in, NOT individual organisms Guided Notes: Evolution The Theory of Evolution is the change in traits through generations over! Occurs in, NOT individual organisms How Have Organisms Changed? At the time life emerged, the Earth was

More information

2. What was the Avery-MacLeod-McCarty experiment and why was it significant? 3. What was the Hershey-Chase experiment and why was it significant?

2. What was the Avery-MacLeod-McCarty experiment and why was it significant? 3. What was the Hershey-Chase experiment and why was it significant? Name Date Period AP Exam Review Part 6: Molecular Genetics I. DNA and RNA Basics A. History of finding out what DNA really is 1. What was Griffith s experiment and why was it significant? 1 2. What was

More information

Chapter 1 Biology 103

Chapter 1 Biology 103 Chapter 1 Biology 103 Properties of Life Living organisms: are composed of cells are complex and ordered respond to their environment can grow and reproduce obtain and use energy maintain internal balance

More information

9/8/2017. Bacteria and Archaea. Three domain system: The present tree of life. Structural and functional adaptations contribute to prokaryotic success

9/8/2017. Bacteria and Archaea. Three domain system: The present tree of life. Structural and functional adaptations contribute to prokaryotic success 5 m 2 m 9/8/2017 Three domain system: The present tree of life Bacteria and Archaea Chapter 27 Structural and functional adaptations contribute to prokaryotic success Unicellular Small Variety of shapes

More information

Frequently Asked Questions (FAQs)

Frequently Asked Questions (FAQs) Frequently Asked Questions (FAQs) Q1. What is meant by Satellite and Repetitive DNA? Ans: Satellite and repetitive DNA generally refers to DNA whose base sequence is repeated many times throughout the

More information

Introduction to Molecular and Cell Biology

Introduction to Molecular and Cell Biology Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What

More information

Bio 119 Bacterial Genomics 6/26/10

Bio 119 Bacterial Genomics 6/26/10 BACTERIAL GENOMICS Reading in BOM-12: Sec. 11.1 Genetic Map of the E. coli Chromosome p. 279 Sec. 13.2 Prokaryotic Genomes: Sizes and ORF Contents p. 344 Sec. 13.3 Prokaryotic Genomes: Bioinformatic Analysis

More information

Microbial Taxonomy and the Evolution of Diversity

Microbial Taxonomy and the Evolution of Diversity 19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy

More information

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology 2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the

More information

I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes.

I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes. I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes. A. Chemistry of Life B. Cells 1. Water How do the unique chemical

More information

AP Biology. Read college-level text for understanding and be able to summarize main concepts

AP Biology. Read college-level text for understanding and be able to summarize main concepts St. Mary's College AP Biology Continuity and Change Consider how specific changes to an ecosystem (geological, climatic, introduction of new organisms, etc.) can affect the organisms that live within it.

More information

CHAPTER : Prokaryotic Genetics

CHAPTER : Prokaryotic Genetics CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering

More information

Bio 1B Lecture Outline (please print and bring along) Fall, 2007

Bio 1B Lecture Outline (please print and bring along) Fall, 2007 Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution

More information

GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H*" ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION

GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H* ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION FIFTH EDITION IV I ^HHk ^ttm IZTI/^Q i I II MPHBBMWBBIHB '-llwmpbi^hbwm^^pfc ' GSBHSRSBRSRRk LlML I I \l 1MB ^HP'^^MMMP" jflp^^^^^^^^st I Iv^O FROM GENES TO GENOMES %^MiM^PM^^MWi99Mi$9i0^^ ^^^^^^^^^^^^^V^^^fii^^t^i^^^^^

More information

I. Molecules & Cells. A. Unit One: The Nature of Science. B. Unit Two: The Chemistry of Life. C. Unit Three: The Biology of the Cell.

I. Molecules & Cells. A. Unit One: The Nature of Science. B. Unit Two: The Chemistry of Life. C. Unit Three: The Biology of the Cell. I. Molecules & Cells A. Unit One: The Nature of Science a. How is the scientific method used to solve problems? b. What is the importance of controls? c. How does Darwin s theory of evolution illustrate

More information

VCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design

VCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design VCE BIOLOGY 2006 2014 Relationship between the key knowledge and key skills of the 2000 2005 Study Design and the 2006 2014 Study Design The following table provides a comparison of the key knowledge (and

More information

Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p

Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p.110-114 Arrangement of information in DNA----- requirements for RNA Common arrangement of protein-coding genes in prokaryotes=

More information

AP Biology Review Packet 5- Natural Selection and Evolution & Speciation and Phylogeny

AP Biology Review Packet 5- Natural Selection and Evolution & Speciation and Phylogeny AP Biology Review Packet 5- Natural Selection and Evolution & Speciation and Phylogeny 1A1- Natural selection is a major mechanism of evolution. 1A2: Natural selection acts on phenotypic variations in

More information

Origin of Sexual Reproduction

Origin of Sexual Reproduction Origin of Sexual Reproduction Lukas Schärer! Evolutionary Biology Zoological Institute University of Basel 1 11.10.2017 Advanced-level Evolutionary Biology What is sexual reproduction? 2 from various websites

More information

1. The basic structural and physiological unit of all living organisms is the A) aggregate. B) organelle. C) organism. D) membrane. E) cell.

1. The basic structural and physiological unit of all living organisms is the A) aggregate. B) organelle. C) organism. D) membrane. E) cell. Name: Date: Test File Questions 1. The basic structural and physiological unit of all living organisms is the A) aggregate. B) organelle. C) organism. D) membrane. E) cell. 2. A cell A) can be composed

More information

TE content correlates positively with genome size

TE content correlates positively with genome size TE content correlates positively with genome size Mb 3000 Genomic DNA 2500 2000 1500 1000 TE DNA Protein-coding DNA 500 0 Feschotte & Pritham 2006 Transposable elements. Variation in gene numbers cannot

More information

Ch 10. Classification of Microorganisms

Ch 10. Classification of Microorganisms Ch 10 Classification of Microorganisms Student Learning Outcomes Define taxonomy, taxon, and phylogeny. List the characteristics of the Bacteria, Archaea, and Eukarya domains. Differentiate among eukaryotic,

More information

Microbiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms

Microbiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms 1 2 Bergey s Manual of Systematic Bacteriology differs from Bergey s Manual of Determinative Bacteriology in that the former a. groups bacteria into species. b. groups bacteria according to phylogenetic

More information

Modern cellular organisms. From

Modern cellular organisms. From Modern cellular organisms From http://www.ucmp.berkeley.edu/exhibit/phylogeny.html Endothelial cell Lysosomes, mitochondria and nucleus See the cellular cytoskeleton, ER and nucleus Modern cells are complex

More information

3) What are the names of the SIX kingdoms? Next to each one, write whether it is prokaryotic or Eukaryotic

3) What are the names of the SIX kingdoms? Next to each one, write whether it is prokaryotic or Eukaryotic Topic #1: Taxonomy 1) What is taxonomy? system of naming and classifying organisms 2) Name the eight levels of taxonomic categories, starting with the most general and ending with the most specific. Domain,

More information

Introduction to Bioinformatics Integrated Science, 11/9/05

Introduction to Bioinformatics Integrated Science, 11/9/05 1 Introduction to Bioinformatics Integrated Science, 11/9/05 Morris Levy Biological Sciences Research: Evolutionary Ecology, Plant- Fungal Pathogen Interactions Coordinator: BIOL 495S/CS490B/STAT490B Introduction

More information

13.1 Biological Classification - Kingdoms and Domains Modern species are divided into three large groups, or domains. Bacteria Archaea Eukarya

13.1 Biological Classification - Kingdoms and Domains Modern species are divided into three large groups, or domains. Bacteria Archaea Eukarya Chapter 13 Prospecting for Biological Gold Biodiversity and Classification 13.1 Biological Classification- How Many Species Exist? Biodiversity is the variety within and among living species Number of

More information

NOTES Ch 17: Genes and. Variation

NOTES Ch 17: Genes and. Variation NOTES Ch 17: Genes and Vocabulary Fitness Genetic Drift Punctuated Equilibrium Gene flow Adaptive radiation Divergent evolution Convergent evolution Gradualism Variation 17.1 Genes & Variation Darwin developed

More information

SPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES.

SPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES. THE TERMS RUN AND TUMBLE ARE GENERALLY ASSOCIATED WITH A) cell wall fluidity. B) cell membrane structures. C) taxic movements of the cell. D) clustering properties of certain rod-shaped bacteria. A MAJOR

More information

Molecular Evolution & the Origin of Variation

Molecular Evolution & the Origin of Variation Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants

More information

Molecular Evolution & the Origin of Variation

Molecular Evolution & the Origin of Variation Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants

More information

The Science of Biology. Chapter 1

The Science of Biology. Chapter 1 The Science of Biology Chapter 1 Properties of Life Living organisms: are composed of cells are complex and ordered respond to their environment can grow and reproduce obtain and use energy maintain internal

More information

CHAPTER 13 MEIOSIS AND SEXUAL LIFE CYCLES. Section A: An Introduction to Heredity

CHAPTER 13 MEIOSIS AND SEXUAL LIFE CYCLES. Section A: An Introduction to Heredity CHAPTER 13 MEIOSIS AND SEXUAL LIFE CYCLES Section A: An Introduction to Heredity 1. Offspring acquire genes from parents by inheriting chromosomes 2. Like begets like, more or less: a comparison of asexual

More information

Valley Central School District 944 State Route 17K Montgomery, NY Telephone Number: (845) ext Fax Number: (845)

Valley Central School District 944 State Route 17K Montgomery, NY Telephone Number: (845) ext Fax Number: (845) Valley Central School District 944 State Route 17K Montgomery, NY 12549 Telephone Number: (845)457-2400 ext. 18121 Fax Number: (845)457-4254 Advance Placement Biology Presented to the Board of Education

More information

8/23/2014. Phylogeny and the Tree of Life

8/23/2014. Phylogeny and the Tree of Life Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major

More information

Curriculum Links. AQA GCE Biology. AS level

Curriculum Links. AQA GCE Biology. AS level Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2

More information

What can sequences tell us?

What can sequences tell us? Bioinformatics What can sequences tell us? AGACCTGAGATAACCGATAC By themselves? Not a heck of a lot...* *Indeed, one of the key results learned from the Human Genome Project is that disease is much more

More information

PDF // IS BACTERIA A PROKARYOTE OR EUKARYOTE

PDF // IS BACTERIA A PROKARYOTE OR EUKARYOTE 19 January, 2018 PDF // IS BACTERIA A PROKARYOTE OR EUKARYOTE Document Filetype: PDF 222.61 KB 0 PDF // IS BACTERIA A PROKARYOTE OR EUKARYOTE How to Tell the Difference Between Prokaryotes and Eukaryotes.

More information

This syllabus is based on 15 weeks (45 class periods), MWF.

This syllabus is based on 15 weeks (45 class periods), MWF. Sample Syllabi for Chapters 1-15 of, by AM Campbell, L J Heyer, C J Paradise, focusing on the molecular, cellular and organismal levels of the biological hierarchy This syllabus is based on 15 weeks (45

More information

Molecular evolution - Part 1. Pawan Dhar BII

Molecular evolution - Part 1. Pawan Dhar BII Molecular evolution - Part 1 Pawan Dhar BII Theodosius Dobzhansky Nothing in biology makes sense except in the light of evolution Age of life on earth: 3.85 billion years Formation of planet: 4.5 billion

More information

What do we mean by a species? Morphological species concept. Morphological species concept BIOL2007 SPECIES AND BIODIVERSITY. Kanchon Dasmahapatra

What do we mean by a species? Morphological species concept. Morphological species concept BIOL2007 SPECIES AND BIODIVERSITY. Kanchon Dasmahapatra BIOL2007 SPECIES AND BIODIVERSITY Kanchon Dasmahapatra What are species? How do species differ from each other? Biodiversity: How many species are there? What do we mean by a species? Darwin proved species

More information

Studying Life. Lesson Overview. Lesson Overview. 1.3 Studying Life

Studying Life. Lesson Overview. Lesson Overview. 1.3 Studying Life Lesson Overview 1.3 Characteristics of Living Things What characteristics do all living things share? Living things are made up of basic units called cells, are based on a universal genetic code, obtain

More information

The Microbial World. Chapter 5

The Microbial World. Chapter 5 The Microbial World Chapter 5 Viruses Non-cellular infectious agents that have two basic characteristics: Not capable of reproduction without a host cell Structure: Nucleic acid core- can be DNA or RNA

More information

Virginia Western Community College BIO 101 General Biology I

Virginia Western Community College BIO 101 General Biology I BIO 101 General Biology I Prerequisites Successful completion of MTE 1, 2, 3, 4, and 5; and a placement recommendation for ENG 111, co-enrollment in ENF 3/ENG 111, or successful completion of all developmental

More information

West Windsor-Plainsboro Regional School District AP Biology Grades 11-12

West Windsor-Plainsboro Regional School District AP Biology Grades 11-12 West Windsor-Plainsboro Regional School District AP Biology Grades 11-12 Unit 1: Chemistry of Life Content Area: Science Course & Grade Level: AP Biology, 11 12 Summary and Rationale The structural levels

More information

BACTERIA AND ARCHAEA 10/15/2012

BACTERIA AND ARCHAEA 10/15/2012 BACTERIA AND ARCHAEA Chapter 27 KEY CONCEPTS: Structural and functional adaptations contribute to prokaryotic success Rapid reproduction, mutation, and genetic recombination promote genetic diversity in

More information

BIOLOGY YEAR AT A GLANCE RESOURCE ( )

BIOLOGY YEAR AT A GLANCE RESOURCE ( ) BIOLOGY YEAR AT A GLANCE RESOURCE (2016-17) DATES TOPIC/BENCHMARKS QUARTER 1 LAB/ACTIVITIES 8/22 8/25/16 I. Introduction to Biology Lab 1: Seed Germination A. What is Biology B. Science in the real world

More information

Map of AP-Aligned Bio-Rad Kits with Learning Objectives

Map of AP-Aligned Bio-Rad Kits with Learning Objectives Map of AP-Aligned Bio-Rad Kits with Learning Objectives Cover more than one AP Biology Big Idea with these AP-aligned Bio-Rad kits. Big Idea 1 Big Idea 2 Big Idea 3 Big Idea 4 ThINQ! pglo Transformation

More information

Activity Activity Title. Chapter Title Chapter Description Lesson Title Lesson Description Introduction to Living Things

Activity Activity Title. Chapter Title Chapter Description Lesson Title Lesson Description Introduction to Living Things Introduction to Living Things Students will explore the characteristics of living things, life cycles, stimuli and behavior, and how organisms maintain homeostasis. Characteristics of Living Things differentiate

More information

no.1 Raya Ayman Anas Abu-Humaidan

no.1 Raya Ayman Anas Abu-Humaidan no.1 Raya Ayman Anas Abu-Humaidan Introduction to microbiology Let's start! As you might have concluded, microbiology is the study of all organisms that are too small to be seen with the naked eye, Ex:

More information

BIOLOGY YEAR AT A GLANCE RESOURCE ( ) REVISED FOR HURRICANE DAYS

BIOLOGY YEAR AT A GLANCE RESOURCE ( ) REVISED FOR HURRICANE DAYS BIOLOGY YEAR AT A GLANCE RESOURCE (2017-18) REVISED FOR HURRICANE DAYS DATES TOPIC/BENCHMARKS QUARTER 1 LAB/ACTIVITIES 8/21 8/24/17 I. Introduction to Biology A. What is Biology B. Science in the real

More information

FUNDAMENTALS OF MOLECULAR EVOLUTION

FUNDAMENTALS OF MOLECULAR EVOLUTION FUNDAMENTALS OF MOLECULAR EVOLUTION Second Edition Dan Graur TELAVIV UNIVERSITY Wen-Hsiung Li UNIVERSITY OF CHICAGO SINAUER ASSOCIATES, INC., Publishers Sunderland, Massachusetts Contents Preface xiii

More information

Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution

Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature

More information

Big Idea 1: The process of evolution drives the diversity and unity of life.

Big Idea 1: The process of evolution drives the diversity and unity of life. Big Idea 1: The process of evolution drives the diversity and unity of life. understanding 1.A: Change in the genetic makeup of a population over time is evolution. 1.A.1: Natural selection is a major

More information

Miller & Levine Biology

Miller & Levine Biology A Correlation of To the Science Biology A Correlation of, 2014 to the, Table of Contents From Molecules to Organisms: Structures and Processes... 3 Ecosystems: Interactions, Energy, and Dynamics... 4 Heredity:

More information

AP Curriculum Framework with Learning Objectives

AP Curriculum Framework with Learning Objectives Big Ideas Big Idea 1: The process of evolution drives the diversity and unity of life. AP Curriculum Framework with Learning Objectives Understanding 1.A: Change in the genetic makeup of a population over

More information

California Subject Examinations for Teachers

California Subject Examinations for Teachers California Subject Examinations for Teachers TEST GUIDE SCIENCE SUBTEST II: LIFE SCIENCES Subtest Description This document contains the Life Sciences subject matter requirements arranged according to

More information

TEACH EVOLUTION LEARN SCIENCE

TEACH EVOLUTION LEARN SCIENCE TEACH EVOLUTION LEARN SCIENCE Why Evolution Education Matters The Federation of American Societies for Experimental Biology Evolution Education Matters Evolution is one of the most thoroughly studied and

More information

Student Performance Q&A:

Student Performance Q&A: Student Performance Q&A: 2011 AP Biology Free-Response Questions The following comments on the 2011 free-response questions for AP Biology were written by the Chief Reader, John Lepri of the University

More information

Biology EOCT Review. Milton High School

Biology EOCT Review. Milton High School Biology EOCT Review Milton High School Cell Organelles Nucleus holds DNA Cell membrane what comes in and goes out Mitochondria powerhouse of the cell Ribosomes protein synthesis Lysosomes digestion Cell

More information

PHYLOGENY AND SYSTEMATICS

PHYLOGENY AND SYSTEMATICS AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study

More information

Protists: Molds Lecture 3 Spring 2014

Protists: Molds Lecture 3 Spring 2014 Meet the Protists 1 Protists: Molds Lecture 3 Spring 2014 Domain Eukarya What unites them as a group? The Origin of Eukaryotic Cells Evolution of the endomembrane system Which organelles are included in

More information

Protists: Molds Lecture 3 Spring 2014

Protists: Molds Lecture 3 Spring 2014 Protists: Molds Lecture 3 Spring 2014 Meet the Protists 1 Domain Eukarya What unites them as a group? The Origin of Eukaryotic Cells 2 Evolution of the endomembrane system Which organelles are included

More information

2 A single allele that controls more than one character is said to be. A. linked B. photogenic C. pleiotropic D. Polygenic E.

2 A single allele that controls more than one character is said to be. A. linked B. photogenic C. pleiotropic D. Polygenic E. Bio101 Sample Questions_Exam 5 1 Flower color in snapdragons is an example of incomplete dominance. If a red-flowered plant is crossed with a white-flowered plant, the F 1 generation has pink flowers.

More information

Section 18-1 Finding Order in Diversity

Section 18-1 Finding Order in Diversity Name Class Date Section 18-1 Finding Order in Diversity (pages 447-450) Key Concepts How are living things organized for study? What is binomial nomenclature? What is Linnaeus s system of classification?

More information

SPRING GROVE AREA SCHOOL DISTRICT. Course Description. Instructional Strategies, Learning Practices, Activities, and Experiences.

SPRING GROVE AREA SCHOOL DISTRICT. Course Description. Instructional Strategies, Learning Practices, Activities, and Experiences. SPRING GROVE AREA SCHOOL DISTRICT PLANNED COURSE OVERVIEW Course Title: Advanced Placement Biology Grade Level(s): 12 Units of Credit: 1.50 Classification: Elective Length of Course: 30 cycles Periods

More information

The Prokaryotic World

The Prokaryotic World The Prokaryotic World A. An overview of prokaryotic life There is no doubt that prokaryotes are everywhere. By everywhere, I mean living in every geographic region, in extremes of environmental conditions,

More information