Mole_Oce Lecture # 24: Introduction to genomics

Size: px
Start display at page:

Download "Mole_Oce Lecture # 24: Introduction to genomics"

Transcription

1 Mole_Oce Lecture # 24: Introduction to genomics

2 DEFINITION: Genomics: the study of genomes or he study of genes and their function. Genomics (1980s):The systematic generation of information about genes and genomes Functional genomics:the systematic generation and analysis of information about what genes do. The omics are a la mode : transcriptomics, proteomics, peptidomics, metabolomics, ecogenomics, toxicogenomics, pharmacogenomics, etc

3 Bio-informatics Structural genomics -DNA sequences (nucleotide order) -gene structure (predicted or from genomecdna comparison) (gene discovery) -gene organization (gene order,chromosomal localization; mapping) -chromosomal organization -genome structure -macrovariation (gene complement,diversity; genome organization) -microvariation interspecific -microvariation intraspecific (polymorphisms) -regulatory sequences -inter-genic regions -repetitive elements,mobile elements Functional genomics -gene regulation -expression of RNA (measured via cdna) -known versus unknown ( gene discovery ) -microarray (cdna vs.oligo)versus other methods -proteomics -protein function (high-throughput analysis of e.g.protein-protein interactions)? -structural biology (structure-function relationships) -gene pathways and networks and their regulation -effects of gene deletion (knock-out,knockdown,saturation mutagenesis)

4 Organisms are networks of genes, which make networks of proteins, which regulate genes, and so on ad infinitum In genomics, one try to escape the reductionist approaches that focus on the component part. The new challenge is to analyze all the components at once. Genomics allow also a constant cross-fertilization between genome-wide studies and more focused studies. The biologists enter into an new landscape of data. For the first time in Biology, data acquisition predate the analysis of data. Data are a new motor of innovation.

5 6000 genes 19,000 genes 13,600 genes

6 The C-value paradox: why would ma ny geno mes have vast amounts of extra DNA considering the actual inf ormational needs of the organism? C-value ranges over fold!! Some amoeba have 200 times more DNA than us.. The PARADOX: Why would many genomes have vast amounts of extra DNA considering the actual informational needs of the organism?

7 The adaptive versus junk DNA theories: The adaptive theories postulate an adaptive function for this extra DNA given that DNA abundance, rather than its information content, can have a direct and significant effect on phenotype. For instance, a larger genome size could be adaptive because it directly or indirectly increases nuclear and cellular volumes, helps to buffer fluctuations in the concentration of regulatory proteins, or protects coding DNA from mutation. According to these hypotheses, the observed variation in genome size reflects different adaptive needs or the efficacy of The adaptive theories natural postulate selection an adaptive in different function organisms. for this extra DNA given that DNA abundance, rather than its information content, can have a direct and significant effect on phenotype According to the junk DNA or the selfish DNA - theories, purifying selection against the accumulation of useless DNA is often not strong enough completely to counteract the steady stream of DNA addition through transposition and pseudogene formation. The final genome size is then set at the highest tolerable maximum which depends on the particular ecological and developmental needs of the organism

8 The forces affecting genome-size evolution. DNA-length mutants are created through a variety of mechanisms shown at the top, producing mutational pressure either to expand or contract the genome size. Some of these mutations affect the phenotype and undergo natural selection. Some might have negligible selective effects and are governed primarily by genetic drift. The combined interplay of all these forces affects genome size.

9 Transposition rates are generally higher than excision rates, so that TEs increase genome size (eg % of mammals genome is made of TEs) In the 240 kb of contiguous sequence around the adh1 gene they found 23 copies of TEs belonging to 11 families of retrotransposons. These 23 copies of retrotransposons accounted for over 160 kb. Importantly, the LTR analysis demonstrated that all elements have transposed in the past 6 Myr, with most jumping in the past 3 Myr. Assuming that the adh1 region is representative of the maize genome in general (and there is no reason to believe otherwise), this result implies that the maize genome has grown by 50%, from 1200 Mbp to 2400 Mbp, in the past 3 Myr. How can we interpret these results? One straightforward explanation is that the transposition frequency in maize has increased substantially in the past 3 Myr. Alternatively, it is also possible that the fixation probability of retrotransposons has changed. For example, natural selection against genome-size growth might keep TEs from fixation in maize relatives, but not in maize itself. SanMiguel et al. 1998

10 Genome diversity in microbial eukaryotes: rdna arrangements Sub-telomeric rdnas: Giardia G. lamblia genome contains,60 copies of a 5.6-Kb rdna unit that is organized in tandem arrays near the telomeres of at least six chromosomes In the microsporidian E. cuniculi, each chromosome contains two subtelomeric rdna units located,15 Kb upstream of the chromosome The rdna genes are located on as many as 200 copies of a circular plasmidlike molecule (episomal elements), in contrast to the tandem arrays found in many eukaryotic genomes.

11 Genome diversity in microbial eukaryotes: Giardia Dual Genomes the micronuclear germline genome is involved in CONJUGATION, whereas the somatic macronuclear genome is the site of the majority of transcription In species of Tetrahymena, fragmentation of as few as five micronuclear chromosomes produces up to 200 unique molecules in the macronucleus, each of which is amplified 60 times. In some spirotrichs, 95% or more of the micronuclear sequence is eliminated during the development of the macronucleus and the 120 micronuclear chromosomes fragment into as many as different genesized chromosomes in the macronucleus. Furthermore, each of these highly processed macronuclear chromosomes is then amplified times.

12 Genome diversity in microbial eukaryotes: Organellar Genomes kinetoplastid mitochondrial genomes exist as concatenated mini- and maxicircles. Some of the maxicircles contain incomplete genes that require RNA editing to produce open reading frames, and at least part of the RNA editing is templated by sequences on minicircles Giardia the Amoebidium mitochondrial genomes contains several hundred distinct Kb linear chromosomes. These chromosomes fall into three categories: (i) small molecules with no identified coding regions, (ii) medium-sized molecules that encode a single gene, and (iii) larger molecules containing multiple genes. UNIGENIC minicircles are a unique genome structure that has been reported in the chloroplasts of peridinean dinoflagellates. The chloroplast genes of these dinoflagellates occur on 2 3-Kb minicircles, which contain generally only one gene plus an origin of replication and a promoter.

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16 Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection

More information

Frequently Asked Questions (FAQs)

Frequently Asked Questions (FAQs) Frequently Asked Questions (FAQs) Q1. What is meant by Satellite and Repetitive DNA? Ans: Satellite and repetitive DNA generally refers to DNA whose base sequence is repeated many times throughout the

More information

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology 2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the

More information

Introduction to Molecular and Cell Biology

Introduction to Molecular and Cell Biology Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What

More information

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/1/18

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/1/18 Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection

More information

TE content correlates positively with genome size

TE content correlates positively with genome size TE content correlates positively with genome size Mb 3000 Genomic DNA 2500 2000 1500 1000 TE DNA Protein-coding DNA 500 0 Feschotte & Pritham 2006 Transposable elements. Variation in gene numbers cannot

More information

Genomes and Their Evolution

Genomes and Their Evolution Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

Drosophila melanogaster and D. simulans, two fruit fly species that are nearly

Drosophila melanogaster and D. simulans, two fruit fly species that are nearly Comparative Genomics: Human versus chimpanzee 1. Introduction The chimpanzee is the closest living relative to humans. The two species are nearly identical in DNA sequence (>98% identity), yet vastly different

More information

Molecular evolution - Part 1. Pawan Dhar BII

Molecular evolution - Part 1. Pawan Dhar BII Molecular evolution - Part 1 Pawan Dhar BII Theodosius Dobzhansky Nothing in biology makes sense except in the light of evolution Age of life on earth: 3.85 billion years Formation of planet: 4.5 billion

More information

GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H*" ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION

GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H* ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION FIFTH EDITION IV I ^HHk ^ttm IZTI/^Q i I II MPHBBMWBBIHB '-llwmpbi^hbwm^^pfc ' GSBHSRSBRSRRk LlML I I \l 1MB ^HP'^^MMMP" jflp^^^^^^^^st I Iv^O FROM GENES TO GENOMES %^MiM^PM^^MWi99Mi$9i0^^ ^^^^^^^^^^^^^V^^^fii^^t^i^^^^^

More information

GACE Biology Assessment Test I (026) Curriculum Crosswalk

GACE Biology Assessment Test I (026) Curriculum Crosswalk Subarea I. Cell Biology: Cell Structure and Function (50%) Objective 1: Understands the basic biochemistry and metabolism of living organisms A. Understands the chemical structures and properties of biologically

More information

Multiple Choice Review- Eukaryotic Gene Expression

Multiple Choice Review- Eukaryotic Gene Expression Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule

More information

Proteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering

Proteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering Proteomics 2 nd semester, 2013 1 Text book Principles of Proteomics by R. M. Twyman, BIOS Scientific Publications Other Reference books 1) Proteomics by C. David O Connor and B. David Hames, Scion Publishing

More information

Molecular Evolution & the Origin of Variation

Molecular Evolution & the Origin of Variation Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants

More information

Molecular Evolution & the Origin of Variation

Molecular Evolution & the Origin of Variation Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants

More information

AP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide

AP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide Name: Period: Date: AP Bio Module 6: Bacterial Genetics and Operons, Student Learning Guide Getting started. Work in pairs (share a computer). Make sure that you log in for the first quiz so that you get

More information

Genetics 275 Notes Week 7

Genetics 275 Notes Week 7 Cytoplasmic Inheritance Genetics 275 Notes Week 7 Criteriafor recognition of cytoplasmic inheritance: 1. Reciprocal crosses give different results -mainly due to the fact that the female parent contributes

More information

Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday

Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA

More information

Bacterial Genetics & Operons

Bacterial Genetics & Operons Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the

More information

Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha

Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary

More information

PLNT2530 (2018) Unit 5 Genomes: Organization and Comparisons

PLNT2530 (2018) Unit 5 Genomes: Organization and Comparisons PLNT2530 (2018) Unit 5 Genomes: Organization and Comparisons Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License Attribution Share-Alike

More information

Bio 1B Lecture Outline (please print and bring along) Fall, 2007

Bio 1B Lecture Outline (please print and bring along) Fall, 2007 Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution

More information

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17. Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:

More information

CONJOINT 541. Translating a Transcriptome at Specific Times and Places. David Morris. Department of Biochemistry

CONJOINT 541. Translating a Transcriptome at Specific Times and Places. David Morris. Department of Biochemistry CONJOINT 541 Translating a Transcriptome at Specific Times and Places David Morris Department of Biochemistry http://faculty.washington.edu/dmorris/ Lecture 1 The Biology and Experimental Analysis of mrna

More information

Bio 119 Bacterial Genomics 6/26/10

Bio 119 Bacterial Genomics 6/26/10 BACTERIAL GENOMICS Reading in BOM-12: Sec. 11.1 Genetic Map of the E. coli Chromosome p. 279 Sec. 13.2 Prokaryotic Genomes: Sizes and ORF Contents p. 344 Sec. 13.3 Prokaryotic Genomes: Bioinformatic Analysis

More information

Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p.

Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p. READING: 14.2 Bacterial Genomes p. 481 14.3 Gene Transfer Mechanisms in Bacteria p. 486 Suggested Problems: 1, 7, 13, 14, 15, 20, 22 BACTERIAL GENETICS AND GENOMICS We still consider the E. coli genome

More information

Computational Biology: Basics & Interesting Problems

Computational Biology: Basics & Interesting Problems Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information

More information

Genetic transcription and regulation

Genetic transcription and regulation Genetic transcription and regulation Central dogma of biology DNA codes for DNA DNA codes for RNA RNA codes for proteins not surprisingly, many points for regulation of the process DNA codes for DNA replication

More information

Results and Problems in Cell Differentiation

Results and Problems in Cell Differentiation Results and Problems in Cell Differentiation A Series of Topical Volumes in Developmental Biology 13 Editors W. Hennig, Nijmegen and 1. Reinert, Berlin Germ Line - Soma Differentiation Edited by W. Hennig

More information

Lecture Notes: BIOL2007 Molecular Evolution

Lecture Notes: BIOL2007 Molecular Evolution Lecture Notes: BIOL2007 Molecular Evolution Kanchon Dasmahapatra (k.dasmahapatra@ucl.ac.uk) Introduction By now we all are familiar and understand, or think we understand, how evolution works on traits

More information

Full file at CHAPTER 2 Genetics

Full file at   CHAPTER 2 Genetics CHAPTER 2 Genetics MULTIPLE CHOICE 1. Chromosomes are a. small linear bodies. b. contained in cells. c. replicated during cell division. 2. A cross between true-breeding plants bearing yellow seeds produces

More information

Virginia Western Community College BIO 101 General Biology I

Virginia Western Community College BIO 101 General Biology I BIO 101 General Biology I Prerequisites Successful completion of MTE 1, 2, 3, 4, and 5; and a placement recommendation for ENG 111, co-enrollment in ENF 3/ENG 111, or successful completion of all developmental

More information

CHAPTER : Prokaryotic Genetics

CHAPTER : Prokaryotic Genetics CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering

More information

Map of AP-Aligned Bio-Rad Kits with Learning Objectives

Map of AP-Aligned Bio-Rad Kits with Learning Objectives Map of AP-Aligned Bio-Rad Kits with Learning Objectives Cover more than one AP Biology Big Idea with these AP-aligned Bio-Rad kits. Big Idea 1 Big Idea 2 Big Idea 3 Big Idea 4 ThINQ! pglo Transformation

More information

Eukaryotic Gene Expression

Eukaryotic Gene Expression Eukaryotic Gene Expression Lectures 22-23 Several Features Distinguish Eukaryotic Processes From Mechanisms in Bacteria 123 Eukaryotic Gene Expression Several Features Distinguish Eukaryotic Processes

More information

Compare and contrast the cellular structures and degrees of complexity of prokaryotic and eukaryotic organisms.

Compare and contrast the cellular structures and degrees of complexity of prokaryotic and eukaryotic organisms. Subject Area - 3: Science and Technology and Engineering Education Standard Area - 3.1: Biological Sciences Organizing Category - 3.1.A: Organisms and Cells Course - 3.1.B.A: BIOLOGY Standard - 3.1.B.A1:

More information

Warm-Up. Illustrate (via model, diagram, cartoon, et cetera) how viral replication introduces genetic variation in the viral population. (LO 3.

Warm-Up. Illustrate (via model, diagram, cartoon, et cetera) how viral replication introduces genetic variation in the viral population. (LO 3. Warm-Up Illustrate (via model, diagram, cartoon, et cetera) how viral replication introduces genetic variation in the viral population. (LO 3.30) Yesterday s Picture G C A T G C A T G C AG T A C C T A

More information

Eukaryotic vs. Prokaryotic genes

Eukaryotic vs. Prokaryotic genes BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 18: Eukaryotic genes http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Eukaryotic vs. Prokaryotic genes Like in prokaryotes,

More information

Introduction. Gene expression is the combined process of :

Introduction. Gene expression is the combined process of : 1 To know and explain: Regulation of Bacterial Gene Expression Constitutive ( house keeping) vs. Controllable genes OPERON structure and its role in gene regulation Regulation of Eukaryotic Gene Expression

More information

WHERE DOES THE VARIATION COME FROM IN THE FIRST PLACE?

WHERE DOES THE VARIATION COME FROM IN THE FIRST PLACE? What factors contribute to phenotypic variation? The world s tallest man, Sultan Kosen (8 feet 1 inch) towers over the world s smallest, He Ping (2 feet 5 inches). WHERE DOES THE VARIATION COME FROM IN

More information

CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON

CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter

More information

BME 5742 Biosystems Modeling and Control

BME 5742 Biosystems Modeling and Control BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various

More information

AP Biology Essential Knowledge Cards BIG IDEA 1

AP Biology Essential Knowledge Cards BIG IDEA 1 AP Biology Essential Knowledge Cards BIG IDEA 1 Essential knowledge 1.A.1: Natural selection is a major mechanism of evolution. Essential knowledge 1.A.4: Biological evolution is supported by scientific

More information

Big Idea 3: Living systems store, retrieve, transmit, and respond to information essential to life processes.

Big Idea 3: Living systems store, retrieve, transmit, and respond to information essential to life processes. Big Idea 3: Living systems store, retrieve, transmit, and respond to information essential to life processes. Enduring understanding 3.A: Heritable information provides for continuity of life. Essential

More information

Introduction to Bioinformatics

Introduction to Bioinformatics CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics

More information

Principles of Genetics

Principles of Genetics Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics

More information

GCD3033:Cell Biology. Transcription

GCD3033:Cell Biology. Transcription Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors

More information

A A A A B B1

A A A A B B1 LEARNING OBJECTIVES FOR EACH BIG IDEA WITH ASSOCIATED SCIENCE PRACTICES AND ESSENTIAL KNOWLEDGE Learning Objectives will be the target for AP Biology exam questions Learning Objectives Sci Prac Es Knowl

More information

16 The Cell Cycle. Chapter Outline The Eukaryotic Cell Cycle Regulators of Cell Cycle Progression The Events of M Phase Meiosis and Fertilization

16 The Cell Cycle. Chapter Outline The Eukaryotic Cell Cycle Regulators of Cell Cycle Progression The Events of M Phase Meiosis and Fertilization The Cell Cycle 16 The Cell Cycle Chapter Outline The Eukaryotic Cell Cycle Regulators of Cell Cycle Progression The Events of M Phase Meiosis and Fertilization Introduction Self-reproduction is perhaps

More information

Bioinformatics. Dept. of Computational Biology & Bioinformatics

Bioinformatics. Dept. of Computational Biology & Bioinformatics Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS

More information

Big Idea 1: The process of evolution drives the diversity and unity of life.

Big Idea 1: The process of evolution drives the diversity and unity of life. Big Idea 1: The process of evolution drives the diversity and unity of life. understanding 1.A: Change in the genetic makeup of a population over time is evolution. 1.A.1: Natural selection is a major

More information

CHAPTER 12 - THE CELL CYCLE (pgs )

CHAPTER 12 - THE CELL CYCLE (pgs ) CHAPTER 12 - THE CELL CYCLE (pgs. 228-245) CHAPTER SEVEN TARGETS I. Describe the importance of mitosis in single-celled and multi-cellular organisms. II. Explain the organization of DNA molecules and their

More information

AP Curriculum Framework with Learning Objectives

AP Curriculum Framework with Learning Objectives Big Ideas Big Idea 1: The process of evolution drives the diversity and unity of life. AP Curriculum Framework with Learning Objectives Understanding 1.A: Change in the genetic makeup of a population over

More information

Curriculum Map. Biology, Quarter 1 Big Ideas: From Molecules to Organisms: Structures and Processes (BIO1.LS1)

Curriculum Map. Biology, Quarter 1 Big Ideas: From Molecules to Organisms: Structures and Processes (BIO1.LS1) 1 Biology, Quarter 1 Big Ideas: From Molecules to Organisms: Structures and Processes (BIO1.LS1) Focus Standards BIO1.LS1.2 Evaluate comparative models of various cell types with a focus on organic molecules

More information

Enduring understanding 1.A: Change in the genetic makeup of a population over time is evolution.

Enduring understanding 1.A: Change in the genetic makeup of a population over time is evolution. The AP Biology course is designed to enable you to develop advanced inquiry and reasoning skills, such as designing a plan for collecting data, analyzing data, applying mathematical routines, and connecting

More information

5/4/05 Biol 473 lecture

5/4/05 Biol 473 lecture 5/4/05 Biol 473 lecture animals shown: anomalocaris and hallucigenia 1 The Cambrian Explosion - 550 MYA THE BIG BANG OF ANIMAL EVOLUTION Cambrian explosion was characterized by the sudden and roughly simultaneous

More information

Miller & Levine Biology

Miller & Levine Biology A Correlation of To the Science Biology A Correlation of, 2014 to the, Table of Contents From Molecules to Organisms: Structures and Processes... 3 Ecosystems: Interactions, Energy, and Dynamics... 4 Heredity:

More information

Molecular Biology Of The Cell 6th Edition Alberts

Molecular Biology Of The Cell 6th Edition Alberts We have made it easy for you to find a PDF Ebooks without any digging. And by having access to our ebooks online or by storing it on your computer, you have convenient answers with molecular biology of

More information

Transport between cytosol and nucleus

Transport between cytosol and nucleus of 60 3 Gated trans Lectures 9-15 MBLG 2071 The n GATED TRANSPORT transport between cytoplasm and nucleus (bidirectional) controlled by the nuclear pore complex active transport for macro molecules e.g.

More information

Translation Part 2 of Protein Synthesis

Translation Part 2 of Protein Synthesis Translation Part 2 of Protein Synthesis IN: How is transcription like making a jello mold? (be specific) What process does this diagram represent? A. Mutation B. Replication C.Transcription D.Translation

More information

Formative/Summative Assessments (Tests, Quizzes, reflective writing, Journals, Presentations)

Formative/Summative Assessments (Tests, Quizzes, reflective writing, Journals, Presentations) Biology Curriculum Map 2017-18 2 Weeks- Introduction to Biology: Scientific method, lab safety, organizing and analyzing data, and psuedoscience. This unit establishes the fundamental nature of scientific

More information

Bi 1x Spring 2014: LacI Titration

Bi 1x Spring 2014: LacI Titration Bi 1x Spring 2014: LacI Titration 1 Overview In this experiment, you will measure the effect of various mutated LacI repressor ribosome binding sites in an E. coli cell by measuring the expression of a

More information

(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.

(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid. 1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the

More information

An Optimal System for Evolutionary Cell Biology: the genus Paramecium

An Optimal System for Evolutionary Cell Biology: the genus Paramecium An Optimal System for Evolutionary Cell Biology: the genus Paramecium Presence of a transcriptionally silent germline (micronucleus) and an expression-active somatic macronucleus. Geographically ubiquitous,

More information

2015 FALL FINAL REVIEW

2015 FALL FINAL REVIEW 2015 FALL FINAL REVIEW Biomolecules & Enzymes Illustrate table and fill in parts missing 9A I can compare and contrast the structure and function of biomolecules. 9C I know the role of enzymes and how

More information

The nature of genomes. Viral genomes. Prokaryotic genome. Nonliving particle. DNA or RNA. Compact genomes with little spacer DNA

The nature of genomes. Viral genomes. Prokaryotic genome. Nonliving particle. DNA or RNA. Compact genomes with little spacer DNA The nature of genomes Genomics: study of structure and function of genomes Genome size variable, by orders of magnitude number of genes roughly proportional to genome size Plasmids symbiotic DNA molecules,

More information

Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:

Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail

More information

UNIT 5. Protein Synthesis 11/22/16

UNIT 5. Protein Synthesis 11/22/16 UNIT 5 Protein Synthesis IV. Transcription (8.4) A. RNA carries DNA s instruction 1. Francis Crick defined the central dogma of molecular biology a. Replication copies DNA b. Transcription converts DNA

More information

An introduction to SYSTEMS BIOLOGY

An introduction to SYSTEMS BIOLOGY An introduction to SYSTEMS BIOLOGY Paolo Tieri CNR Consiglio Nazionale delle Ricerche, Rome, Italy 10 February 2015 Universidade Federal de Minas Gerais, Belo Horizonte, Brasil Course outline Day 1: intro

More information

Biology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 26 Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 2 of 26 Gene Regulation: An Example Gene Regulation: An Example

More information

Ohio Tutorials are designed specifically for the Ohio Learning Standards to prepare students for the Ohio State Tests and end-ofcourse

Ohio Tutorials are designed specifically for the Ohio Learning Standards to prepare students for the Ohio State Tests and end-ofcourse Tutorial Outline Ohio Tutorials are designed specifically for the Ohio Learning Standards to prepare students for the Ohio State Tests and end-ofcourse exams. Biology Tutorials offer targeted instruction,

More information

BIOLOGY I: COURSE OVERVIEW

BIOLOGY I: COURSE OVERVIEW BIOLOGY I: COURSE OVERVIEW The academic standards for High School Biology I establish the content knowledge and skills for Tennessee students in order to prepare them for the rigorous levels of higher

More information

The Gene The gene; Genes Genes Allele;

The Gene The gene; Genes Genes Allele; Gene, genetic code and regulation of the gene expression, Regulating the Metabolism, The Lac- Operon system,catabolic repression, The Trp Operon system: regulating the biosynthesis of the tryptophan. Mitesh

More information

Chapter 18 Active Reading Guide Genomes and Their Evolution

Chapter 18 Active Reading Guide Genomes and Their Evolution Name: AP Biology Mr. Croft Chapter 18 Active Reading Guide Genomes and Their Evolution Most AP Biology teachers think this chapter involves an advanced topic. The questions posed here will help you understand

More information

November 13, 2009 Bioe 109 Fall 2009 Lecture 20 Evolutionary Genomics

November 13, 2009 Bioe 109 Fall 2009 Lecture 20 Evolutionary Genomics November 13, 2009 Bioe 109 Fall 2009 Lecture 20 Evolutionary Genomics - we have now entered the genomics age - the number of complete genomes continues to rise rapidly each year, now numbering about 200.

More information

Campbell Biology Concepts & Connections 2015

Campbell Biology Concepts & Connections 2015 A Correlation of Concepts & Connections 2015 To the Science, , Science - Table of Contents From Molecules to Organisms: Structures and Processes... 3 Ecosystems: Interactions, Energy, and Dynamics... 5

More information

EASTERN ARIZONA COLLEGE General Biology I

EASTERN ARIZONA COLLEGE General Biology I EASTERN ARIZONA COLLEGE General Biology I Course Design 2013-2014 Course Information Division Science Course Number BIO 181 (SUN# BIO 1181) Title General Biology I Credits 4 Developed by David J. Henson

More information

FUNDAMENTALS OF MOLECULAR EVOLUTION

FUNDAMENTALS OF MOLECULAR EVOLUTION FUNDAMENTALS OF MOLECULAR EVOLUTION Second Edition Dan Graur TELAVIV UNIVERSITY Wen-Hsiung Li UNIVERSITY OF CHICAGO SINAUER ASSOCIATES, INC., Publishers Sunderland, Massachusetts Contents Preface xiii

More information

Special Topics on Genetics

Special Topics on Genetics ARISTOTLE UNIVERSITY OF THESSALONIKI OPEN COURSES Section 9: Transposable elements Drosopoulou E License The offered educational material is subject to Creative Commons licensing. For educational material,

More information

A DNA Sequence 2017/12/6 1

A DNA Sequence 2017/12/6 1 A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta

More information

Algorithmics and Bioinformatics

Algorithmics and Bioinformatics Algorithmics and Bioinformatics Gregory Kucherov and Philippe Gambette LIGM/CNRS Université Paris-Est Marne-la-Vallée, France Schedule Course webpage: https://wikimpri.dptinfo.ens-cachan.fr/doku.php?id=cours:c-1-32

More information

The Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11

The Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11 The Eukaryotic Genome and Its Expression Lecture Series 11 The Eukaryotic Genome and Its Expression A. The Eukaryotic Genome B. Repetitive Sequences (rem: teleomeres) C. The Structures of Protein-Coding

More information

Learning Objectives LO 3.7 The student can make predictions about natural phenomena occurring during the cell cycle. [See SP 6.4]

Learning Objectives LO 3.7 The student can make predictions about natural phenomena occurring during the cell cycle. [See SP 6.4] Big Ideas 3.A.2: In eukaryotes, heritable information is passed to the next generation via processes that include the cell cycle and mitosis or meiosis plus fertilization. CHAPTER 13 MEIOSIS AND SEXUAL

More information

- mutations can occur at different levels from single nucleotide positions in DNA to entire genomes.

- mutations can occur at different levels from single nucleotide positions in DNA to entire genomes. February 8, 2005 Bio 107/207 Winter 2005 Lecture 11 Mutation and transposable elements - the term mutation has an interesting history. - as far back as the 17th century, it was used to describe any drastic

More information

BIOLOGY STANDARDS BASED RUBRIC

BIOLOGY STANDARDS BASED RUBRIC BIOLOGY STANDARDS BASED RUBRIC STUDENTS WILL UNDERSTAND THAT THE FUNDAMENTAL PROCESSES OF ALL LIVING THINGS DEPEND ON A VARIETY OF SPECIALIZED CELL STRUCTURES AND CHEMICAL PROCESSES. First Semester Benchmarks:

More information

Essential knowledge 1.A.2: Natural selection

Essential knowledge 1.A.2: Natural selection Appendix C AP Biology Concepts at a Glance Big Idea 1: The process of evolution drives the diversity and unity of life. Enduring understanding 1.A: Change in the genetic makeup of a population over time

More information

Curriculum Links. AQA GCE Biology. AS level

Curriculum Links. AQA GCE Biology. AS level Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2

More information

Miller & Levine Biology 2010

Miller & Levine Biology 2010 A Correlation of 2010 to the Pennsylvania Assessment Anchors Grades 9-12 INTRODUCTION This document demonstrates how 2010 meets the Pennsylvania Assessment Anchors, grades 9-12. Correlation page references

More information

Lesson Overview. Gene Regulation and Expression. Lesson Overview Gene Regulation and Expression

Lesson Overview. Gene Regulation and Expression. Lesson Overview Gene Regulation and Expression 13.4 Gene Regulation and Expression THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium

More information

Introduction Biology before Systems Biology: Reductionism Reduce the study from the whole organism to inner most details like protein or the DNA.

Introduction Biology before Systems Biology: Reductionism Reduce the study from the whole organism to inner most details like protein or the DNA. Systems Biology-Models and Approaches Introduction Biology before Systems Biology: Reductionism Reduce the study from the whole organism to inner most details like protein or the DNA. Taxonomy Study external

More information

Exam 1 PBG430/

Exam 1 PBG430/ 1 Exam 1 PBG430/530 2014 1. You read that the genome size of maize is 2,300 Mb and that in this species 2n = 20. This means that there are 2,300 Mb of DNA in a cell that is a. n (e.g. gamete) b. 2n (e.g.

More information

Biology Assessment. Eligible Texas Essential Knowledge and Skills

Biology Assessment. Eligible Texas Essential Knowledge and Skills Biology Assessment Eligible Texas Essential Knowledge and Skills STAAR Biology Assessment Reporting Category 1: Cell Structure and Function The student will demonstrate an understanding of biomolecules

More information

Grundlagen der Systembiologie und der Modellierung epigenetischer Prozesse

Grundlagen der Systembiologie und der Modellierung epigenetischer Prozesse Grundlagen der Systembiologie und der Modellierung epigenetischer Prozesse Sonja J. Prohaska Bioinformatics Group Institute of Computer Science University of Leipzig October 25, 2010 Genome-scale in silico

More information

STAAR Biology Assessment

STAAR Biology Assessment STAAR Biology Assessment Reporting Category 1: Cell Structure and Function The student will demonstrate an understanding of biomolecules as building blocks of cells, and that cells are the basic unit of

More information

Predicting Protein Functions and Domain Interactions from Protein Interactions

Predicting Protein Functions and Domain Interactions from Protein Interactions Predicting Protein Functions and Domain Interactions from Protein Interactions Fengzhu Sun, PhD Center for Computational and Experimental Genomics University of Southern California Outline High-throughput

More information

Vital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655)

Vital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655) We still consider the E. coli genome as a fairly typical bacterial genome, and given the extensive information available about this organism and it's lifestyle, the E. coli genome is a useful point of

More information

THE ROLE OF BBSRC IN BIODIVERSITY RESEARCH

THE ROLE OF BBSRC IN BIODIVERSITY RESEARCH THE ROLE OF BBSRC IN BIODIVERSITY RESEARCH INTRODUCTION The aim of this document is to explain the role of biodiversity research in the delivery of the BBSRC mission, and thereby to provide guidance to

More information

The geneticist s questions. Deleting yeast genes. Functional genomics. From Wikipedia, the free encyclopedia

The geneticist s questions. Deleting yeast genes. Functional genomics. From Wikipedia, the free encyclopedia From Wikipedia, the free encyclopedia Functional genomics..is a field of molecular biology that attempts to make use of the vast wealth of data produced by genomic projects (such as genome sequencing projects)

More information

Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p

Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p.110-114 Arrangement of information in DNA----- requirements for RNA Common arrangement of protein-coding genes in prokaryotes=

More information

A diploid somatic cell from a rat has a total of 42 chromosomes (2n = 42). As in humans, sex chromosomes determine sex: XX in females and XY in males.

A diploid somatic cell from a rat has a total of 42 chromosomes (2n = 42). As in humans, sex chromosomes determine sex: XX in females and XY in males. Multiple Choice Use the following information for questions 1-3. A diploid somatic cell from a rat has a total of 42 chromosomes (2n = 42). As in humans, sex chromosomes determine sex: XX in females and

More information