Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2

Size: px
Start display at page:

Download "Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2"

Transcription

1 Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2 IRT1, FRO2 and FIT expression levels in roots of the wild-type, nas4x- 1 and nas4x-2, showing that in both nas mutants the three genes were induced compared to the wild-type. Plants were grown in a hydroponic system under Fe-sufficient conditions up to the LVS. Gene expression was determined by reverse transcription-qpcr. The result has been reproduced in three independent experiments. 1

2 Supplemental Figure 2: Fe accumulated in leaves of nas4x-2 but not in leaves of frd3 nas4x-2 Perls Fe staining of middle-aged leaves, confirming that frd3 nas4x-2 plants did not accumulate Fe in the leaves. Fe deposits are observed in nas4x-2 leaf veins and hydathodes, shown with higher magnification in the circles (compare with Fig. 6); bar = 1 cm. 2

3 Supplemental Figure 3: Fe accumulated in roots of nas4x-2 and frd3 nas4x-2 Plant material was harvested from plants in the RS. A, Perls Fe staining of roots, showing Fe accumulation in the steles of roots that have a frd3 background. Note that Fe accumulated in frd3 nas4x-2 roots, indicating that the transport of Fe towards the central stele was not affected by loss of NA; bar = 1 cm B, Fe contents per g dry weight of roots, demonstrating a high Fe content in roots with a frd3 background (error bars are standard deviations; n= 4). Numbers 1-6 indicate p < 0.05 in the comparisons 1 nas4x-2 vs WT; 2 frd3 vs. WT; 3 frd3 nas4x-2 vs. WT; 4 frd3 vs. nas4x-2; 5 frd3 nas4x-2 vs. nas4x-2; 6 frd3 nas4x-2 vs. frd3. 3

4 Supplemental Figure 4: Malate, 2-oxoglutarate and succinate contents were not affected by frd3 and nas4x-2 mutations Contents of malate, 2-oxoglutarate and succinate in the xylem saps, showing no significant changes between the mutants and wild type; error bars are standard deviations; n= 5; p<

5 Supplemental Figure 5: Perls Fe staining signals in sections of wild-type and nas4x-2 leaves Enlargement of Fig. 6B; Perls Fe staining signals in 7 µm sections of wild-type and nas4x-2 young and middle-aged leaves, showing Fe deposits in the phloem of the vessels in nas4x-2 (indicated by arrows); Xy = xylem; Ph = phloem; bar = 50 µm. 5

6 Supplemental Figure 6: nas4x-2 plants were late-flowering Percentage of nas4x-2 and wild-type plants in the flowering stage during a growth period of up to ten weeks; n=

7 Supplemental Figure 7: NAS genes were not expressed in wild-type carpels and stamens NAS1, NAS2, NAS3 and NAS4 expression in sepals, petals, carpels and stamens of wild-type plants, showing that only NAS3 was expressed in flowers and only in sepals and petals. Gene expression was determined by reverse transcription-qpcr; error bars are standard deviations; n= 3. 7

8 Supplemental Figure 8: nas4x-2 sterility was rescued by Fe and a combination of Fe and Zn spraying Images of nas4x-2 flowering plants that were not treated with fertilizer as control (co), sprayed with 0.1% ZnSO 4 (+ Zn), 0.05% Fe EDDHA (+ Fe) and a combination of 0.1% ZnSO 4 and 0.05% Fe EDDHA (+ Zn/Fe). The arrows point to developed siliques. The numbers indicate the number of rescued plants producing siliques out of five tested plants. 8

Nicotianamine Functions in the Phloem-Based Transport of Iron to Sink Organs, in Pollen Development and Pollen Tube Growth in Arabidopsis C W

Nicotianamine Functions in the Phloem-Based Transport of Iron to Sink Organs, in Pollen Development and Pollen Tube Growth in Arabidopsis C W The Plant Cell, Vol. 24: 2380 2400, June 2012, www.plantcell.org ã 2012 American Society of Plant Biologists. All rights reserved. Nicotianamine Functions in the Phloem-Based Transport of Iron to Sink

More information

GFP GAL bp 3964 bp

GFP GAL bp 3964 bp Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive

More information

DNA or RNA metabolism (1%) Signal transduction (2%) Development (2%) Other cellular processes (17%)

DNA or RNA metabolism (1%) Signal transduction (2%) Development (2%) Other cellular processes (17%) Fig. 35-24 Other metabolism (18%) DNA or RNA metabolism (1%) Signal transduction (2%) Development (2%) Unknown (24%) Energy pathways (3%) Cell division and organization (3%) Transport (4%) Transcription

More information

Ethylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis

Ethylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis Ethylene is critical to the maintenance of primary root growth and Fe homeostasis under Fe stress in Arabidopsis Guangjie Li, Weifeng Xu, Herbert J. Kronzucker, Weiming Shi * Supplementary Data Supplementary

More information

Genome-wide Identification of Lineage Specific Genes in Arabidopsis, Oryza and Populus

Genome-wide Identification of Lineage Specific Genes in Arabidopsis, Oryza and Populus Genome-wide Identification of Lineage Specific Genes in Arabidopsis, Oryza and Populus Xiaohan Yang Sara Jawdy Timothy Tschaplinski Gerald Tuskan Environmental Sciences Division Oak Ridge National Laboratory

More information

** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.

** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation. Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *

More information

b. Leaf: 7. Where are most of the plants carbohydrates made? 8. Where are carbohydrates stored for future use?

b. Leaf: 7. Where are most of the plants carbohydrates made? 8. Where are carbohydrates stored for future use? Plant Structures 1. Circle the three main parts of the plant to the left. 2. What does each part below do for the plant? a. Stem: b. Leaf: c. Root: 3. Where does most photosynthesis occur? 4. Where are

More information

Supplemental Data. Perrella et al. (2013). Plant Cell /tpc

Supplemental Data. Perrella et al. (2013). Plant Cell /tpc Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature12791 Supplementary Figure 1 (1/3) WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 1 (2/3) 2 WWW.NATURE.COM/NATURE SUPPLEMENTARY

More information

Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated

Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin

More information

Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed

Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed using the Geneious software. Accession numbers of the

More information

Plant Structure, Growth, and Development

Plant Structure, Growth, and Development Plant Structure, Growth, and Development Plant hierarchy: Cells Tissue: group of similar cells with similar function: Dermal, Ground, Vascular Organs: multiple kinds of tissue, very diverse function Organ

More information

PLANTS FORM AND FUNCTION PLANT MORPHOLOGY PART I: BASIC MORPHOLOGY. Plant Form & Function Activity #1 page 1

PLANTS FORM AND FUNCTION PLANT MORPHOLOGY PART I: BASIC MORPHOLOGY. Plant Form & Function Activity #1 page 1 AP BIOLOGY PLANTS FORM AND FUNCTION ACTIVITY #1 NAME DATE HOUR PLANT MORPHOLOGY PART I: BASIC MORPHOLOGY Plant Form & Function Activity #1 page 1 PART II: ROOTS 1. Examine the examples of the two root

More information

Vocabulary. photosynthesis p.48. chlorophyll p.49. sepal p.55. pistil p.55. stamen p.55. ovary p.56. fertilization p.56. dormant p.

Vocabulary. photosynthesis p.48. chlorophyll p.49. sepal p.55. pistil p.55. stamen p.55. ovary p.56. fertilization p.56. dormant p. Name: Section: 2 3 4 Vocabulary Word Definition photosynthesis p.48 chlorophyll p.49 sepal p.55 pistil p.55 stamen p.55 ovary p.56 fertilization p.56 dormant p.62 5 6 7 Chapter 2 Lesson 1 What are plants

More information

AP Biology. Evolution of Land Plants. Kingdom: Plants. Plant Diversity. Animal vs. Plant life cycle. Bryophytes: mosses & liverworts

AP Biology. Evolution of Land Plants. Kingdom: Plants. Plant Diversity. Animal vs. Plant life cycle. Bryophytes: mosses & liverworts Kingdom: Plants Domain Eukarya Domain Domain Domain Eubacteria Archaea Eukarya 2007-2008 Common ancestor Evolution of Land Plants 500 mya land plants evolved special adaptations for life on dry land protection

More information

3.02 Morphology (external) and Anatomy (internal) Packet: P5 Plant Leaves you will explore both compound and simple leaves. Enjoy the journey.

3.02 Morphology (external) and Anatomy (internal) Packet: P5 Plant Leaves you will explore both compound and simple leaves. Enjoy the journey. 02 Morphology (external) and Anatomy (internal) Packet: P5 Plant Leaves you will explore both compound and simple leaves. Enjoy the journey. Simple Leaf Morphology List five edible plant leaves: 5. Compound

More information

Basic Principles of Plant Science

Basic Principles of Plant Science Basic Principles of Plant Science are the structural basis of all living organisms. A cell is a tiny structure that forms the of plants. All organisms are made of one or more cells. in cells carries out

More information

Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc

Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc Supplemental Data. Chen and Thelen (2010). Plant Cell 10.1105/tpc.109.071837 1 C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector

More information

Shoot System. Root System. below-ground organs (roots) Dermal Tissue. Ground Tissue. Vascular Tissue. above-ground organs (leaves, stems, flowers)

Shoot System. Root System. below-ground organs (roots) Dermal Tissue. Ground Tissue. Vascular Tissue. above-ground organs (leaves, stems, flowers) Shoot System above-ground organs (leaves, stems, flowers) Root System below-ground organs (roots) Dermal Tissue type of plant tissue that is the outer covering of the plant and serves as a protective barrier

More information

Plant Vocabulary. Define

Plant Vocabulary. Define Define Plant Vocabulary 1. Photosynthesis 2. Eukaryotic 3. Monocot 4. Dicot 5. Cotyledon 6. Roots 7. Stems 8. Leaves 9. Xylem 10. Phloem 11. Capillary action 12. Meristem 13. Apical meristem 14. Vascular

More information

The mode of development in animals and plants is different

The mode of development in animals and plants is different The mode of development in animals and plants is different Outcome of animal embryogenesis is a mini edition of the adult Outcome of plant embryogenesis is a simple structure with -root apical meristem

More information

A MicroRNA as a Translational Repressor of APETALA2 in Arabidopsis Flower Development

A MicroRNA as a Translational Repressor of APETALA2 in Arabidopsis Flower Development A MicroRNA as a Translational Repressor of APETALA2 in Arabidopsis Flower Development Xuemei Chen Waksman Institute, Rutgers University, Piscataway, NJ 08854, USA. E-mail: xuemei@waksman.rutgers.edu Plant

More information

Biology 213 Exam 3 Practice Key

Biology 213 Exam 3 Practice Key Biology 213 Practice Key 1. (4) Explain the difference between a macronutrient and a micronutrient and cite two examples of each category? Macronutrients are the minerals needed by the plant in greater

More information

Table S1 List of primers used for genotyping and qrt-pcr.

Table S1 List of primers used for genotyping and qrt-pcr. Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!

More information

Supplemental Data. Wang et al. (2014). Plant Cell /tpc

Supplemental Data. Wang et al. (2014). Plant Cell /tpc Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and

More information

LESSON 10 PLANTS. Pteridophytes.(Cormophytes) Ferns: have woody vascular conduicts.

LESSON 10 PLANTS. Pteridophytes.(Cormophytes) Ferns: have woody vascular conduicts. LESSON 10 PLANTS The plant kingdom. Plants originated as part of a group of green algae approximately 500 million years ago. They were the first living beings to colonize the Earth. Plants are multi-cellular(eucariotyc)living

More information

POTASSIUM IN PLANT GROWTH AND YIELD. by Ismail Cakmak Sabanci University Istanbul, Turkey

POTASSIUM IN PLANT GROWTH AND YIELD. by Ismail Cakmak Sabanci University Istanbul, Turkey POTASSIUM IN PLANT GROWTH AND YIELD by Ismail Cakmak Sabanci University Istanbul, Turkey Low K High K High K Low K Low K High K Low K High K Control K Deficiency Cakmak et al., 1994, J. Experimental Bot.

More information

Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day

Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day conditions. Photo was taken when the wild type plant started to bolt. Scale bar represents 1 cm. Supplemental Figure 2. Flowering

More information

Objectives. To identify plant structures and functions. To describe the structure of plant cells. To explain the process of reproduction in plants.

Objectives. To identify plant structures and functions. To describe the structure of plant cells. To explain the process of reproduction in plants. 1 Objectives To identify plant structures and functions. To describe the structure of plant cells. To explain the process of reproduction in plants. 2 Main Menu Plant Cell Biology Plant Structures Roots

More information

Kingdom: Plantae. Domain Archaea. Domain Eukarya. Domain Bacteria. Common ancestor

Kingdom: Plantae. Domain Archaea. Domain Eukarya. Domain Bacteria. Common ancestor Kingdom: Plantae Domain Eukarya Domain Bacteria Domain Archaea Domain Eukarya Common ancestor The First Plants For more than 3 billion years, Earth s terrestrial surface was lifeless life evolved in the

More information

GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL

GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,

More information

Name the tube-like tissue found in part C in which water moves. Name the cells which are responsible for controlling the size of the opening at Z

Name the tube-like tissue found in part C in which water moves. Name the cells which are responsible for controlling the size of the opening at Z Past Questions on Plant Structure Note: You need to be able to draw and label all the diagrams in this worksheet for your exam. Name the parts labelled B, C and E. C E Give one main function each for the

More information

PLANT GROWTH. IB Topic 9.3 & 9.4 Urry text ref: Ch 28 & 31

PLANT GROWTH. IB Topic 9.3 & 9.4 Urry text ref: Ch 28 & 31 PLANT GROWTH IB Topic 9.3 & 9.4 Urry text ref: Ch 28 & 31 INDETERMINATE GROWTH = throughout life meristems like stem cells in humans Shoot tip (shoot apical meristem and young leaves) lateral Axillary

More information

UNIVERSITY OF BOLTON SCHOOL OF SPORT AND BIOMEDICAL SCIENCES BSC(HONS) BIOLOGY SEMESTER ONE EXAMINATION 2015/2016 DIVERSITY OF LIFE MODULE NO: BIO4003

UNIVERSITY OF BOLTON SCHOOL OF SPORT AND BIOMEDICAL SCIENCES BSC(HONS) BIOLOGY SEMESTER ONE EXAMINATION 2015/2016 DIVERSITY OF LIFE MODULE NO: BIO4003 [LH4] UNIVERSITY OF BOLTON SCHOOL OF SPORT AND BIOMEDICAL SCIENCES BSC(HONS) BIOLOGY SEMESTER ONE EXAMINATION 2015/2016 DIVERSITY OF LIFE MODULE NO: BIO4003 Date: Friday 15 January 2016 Time: 10.00 am

More information

Worksheet for Morgan/Carter Laboratory #16 Plant Diversity II: Seed Plants

Worksheet for Morgan/Carter Laboratory #16 Plant Diversity II: Seed Plants Worksheet for Morgan/Carter Laboratory #16 Plant Diversity II: Seed Plants BE SURE TO CAREFULLY READ THE INTRODUCTION PRIOR TO ANSWERING THE QUESTIONS!!! You will need to refer to your text book to answer

More information

1 Evolution of Plants

1 Evolution of Plants 1 Evolution of Plants Plant Evolutionary Tree 1 How Did Plant Life Begin? BIBLICAL WORLDVIEW EVOLUTIONARY WORLDVIEW The Biblical worldview is that plants began on the third day of creation, created by

More information

Basic Principles of Plant Science EXAMINING PLANT STRUCTURES AND FUNCTIONS

Basic Principles of Plant Science EXAMINING PLANT STRUCTURES AND FUNCTIONS Basic Principles of Plant Science EXAMINING PLANT STRUCTURES AND FUNCTIONS Cellular Structure of Plants Cells are the structural basis of all living organisms. A cell is a tiny structure that forms the

More information

Name Date Block. Plant Structures

Name Date Block. Plant Structures Name Date Block What are the Functions of Roots, Stems, and Leaves? Plant Structures Each part of a plant plays an important role in its structure and function. Roots, stems, and leaves are just three

More information

Regulation of Phosphate Homeostasis by microrna in Plants

Regulation of Phosphate Homeostasis by microrna in Plants Regulation of Phosphate Homeostasis by microrna in Plants Tzyy-Jen Chiou 1 *, Kyaw Aung 1,2, Shu-I Lin 1,3, Chia-Chune Wu 1, Su-Fen Chiang 1, and Chun-Lin Su 1 Abstract Upon phosphate (Pi) starvation,

More information

The Plant Kingdom If you were to walk around a forest, what would you see? Most things that you would probably name are plants.

The Plant Kingdom If you were to walk around a forest, what would you see? Most things that you would probably name are plants. INTRODUCTION TO PLANTS The Plant Kingdom If you were to walk around a forest, what would you see? Most things that you would probably name are plants. Plants are abundant in almost every environment that

More information

Unit 8 Angiosperms Student Guided Notes

Unit 8 Angiosperms Student Guided Notes Unit 8 Angiosperms Student Guided Notes Angiosperms General Characteristics of FloweringPlants All belong to the division Magnoliophyta and. Developing from the flower is. This extremely diverse division

More information

. Supplementary Information

. Supplementary Information . Supplementary Information Supplementary Figure S1. Mature embryo sac observations. Supplementary Figure S2. STT observations. Supplementary Figure S3. Comparison of the PTB1 cdna with that of the mutant.

More information

Plant Structure, Growth, and Development

Plant Structure, Growth, and Development Chapter 35 Plant Structure, Growth, and Development PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions

More information

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and

More information

Chapter 23: Plant Diversity and Life Cycles

Chapter 23: Plant Diversity and Life Cycles Chapter 23: Plant Diversity and Life Cycles Section 1: Introduction to Plants Cuticle: a waxy or fatty and watertight layer on the external wall of epidermal cells Spore: a reproductive cell or multicellular

More information

UNIT 3. PLANTS. PRIMARY 4/ Natural Science Pedro Antonio López Hernández

UNIT 3. PLANTS. PRIMARY 4/ Natural Science Pedro Antonio López Hernández UNIT 3. PLANTS PRIMARY 4/ Natural Science Pedro Antonio López Hernández They help to keep it in place. Roots They take in the water and minerals a plant needs to make its food. They support the leaves.

More information

Chapter 35: Plant Structure, Growth and Development - No two Plants Are Alike Plant structure

Chapter 35: Plant Structure, Growth and Development - No two Plants Are Alike Plant structure Chapter 35: Plant Structure, Growth and Development - No two Plants Are Alike Plant structure Systems Root and Shoot system Organs Roots, Stems, Leaves Tissues Dermal, Vascular, Ground Cells parencyma,

More information

Potential Sites of Bioactive Gibberellin Production during Reproductive Growth in Arabidopsis W

Potential Sites of Bioactive Gibberellin Production during Reproductive Growth in Arabidopsis W This article is a Plant Cell Advance Online Publication. The date of its first appearance online is the official date of publication. The article has been edited and the authors have corrected proofs,

More information

Plant Structure, Growth, and Development

Plant Structure, Growth, and Development Chapter 35 Plant Structure, Growth, and Development PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Overview: No two Plants Are Alike To some people The fanwort is an intrusive

More information

Leucine-rich repeat receptor-like kinases (LRR-RLKs), HAESA, ERECTA-family

Leucine-rich repeat receptor-like kinases (LRR-RLKs), HAESA, ERECTA-family Leucine-rich repeat receptor-like kinases (LRR-RLKs), HAESA, ERECTA-family GENES & DEVELOPMENT (2000) 14: 108 117 INTRODUCTION Flower Diagram INTRODUCTION Abscission In plant, the process by which a plant

More information

Directed Reading A. Section: Structures of Seed Plants ROOTS. Skills Worksheet

Directed Reading A. Section: Structures of Seed Plants ROOTS. Skills Worksheet Skills Worksheet Directed Reading A Section: Structures of Seed Plants Write the letter of the correct answer in the space provided. 1. What supplies a seed plant with the things it needs to survive? a.

More information

Root cross-section (Ranunculus)

Root cross-section (Ranunculus) Plant Lab Review Root cross-section (Ranunculus) Epidermis Cortex Vascular Cylinder Phloem Endodermis Xylem Ranunculus Root Cross section Give three functions of the root Anchor plant Absorb water and

More information

plant physiology and energy conversion to plant systems. identify the components and the functions of plant describe the processes of

plant physiology and energy conversion to plant systems. identify the components and the functions of plant describe the processes of Plant Systems-AG1 Essential Questions: 1. How do plant classification, plant anatomy, and plant physiology affect the production and management of plants? 2. What are the necessary steps to Prepare and

More information

Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering

Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering by Valverde et. Al Published in Science 2004 Presented by Boyana Grigorova CBMG 688R Feb. 12, 2007 Circadian Rhythms: The Clock Within

More information

Plant Structure, Growth, and Development

Plant Structure, Growth, and Development Chapter 35 Plant Structure, Growth, and Development PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions

More information

Name Class Date. Complete each of the following sentences by choosing the correct term from the word bank.

Name Class Date. Complete each of the following sentences by choosing the correct term from the word bank. Skills Worksheet Chapter Review USING KEY TERMS Complete each of the following sentences by choosing the correct term from the word bank. pistil rhizoid vascular plant rhizome xylem phloem pollen stamen

More information

2a. General: Describe 3 specialised uses for plants. Plants can be used as: i. raw materials ii. foods iii. medicines

2a. General: Describe 3 specialised uses for plants. Plants can be used as: i. raw materials ii. foods iii. medicines 1a. General: Give examples of advantages of there being a wide variety of plants. Greater number of characteristics for breeding. Bigger choice for use as raw materials, foods and medicines. Provide different

More information

SCI-4 BNES 4.4 Summative Exam not valid for Paper Pencil Test Sessions

SCI-4 BNES 4.4 Summative Exam not valid for Paper Pencil Test Sessions SCI-4 BNES 4.4 Summative Exam not valid for Paper Pencil Test Sessions [Exam ID:1LEHLS 1 Which seed is carried by the wind? A B C D 2 Which section of the plant is the roots? A Section 3 B Section 1 C

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative

More information

Plant Anatomy and Life Processes Study Guide

Plant Anatomy and Life Processes Study Guide Plant Anatomy and Life Processes Study Guide Science SOL 4.4 Please use this study guide to study daily for your test! Please keep this study guide in your HOMEWORK FOLDER so that you can use it to study

More information

The Coch gene controls the subsequent differentiation of pea axial meristems into lateral structures

The Coch gene controls the subsequent differentiation of pea axial meristems into lateral structures The Coch gene controls the subsequent differentiation of pea axial meristems into lateral structures Rozov, S.M. 1, Institute of Cytology and Genetics SD RAS, Novosibirsk, Russia Voroshilova, V.A. 2, 2

More information

Supplemental Figures. Supplemental Data. Sugliani et al. Plant Cell (2016) /tpc Clades RSH1. Rsh1[HS] RSH2 RSH3. Rsh4[HS] HYD TGS ACT

Supplemental Figures. Supplemental Data. Sugliani et al. Plant Cell (2016) /tpc Clades RSH1. Rsh1[HS] RSH2 RSH3. Rsh4[HS] HYD TGS ACT Supplemental Figures Clades RSH1 TP - HYD TGS ACT Rsh1[HS] RSH2 TP HYD SYN TGS Rsh2[HS] RSH3 TP HYD SYN TGS CRSH TP - SYN EFh Rsh4[HS] Supplemental Figure 1. Arabidopsis RSH domain structure. Schematic

More information

Hormonal and other chemical effects on plant growth and functioning. Bill Davies Lancaster Environment Centre, UK

Hormonal and other chemical effects on plant growth and functioning. Bill Davies Lancaster Environment Centre, UK Hormonal and other chemical effects on plant growth and functioning Bill Davies Lancaster Environment Centre, UK Integrating the impacts of soil drought and atmospheric stress High radiant load Reduced

More information

Supplementary Figure 1. Phenotype of the HI strain.

Supplementary Figure 1. Phenotype of the HI strain. Supplementary Figure 1. Phenotype of the HI strain. (A) Phenotype of the HI and wild type plant after flowering (~1month). Wild type plant is tall with well elongated inflorescence. All four HI plants

More information

[transport] in plants

[transport] in plants [transport] in plants learningobjectives Identify the main parts of the transport system in plants xylem and phloem. Explain the structural adaptation of the xylem (ie lumen, lignin and dead cells) Explain

More information

Unit 5: Plant Science. Mr. Nagel Meade High School

Unit 5: Plant Science. Mr. Nagel Meade High School Unit 5: Plant Science Mr. Nagel Meade High School Warm Up What significant roles do plants perform on Earth? How do you know? Name two modern issues that could be interrelated with plants. IB Syllabus

More information

Anatomy of Plants Student Notes

Anatomy of Plants Student Notes Directions: Fill in the blanks. Anatomy of Plants Student Notes Plant Cell Biology Segment 1. Plants Plants are organisms are incapable of movement produce food through 2. Animals Animals are multicellular

More information

Chapter 15 PLANT STRUCTURES AND TAXONOMY

Chapter 15 PLANT STRUCTURES AND TAXONOMY Chapter 15 PLANT STRUCTURES AND TAXONOMY Chapter 15: Parts of a plant Manufactures food by photosynthesis Attracts insects for pollination Contains seeds Supports branches and transports food and water

More information

Plants Review 1. List the 6 general characteristics of plants. 2. What did plants probably evolve from? 3. What are some advantages for life on land

Plants Review 1. List the 6 general characteristics of plants. 2. What did plants probably evolve from? 3. What are some advantages for life on land Plants Review 1. List the 6 general characteristics of plants. 2. What did plants probably evolve from? 3. What are some advantages for life on land for a plant? 4. What are the 3 main groups of plants?

More information

The FRD3 Citrate Effluxer Promotes Iron Nutrition between Symplastically Disconnected Tissues throughout Arabidopsis Development C W

The FRD3 Citrate Effluxer Promotes Iron Nutrition between Symplastically Disconnected Tissues throughout Arabidopsis Development C W The Plant Cell, Vol. 23: 2725 2737, July 2011, www.plantcell.org ã 2011 American Society of Plant Biologists. All rights reserved. The FRD3 Citrate Effluxer Promotes Iron Nutrition between Symplastically

More information

Nutrition and Transport in Plants Chapter 26. Outline

Nutrition and Transport in Plants Chapter 26. Outline Nutrition and Transport in Plants Chapter 26 Outline Essential Inorganic Nutrients Soil Formation Soil Profiles Soil Erosion Mineral Uptake Transport Mechanisms Water Organic Nutrients 1 2 Plant Nutrition

More information

Save My Exams! The Home of Revision For more awesome GCSE and A level resources, visit us at Microscopes.

Save My Exams! The Home of Revision For more awesome GCSE and A level resources, visit us at   Microscopes. Microscopes Question Paper 2 Level International Level Subject iology Exam oard IE Topic Microscopes Sub Topic ooklet Multiple hoice Paper Type Question Paper 2 Time llowed : 44 minutes Score : / 36 Percentage

More information

BIOLOGY. Plant Structure and Growth CAMPBELL. Reece Urry Cain Wasserman Minorsky Jackson

BIOLOGY. Plant Structure and Growth CAMPBELL. Reece Urry Cain Wasserman Minorsky Jackson CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 35 Plant Structure and Growth Lecture Presentation by Nicole Tunbridge and Kathleen Fitzpatrick Are Plants Computers? Romanesco

More information

COLLEGE OF THE NORTH ATLANTIC BIOLOGY Practice Final Exam

COLLEGE OF THE NORTH ATLANTIC BIOLOGY Practice Final Exam COLLEGE OF THE NORTH ATLANTIC BIOLOGY 1170 Practice Final Exam Students please take note: This exam has been produced and distributed solely as a practice exam. The questions are similar to questions that

More information

Stomata and water fluxes through plants

Stomata and water fluxes through plants Stomata and water fluxes through plants Bill Davies The Lancaster Environment Centre, UK Summary Stomata and responses to the environment Conductance, a function of frequency and aperture Measuring/estimating

More information

1 These are living cells that lack nuclei and ribosomes; they transport sugars and other organic nutrients

1 These are living cells that lack nuclei and ribosomes; they transport sugars and other organic nutrients 1 These are living cells that lack nuclei and ribosomes; they transport sugars and other organic nutrients collenchyma parenchyma sclerenchyma sieve cells tracheids 2 The fiber cells of plants are a type

More information

Chapter 18 Lecture. Concepts of Genetics. Tenth Edition. Developmental Genetics

Chapter 18 Lecture. Concepts of Genetics. Tenth Edition. Developmental Genetics Chapter 18 Lecture Concepts of Genetics Tenth Edition Developmental Genetics Chapter Contents 18.1 Differentiated States Develop from Coordinated Programs of Gene Expression 18.2 Evolutionary Conservation

More information

Supplemental Data. Yang et al. (2012). Plant Cell /tpc

Supplemental Data. Yang et al. (2012). Plant Cell /tpc Supplemental Figure 1. Mature flowers of P. heterotricha. (A) An inflorescence of P. heterotricha showing the front view of a zygomorphic flower characterized by two small dorsal petals and only two fertile

More information

Biological Roles of Cytokinins

Biological Roles of Cytokinins Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators

More information

SUBJECT: Integrated Science TEACHER: Mr. S. Campbell DATE: GRADE: 7 DURATION: 1 wk GENERAL TOPIC: Living Things Reproduce

SUBJECT: Integrated Science TEACHER: Mr. S. Campbell DATE: GRADE: 7 DURATION: 1 wk GENERAL TOPIC: Living Things Reproduce SUBJECT: Integrated Science TEACHER: Mr. S. Campbell DATE: GRADE: 7 DURATION: 1 wk GENERAL TOPIC: Living Things Reproduce Living Things and How They Reproduce Students will be able to:- 1) Identify root,

More information

Research Notes: G. B. Pant University of Agriculture and Technology

Research Notes: G. B. Pant University of Agriculture and Technology Volume 1 Article 6 4-1-1974 Research Notes: G. B. Pant University of Agriculture and Technology G. B. Pant University of Agriculture and Technology G. B. Pant University of Agriculture and Technology G.

More information

Plant Anatomy and Physiology. What are the parts of the plant, and how do they work?

Plant Anatomy and Physiology. What are the parts of the plant, and how do they work? Plant Anatomy and Physiology What are the parts of the plant, and how do they work? What is Classification GROUPING things according to their CHARACTERISTICS Plant Classification (5 Kingdoms) ANIMAL PLANT

More information

Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.

Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny

More information

Supporting Information

Supporting Information Supporting Information Cao et al. 10.1073/pnas.1306220110 Gram - bacteria Hemolymph Cytoplasm PGRP-LC TAK1 signalosome Imd dfadd Dredd Dnr1 Ikk signalosome P Relish Nucleus AMP and effector genes Fig.

More information

Reproduction, Seeds and Propagation

Reproduction, Seeds and Propagation Reproduction, Seeds and Propagation Diploid (2n) somatic cell Two diploid (2n) somatic cells Telophase Anaphase Metaphase Prophase I One pair of homologous chromosomes (homologues) II Homologues condense

More information

The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype.

The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype. Series 2: Cross Diagrams - Complementation There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:

More information

The bhlh Transcription Factor POPEYE Regulates Response to Iron Deficiency in Arabidopsis Roots W OA

The bhlh Transcription Factor POPEYE Regulates Response to Iron Deficiency in Arabidopsis Roots W OA The Plant Cell, Vol. 22: 2219 2236, July 2010, www.plantcell.org ã 2010 American Society of Plant Biologists The bhlh Transcription Factor POPEYE Regulates Response to Iron Deficiency in Arabidopsis Roots

More information

Cadmium uptake and partitioning in durum wheat during grain filling

Cadmium uptake and partitioning in durum wheat during grain filling Harris and Taylor BMC Plant Biology, : http://www.biomedcentral.com/7-9// RESEARCH ARTICLE Open Access Cadmium uptake and partitioning in durum wheat during grain filling Neil S Harris * and Gregory J

More information

Na+ recirculation in alfalfa and phloem transfer cell structure. N?ziha Boughanmi 1, Philippe Michonneau 2 and Pierrette Fleurat-Lessard 2

Na+ recirculation in alfalfa and phloem transfer cell structure. N?ziha Boughanmi 1, Philippe Michonneau 2 and Pierrette Fleurat-Lessard 2 Na+ recirculation in alfalfa and phloem transfer cell structure N?ziha Boughanmi 1, Philippe Michonneau 2 and Pierrette Fleurat-Lessard 2 1 D?partement des Sciences de la Vie. Facult? des Sciences de Bizerte.

More information

Plants for Food and Fibre

Plants for Food and Fibre Plants for Food and Fibre 1. List five ways that plants can be used. 2. What roles to plants play in the natural ecosystem? 3. Define the following a) Transpiration b) Capillary action c) Osmosis d) Diffusion

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature10534 Supplementary Fig. 1. Diagrammatic representation of the N-end rule pathway of targeted proteolysis (after Graciet and Wellmer 2010 9 ). Tertiary, secondary

More information

23 Structure of Flowering Plants

23 Structure of Flowering Plants 23 Structure of Flowering Plants Flowering plants first evolved around 125 million years ago. www.mrcbiology.com 1 23 Structure of Flowering Plants www.mrcbiology.com 2 24 Structure of Flowering Plants

More information

3. Diagram a cladogram showing the evolutionary relationships among the four main groups of living plants.

3. Diagram a cladogram showing the evolutionary relationships among the four main groups of living plants. OBJECTIVE SHEET PLANTS Phylum: Coniferophyta (gymnosperms the conifers) Phylum: Anthophyta (angiosperms the flowering plants) 1. Explain the alternation of generations in the two-phase life cycle of all

More information

** LCA LCN PCA

** LCA LCN PCA % of wild type value % of wild type value a 12 1 8 2 b 12 1 8 2 LCA LCN PCA Col- sod3-1 Supplementary Figure 1 sod3-1 influences cell proliferation. (a) Fifth leaf cell area (LCA) and leaf cell number

More information

Structures of Seed Plants

Structures of Seed Plants CHAPTER 12 SECTION 4 Introduction to Plants Structures of Seed Plants BEFORE YOU READ After you read this section, you should be able to answer these questions: What are the functions of roots and stems?

More information

Plants Notes. Plant Behavior Phototropism - growing towards light

Plants Notes. Plant Behavior Phototropism - growing towards light Plants Notes Plant Behavior Phototropism - growing towards light Geotropism - roots knowing which direction is down Thigmotropism - a plant's response to touch Ex. a vine wrapping around and climbing a

More information

active transport active transport support

active transport active transport support 1 Which row matches the cell membrane and cell wall of a palisade cell to their functions? cell membrane active transport active transport support support cell wall active transport support active transport

More information

Unit 2B- The Plants. Plants can be classified according to the presence or absence of vascular tissue.

Unit 2B- The Plants. Plants can be classified according to the presence or absence of vascular tissue. Unit 2B- The Plants Botany is the study of plants. All plants are said to have a common ancestor; (ie.) it is thought that plants have evolved from an ancient group of green algae. Plants and green algae

More information

BIOLOGY 317 Spring First Hourly Exam 4/20/12

BIOLOGY 317 Spring First Hourly Exam 4/20/12 Name: Lab sect. (TA name/time): BIOLOGY 317 Spring 2012 First Hourly Exam 4/20/12 1) (24 pts) Match the letter of the family given on the right with the characteristics for a plant described on the left.

More information

1 Mosses and other bryophytes are like ferns in that both bryophytes and ferns exhibit each of the following traits EXCEPT

1 Mosses and other bryophytes are like ferns in that both bryophytes and ferns exhibit each of the following traits EXCEPT Page 1 1 Mosses and other bryophytes are like ferns in that both bryophytes and ferns exhibit each of the following traits EXCEPT A haploid spores. B specialized cells and tissues. C vascular tissue for

More information