Hes5. Hes Relative mrna levels

Size: px

Start display at page:

Download "Hes5. Hes Relative mrna levels"

Hope Miller
5 years ago
Views:

A a Absolute mrna levels 6 5 4 3 2 1 hjag1 EP cdl1 EP

i EP Hey1 1 a Hes5 Hes5 a Hes5 Hes5 B a b EP e 1.4 1.

1..8.6.4.2 a Hes5 Hes5. Hey1 Hes5 Jag1 Dl1 Figure S1.

(A) Absolute hjag1 and cdl1 mrna levels (2 -ΔCt ) 12h

trafection levels are comparable. Values are mean ± s.

Coronal sectio of otic vesicles from chicken embryos

cdl1 (f-i) and allowed to develop one day in ovo.

Sectio were developed by ISH for Hey1 (b-c, f-g) or

(B) The expression patter of Hey1 (a-b) and Hes5 (c-d)

Similarly, Hey1, Hes5, Jag1 and Dl1 relative mrna

changed in otic vesicles electroporated with GFP when

Values are relative to control (not electroporated)

1 A a Absolute mrna levels hjag1 EP cdl1 EP Jag1 E2+1 b d m Hey1 c e EP Hey1 Dl1 E2+1 f h m Hey1 g i EP Hey1 1 a Hes5 Hes5 a Hes5 Hes5 B a b EP e EP GFP GFP E2+1 c m Hey1 d Hey1 Relative mrna levels a Hes5 Hes5. Hey1 Hes5 Jag1 Dl1 Figure S1. hjag1, cdl1 and GFP electroporatio. (A) Absolute hjag1 and cdl1 mrna levels (2 -ΔCt ) 12h after hjag1 and cdl1 electroporation indicate that trafection levels are comparable. Values are mean ± s.e.m. of five independent experiments (a). Coronal sectio of otic vesicles from chicken embryos that were electroporated at E2 with hjag1 (b-e) or cdl1 (f-i) and allowed to develop one day in ovo. The diagram on the top illustrates the procedure. Sectio were developed by ISH for Hey1 (b-c, f-g) or Hes5 (d-e, h-i) and stained for GFP (iet, green). (B) The expression patter of Hey1 (a-b) and Hes5 (c-d) were not altered by GFP electroporation. Similarly, Hey1, Hes5, Jag1 and Dl1 relative mrna levels evaluated by qrt-pcr are not significantly changed in otic vesicles electroporated with GFP when compared to control (not electroporated) otic vesicles. Values are relative to control (not electroporated) otic vesicles and are mean ± s.e.m. of tree independent experiments (e). Statistical significance was tested by comparing ΔCts in Student s t-test.

2 A B Hey1 absolute mrna levels (x1-2 ) * EP NICD ** ** ** Hes5 absolute mrna levels (x1-2 ) EP NICD ** * Log NICD (μg/ml) Log NICD (μg/ml) Figure S2. Hey1 and Hes5 are readouts of Notch signal strength. Absolute mrna levels (2 -ΔCt x1-2 ) of Hey1 (A, black dots and squares) and Hes5 (B, gray dots and squares) after electroporation at E2 with increasing concentratio of NICD and analysis one day after. Values are mean ± s.e.m. of duplicate analysis of n=4-5 independent experiments. Statistical significance was tested by comparing individual ΔCt from experimental and control (not electroporated) side from each experiment in Student s t-test.

A 8xCSL Luciferase B 12xCSL DSR 18 Relative Luciferase activity 15 12 9 6 3 1 2 NICD µg/µl pcig-egfp 12xCSLDsRed C 8xCSL Luciferase D 8xCSL Luciferase 6h LY411575 14 1.

(A) Relative Luciferase activity in HEK293T cells trafected with different levels of NICD. Luciferase expression is driven by 8 multimerized CSL binding sites and it is proportional to NICD levels.

3 A 8xCSL Luciferase B 12xCSL DSR 18 Relative Luciferase activity NICD µg/µl pcig-egfp 12xCSLDsRed C 8xCSL Luciferase D 8xCSL Luciferase 6h LY Relative Luciferase activity Relative Luciferase activity Figure S3. Quantification of the levels of Notch activity in the otic vesicle. (A) Relative Luciferase activity in HEK293T cells trafected with different levels of NICD. Luciferase expression is driven by 8 multimerized CSL binding sites and it is proportional to NICD levels. This experiment indicates that 8xCSL-Luc reporter is seitive to different levels of NICD. (B) Direct DsRed expression in one otic vesicle electroporated with 12xCSL-DsRed (n=8). DsRed expression is driven by 12 multimerized CSL binding sites. This experiment indicates that endogenous Notch activity can be detected in the otic vesicle using this cotruct. (C) Relative Luciferase activity in otic vesicles electroporated with 1 µg/µl mnicd and 8xCSL-Luc from n=3 independent experiments. As with DsRed, endogenous Notch activity can be detected with 8xCSL-Luc reporter (light grey) and reporter activity is significantly increased by co-trafection with mnicd (black), indicating that also in vivo, this reporter responds to increased concentration of NICD. (D) Relative Luciferase activity in otic vesicles electroporated with 8xCSL-Luc and cultured in the presence of LY for 6h, relative to otic vesicles cultured without inhibitor. This experiment indicates that the levels of Notch activity measured by Luciferase reporter activity decay after addition of LY to the culture medium.

4 A B Ligand Ligand Ligand Ligand Jag1 Notch Dl1 Notch Notch Jag1 Notch Dl1 time time Figure S4. Lateral induction drives ligand propagation, while lateral inhibition generates fine-grained patterning. (A) Lateral induction and (B) lateral inhibition circuits and its patterning effects. Top: mutual activation and mutual inhibition feedback loops between two equivalent adjacent cells. Middle: The circuit on the top is detailed for Notch signaling driven by a single ligand (Jag1 for A and Dl1 for B). Jag1 is activated by Notch, while Dl1 is inhibited by Notch. Bottom: Lateral induction and lateral inhibition of ligand occurring when a central cell expresses the ligand strongly (green for Jag1 and red for Dl1).

5 Figure S5. The absence of Atoh1 autoactivation reduces pattern maintenance capabilities. (A, B) correspond to panels 5E and 5G (middle) where additional regio with two stable homogeneous states (green at high!!, yellow and dark blue) computed from LSA (Methods and see below) are shown. These regio have been omitted in Fig. 5 for the sake of simplicity and compreheion of the figure since they do not inform about the proseory or hair cell pattern formation regio. We include them here for completitude. (C, D) Panels A and B without the Atoh1 autoactivation loop (! = ). In all panels, dashed red lines indicate pattern maintenance as in Fig. 5. In the absence of Atoh1 autoactivation, pattern maintenance regio are greatly reduced, as well as bistable regio for high Atoh1 productio. In contrast, pattern formation regio (light blue) remain nearly unchanged. Parameter values in all panels are as detailed in Materials and Methods. In all panels we used h! = 1, h!! =! h! = 4!. For! =, this drives the same effective cooperativity of Dl1 on Notch1 signaling (h! h!! = 4) as Jag1 has (h! = 4!). Results depicted in all panels corresponds to linear stability analysis (LSA, Materials and Methods). LSA as explained in Materials and Methods resulted in the following Routh-Hurwitz conditio (Murray, 22):!! > (S1)!!!! Ω!! Ω > (S2)!!!! Ω!! Ω!!! Ω!!! Ω!! Ω > (S3)!! Ω >, (S4) with!! = 1 +!! +!!!!!,!! Ω =!! + 1 +!!!! 1 +!! +!!!!!!Ω!!!!",!! Ω =!!!!!! +!! 1+!!!!!!Ω!!!!"!!" +!Ω!! (!!!!!!)!!"!! Ω =!!!!! Ω!!!!"!!!! Ω!!!!"!!"

6 where!!"!!!!!!!!"!!"! and!!!!!!!!!!!"!!"!. In these definitio, homo represents the homogeneous stationary state whose stability is evaluated,! and! stand for the model variables, the index! refers to a cell that is neighboring cell!, and! is the number of first neighbors. Ω is a parameter that takes discrete values within the interval Ω.5,1 and that accounts for different periodic perturbatio of the hexagonal lattice (Formosa-Jordan and Ibañes, 29). Ω =.5 refers to the periodicity characteristic of lateral inhibition patterning, while Ω = 1 refers to a homogeneous perturbation. Green regio correspond to parameter regio where two homogeneous solutio are stable and therefore satisfy inequalities S1-S4 for all Ω values. Light blue regio correspond to those parameter regio where at least one of the conditio S1-S4 is violated for Ω =.5 and not Ω = 1 (i.e. utable to Ω =.5 and stable to Ω = 1). In these regio and according to the LSA (notice that Ω =.5 is the perturbation that grows the fastest) the lateral inhibition pattern can emerge. These have been plotted in Fig. 5. The dark blue region in B corresponds to two homogeneous solutio stable to all Ω, plus another homogeneous solution utable to all Ω with the fastest growing mode at Ω =.5. This drives an irregular non periodic pattern. The yellow region in B has one homogeneous solution utable to all Ω with the fastest growing mode at Ω =.5 (i.e. an irregular non periodic pattern can emerge from this state), one homogeneous state stable to all Ω and one homogeneous state utable to Ω =.5 but not to Ω = 1 (i.e. a periodic pattern can emerge from this other state).

7 Figure S6. Jag1 switches its role when Dl1 arises. (A, B) Cartoo of interactio through Jag1 that are obtained from the model in Fig. 5B for equivalent cells. (A) In the absence of Dl1, Jag1 increases (arrow from cell to cell) the overall signal in an adjacent cell. Thus, the lateral induction module of Fig. S4A holds. (B) When there is enough Dl1 expressed, which signals with more strength than Jag1, Jag1 decreases the overall signal in the adjacent cell (blunt arrow from cell to cell). This decrease occurs because of competition between Dl1 and Jag1 for common resources of Notch signaling (Fig. 4). The cartoon shows that the regulatory interactio mediated by Jag1 ultimately drive mutual Jag1 inhibition between cells and therefore cotitute a novel type of lateral inhibition. The interactio mediated by Dl1, which correspond to those in Fig. S4B, are not included for simplicity. Note that the arrow and the blunt arrow between cells in A and B stand only for the net effect of Jag1 on Notch signal, which depends on the amount of competition. (C,D) Regio where Jag1 increases or decreases overall Notch signaling within the phase diagrams of Fig. 5E and 5G (middle) respectively. The blue dot-dashed line divides the space in these two regio. Hence, this line divides the parameter space in a region where Jag1 drives lateral induction as in A (left regio) and another region (right ones) where Jag1 drives the type of lateral inhibition as in B. This line is defined by!!!!!!!!!!"!!"! = where the derivative is computed at the homogeneous stationary state of the dynamics of Eq 1-4 (at the low Jag1 homogeneous state when multiple homogeneous states are present for high!!, which has similar Jag1 values as the high Jag1 state of the proseory). Hence, the derivative is evaluated on equivalent cells that express Jag1 and Dl1 (Dl1 is expressed at low values compared to those in hair cells), mimicking the equivalence of cells at the proseory state before hair cell patterning is set. Point II corresponds to fine-grained patterning (blue) arising when Jag1 production decreases overall Notch signaling and hence it is performing the type of lateral inhibition of panel B. D shows that fine-grained patterning for high Jag1 production (!! = 25) occurs when Jag1 reduces overall Notch signaling (i.e. drives mutual inhibition between adjacent cells).

8 a EP sicontrol b EP sijag1 c d e ac ac Jag1 ac Jag1 DsRed Jag1 Jag1 GFP f g h i j k Sox2 mu pc pc Sox2 DsRed Sox2 Sox2 DsRed MyoVIIa Figure S7. Stealth Jag1 downregulates Jag1 and Sox2 expression. Unaffected Jag1 expression after stealth control electroporation at E3.5+1 (a-b). Decreased Jag1 expression in stealth Jag1 electroporated crista at E3.5+2 (d-e) compared to non electroporated control (c). Unaffected Sox2 immunostaining after stealth control electroporation at E3.5+3 (f-g). Sox2 immunostaining of non electroporated (h), stealth Jag1 electroporated patch (i-j) and MyoVIIa immunostaining after stealth Jag1 electroporated patch at E3.5+3 in alternate section (k). DsRed and GFP were used as tracers for electroporation.

9 A B % 17.7 % Jag1 GOF 5% EP % 62.6 % Jag1 LOF 5% EP C total EP HCs EP HCs.6 s i.5 z i t t 6 d i 4 a i t t D % 86.7 % Jag1 LOF 8% EP % 46.3 % Jag1 GOF 5% EP % 79.9 % Jag1 GOF 8% EP % 49.8 % Jag1 GOF 5% EP % 54.8 % Jag1 LOF 5% EP Figure S8. Numerical simulatio of Jag1 gain of function (GOF) and loss of function (LOF) at different conditio. Hair cell (red) pattern at final simulation times and bar diagrams as in Fig. 6C. Each panel corresponds to a different condition which differs only in a single parameter value from the conditio of Fig. 6C: (A) GOF and LOF performed at earlier times (t EP =), (B) LOF with higher (8%) electroporation deity, (C) GOF with higher exogenous Jag1 electroporation levels (β z =5β z ), (D) GOF and LOF with higher endogenous production rates (β z =1). (A, left) Time evolution of each variable in different cells (each line corresponds to a different cell) for point II in Fig. 5E for CTL electroporatio. The pattern is not formed at t=t EP = nor at t=t EP =49. In all panels we used the color codes as in Fig. 6C. The threshold level of Atoh1 above which cells are coidered hair cells is the same for all cells, being electroporated or not, as done in Fig. 6C, and was computed as described in Materials and Methods. Accordingly, this threshold level is the same in panels A-C and in Fig. 6C (threshold level: 2.629). Panel D has a different threshold level, defined by its parameter values (threshold level: 2.33). All patter have been simulated with the same seed of random numbers for the initial condition that chooses which cells are electroporated. Therefore, all the snapshots that have the same percentage of electroporation have identical patter of electroporated cells (green cell borders). Bar diagrams are averages and s.e.m. over three different set of random numbers (i.e. patter of electroporation).

10 % 5 % Jag1 GOF Jag1 LOF 5% EP 5% EP Figure S9. Atoh1 autoactivation drives robustness to patterning. Numerical simulation of gain of function (GOF) and loss of function (LOF) as in Fig. 6C but in the absence of Atoh1 autoactivation (α=). Patterning is disrupted. Hair cells are defined at the same threshold level of Atoh1 as in Fig. 6C. All other parameter values and conditio as in Fig. 6C. The same identical patter of electroporation (green cell borders) have been used in both panels (as in Fig. S8 for the same percentage of electroporation). Despite the signal, ligands and Atoh1 activities driven by GOF and LOF are different (data not shown), they all result in the absence of HCs. Therefore, both patter look identical. Bar diagrams are averages and s.e.m. over three different set of random numbers (i.e. patter of electroporation).

Movie 1. Dynamics of ligand propagation through lateral induction. In silico dynamics of (left) Dl1 and (right) Jag1 corresponding to Fig. 5D. Movie 2.

Plots of these dynamics in different cells are shown in Fig. S8A. Simulation 1.

11 Movie 1. Dynamics of ligand propagation through lateral induction. In silico dynamics of (left) Dl1 and (right) Jag1 corresponding to Fig. 5D. Movie 2. Dynamics of fine grained pattern formation through lateral inhibition. In silico dynamics of (left) Dl1 and (right) Jag1 corresponding to Fig. 5F. Plots of these dynamics in different cells are shown in Fig. S8A. Simulation 1. Code for simulating ligand propagation and fine-grained patterning for the model with two ligands regulated oppositely by Notch. Mathematica notebook that integrates Eq (1-4) on a perfect hexagonal lattice with periodic boundary conditio and represents the results on a regular hexagonal cellular lattice. Homogeneous initial conditio with small perturbatio are used as explained in Methods. A local perturbation can be also included in the initial conditio for driving ligand propagation in the appropriate lateral induction regio. The code ru properly in both Mathematica 8. and 9. software. Download Simulation 1. PDF Download Simulation 1. Code

12 Table S1. Stealth Jag1 RNAi and stealth control duplex oligonucleotide sequences sirna si RNA sequence1 sirna sequence2 (reverse complement) si_jag1 #1 CCUUGUGAAGUAAUCGACAGCUGUA UACAGCUGUCGAUUACUUCACAAGG si_jag1#2 AUUGCAUGUUGCCUCAUCACACUGG CCAGUGUGAUGAGGCAACAUGCAAU si_jag1#3 CGGAGCAAAUACUGUUCCAAUUAAA UUUAAUUGGAACAGUAUUUGCUCCG si_ctrl #1 CCUAAGUAAUGAGCUCGACUGUGUA UACACAGUCGAGCUCAUUACUUAGG si_ctrl #2 AUUCAGACGUUUCGUCACCUCAUGG CCAUGAGGUGACGAAACGUCUGAAU st_ctrl #3 CGGAACAUAGUCCUUAACUUAGAAA UUUCUAAGUUAAGGACUAUGUUCCG Table S2. qrt-pcr primer sequences Gene Forward primer Reverse primer GAPDH TTGGCATTGTGGAGGGTCTT GTGGACGCTGGGATGATGTT chey1 CGGAGGGAAAGGTTATTTCG CAGCAATGGGTGAGATATGTG ches5 GAAATCCTGACACCCAAAGAG TCAATGCTGCTGTTAATCCT cdl1 TTGACCTGGGGAACTCCTAC GGTGCAGGAGTAGTCGTTGA cjag1 TGCCAGACGGTGCTAAGTG TCGAGGACCACACCAAACC hjag1 CAACCGTGCCAGTGACTATTTCTGC TGTTCCCGTGAAGCCTTTGTTACAG DSR CCAAGCTGAAGGTGACCAAG CCGTCCTCGAAGTTCATCAC Gapdh was used as calibrator gene.

targets. clustering show that different complex pathway

targets. clustering show that different complex pathway Supplementary Figure 1. CLICR allows clustering and activation of cytoplasmic protein targets. (a, b) Upon light activation, the Cry2 (red) and LRP6c (green) components co-cluster due to the heterodimeric