Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
|
|
|
- Benjamin Palmer
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting with both bosentan and K-8794 are colored green, the residue only interacting with bosentan is blue, and those only interacting with K-8794 are red, as shown in the figure. b, c, Effects of ET-1 on the release of AP-TGFα and antagonists on the ET-1-induced release of AP-TGFα in HEK293 cells expressing the endothelin receptors. In the competitive assays, the concentration of the agonist ET-1 was 0.2 nm, and the AP-TGFα release response in the ET-1 treatment alone was normalized to 100%. Symbols and error bars are means and s.e.m. (standard error of the mean), respectively. For most data points, the error bars are smaller than the symbols. d, e, Crystallographic data of the ET B -Y5-mT4L protein bound to K-8794 (d) and the ET B -Y4-mT4L protein bound to bosentan (e). The left panels show the crystals of the antagonist-bound ET B receptors. The middle and right panels show their crystal packings. T4L is shown as a grey cartoon, and the K and bosentan-bound ET B receptors are shown as orange and turquoise cartoons, respectively. Crystal lattices are indicated by black lines.
2 Supplementary Figure 2 Electron density. a, b, Fo Fc omit maps for K-8794 (a) and bosentan (b), contoured at 3.0 σ and 4.0 σ, respectively. TM6 and TM7 are omitted. c, The bosentan binding site, in which the colors represent the temperature factors ranging from 20 Å 2 (blue) to 120 Å 2 (red). d, Stereo view of the 2Fo Fc map, contoured at 1.0 σ, for the residues within 4 Å contact distances of the ligand in the K-8794-bound ET B structure. e,
3 Stereo views of the 2Fo Fc maps, contoured at 1.0 σ, for the residues within 4 Å contact distances of the ligand in the bosentan-bound ET B structure. f, Stereo view of the composite omit map, contoured at 1.0 σ, for the residues within 4 Å contact distances of the ligand in the bosentan-bound ET B structure.
4 Supplementary Figure 3 Comparison with other peptide-activated GPCRs. a c, Comparison of the antagonist binding sites of the peptide-activated GPCRs. Ribbon representations of the ET B receptor in complex with bosentan (a), Orexin receptor OX2 in complex with suvorexant (PDB accession number 4RNB) (b), and NOP receptor in complex with the peptidomimetic antagonist C-24 (PDB accession number 4EA3) (c) are aligned according to the position of Trp6.48, which is indicated by the stick model in each figure. The black dashed line indicates the position of the C atoms of Trp6.48. The smallmolecule antagonists are represented by stick models. Like the ET B receptor, OX2 belongs to the subfamily of the class A GPCRs, while NOP belongs to the subfamily. d, e, Electrostatic surfaces of the ET B structures bound to bosentan (d) and ET-1 (e), viewed from the extracellular side (left) and within the membrane plane (right). Bosentan and ET-1 are shown as sticks and transparent surfaces, colored blue and pink, respectively.
5 Supplementary Figure 4 Ligand-interaction diagrams. Interaction diagrams of K-8794 (a) and bosentan (b) with the ET B receptor. Interactions within 4 Å are shown. Polar and hydrophobic contacts are represented as red dashed and green lines, respectively.
6 Supplementary Figure 5 Homology between ET B and ET A. Amino acid sequence alignment of the human ET B (UniProt ID: P24530) and ET A (P25101) receptors. Secondary structure elements for -helices and -strands are indicated by cylinders and arrows, respectively. Conservation of the residues between ET A and ET B is indicated as follows: red panels for completely conserved, red letters for partially conserved, and black letters for not conserved. The residues involved in bosentan and K-8794 binding are shown as blue squares and orange diamonds, respectively.
7 Supplementary Figure 6 Small-molecule endothelin-receptor antagonists. Chemical structures of major small-molecule endothelin receptor antagonists. Endothelin receptor antagonists commonly have negatively-charged moieties (sulfonamide or carboxylate).
8 Supplementary Figure 7 Comparison of structural changes on ligand binding. a, b, Comparison of the ET-1 and bosentan binding modes, coloured as in Fig. 6. Receptors and ET-1 are represented by ribbons, and the side chains of ET and bosentan are shown as sticks with transparent surfaces. c, The residues that interact with both ET-1 and bosentan are superimposed. d f, Comparison of the structural changes upon ET-1 (d), bosentan (e), and K-8794 (f) binding, coloured as in Figs. 1 and 4.
9 Supplementary note The different moieties between bosentan and K-8794 are located adjacent to the TM2 helix, in which the amino acid sequences are most divergent between the ET A and ET B receptors (Fig. 3g). Especially, His , which is involved in the direct interaction with K-8794, is substituted with tyrosine in the ET A receptor. Therefore, we first hypothesized that the specific interaction between K-8794 and TM2 is predominantly responsible for the ET B-selectivity of K However, the His150Tyr mutation did not alter the affinity for either bosentan or K-8794 (Table 1b). In contrast, the mutation to a smaller side chain (His150Ala) greatly reduced the affinities for both bosentan and K-8794, although His is not involved in any direct interactions with bosentan (Table 1b and Fig 3c). Considering that the K-8794-bound structure was obtained with the construct containing the thermostabilizing mutant Asp154Ala, it is possible that this mutation slightly affects the shape of the binding pocket, by disrupting the electrostatic interaction between Asp and His , which is actually observed in the bosentan-bound structure. These data suggest that the interaction between K-8794 and His is not important for receptor binding, while His facilitates the binding of these antagonists by narrowing the shape of the binding pocket, rather than by forming any direct interactions. This is consistent with the previous mutation analysis of the ET A receptor, which showed that the bulky residue at position 2.53 is important for bosentan binding 1. 1 Webb, M. L. et al. Mutational analysis of the endothelin type A receptor (ETA): interactions and model of selective ETA antagonist BMS with putative ETA receptor binding cavity. Biochemistry. 35, , doi: /bi951836v (1996).
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group
SUPPLEMENTARY INFORMATION
Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3
SUPPLEMENTARY INFORMATION
Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,
Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).
Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
SUPPLEMENTARY INFORMATION
Supplementary Table 1: Data collection, phasing and refinement statistics ChbC/Ta 6 Br 12 Native ChbC Data collection Space group P4 3 2 1 2 P4 3 2 1 2 Cell dimensions a, c (Å) 132.75, 453.57 132.81, 452.95
SUPPLEMENTARY INFORMATION. doi: /nature07461
Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the
NB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5
SUPPLEMENTARY TABLES Suppl. Table 1. Protonation states at ph 7.4 and 4.5. Protonation states of titratable residues in GCase at ph 7.4 and 4.5. Histidine: HID, H at δ-nitrogen; HIE, H at ε-nitrogen; HIP,
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer
Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27
Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase
SUPPLEMENTARY INFORMATION
Supplementary Table 1: Amplitudes of three current levels. Level 0 (pa) Level 1 (pa) Level 2 (pa) TrkA- TrkH WT 200 K 0.01 ± 0.01 9.5 ± 0.01 18.7 ± 0.03 200 Na * 0.001 ± 0.01 3.9 ± 0.01 12.5 ± 0.03 200
Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein
Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08
Cks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved
Cks1 d CKS1 Supplementary Figure 1 The -Cks1 crystal lattice. (a) Schematic of the - Cks1 crystal lattice. -Cks1 crystallizes in a lattice that contains c 4 copies of the t - Cks1 dimer in the crystallographic
SUPPLEMENTARY INFORMATION
Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase
SUPPLEMENTARY INFORMATION
doi:1.138/nature1737 Supplementary Table 1 variant Description FSEC - 2B12 a FSEC - 6A1 a K d (leucine) c Leucine uptake e K (wild-type like) K (Y18F) K (TS) K (TSY) K288A mutant, lipid facing side chain
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11744 Supplementary Table 1. Crystallographic data collection and refinement statistics. Wild-type Se-Met-BcsA-B SmCl 3 -soaked EMTS-soaked Data collection Space
Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Chemical structure of LPS and LPS biogenesis in Gram-negative bacteria. a. Chemical structure of LPS. LPS molecule consists of Lipid A, core oligosaccharide and O-antigen. The polar
Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a
Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a series of tmfret-pairs comprised of single cysteine mutants
Supporting Information
Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)
Bacterial protease uses distinct thermodynamic signatures for substrate recognition
Bacterial protease uses distinct thermodynamic signatures for substrate recognition Gustavo Arruda Bezerra, Yuko Ohara-Nemoto, Irina Cornaciu, Sofiya Fedosyuk, Guillaume Hoffmann, Adam Round, José A. Márquez,
Supplementary Figure 1. Biochemical and sequence alignment analyses the
Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).
Supplementary information for:
SUPPLEMETARY IFRMATI Supplementary information for: Structure of a β 1 -adrenergic G protein-coupled receptor Tony Warne, Maria J. Serrano-Vega, Jillian G. Baker#, Rouslan Moukhametzianov, Patricia C.
SUPPLEMENTARY INFORMATION
Data collection Supplementary Table 1 Statistics of data collection, phasing and refinement Native Se-MAD Space group P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 50.4, 94.2, 115.4 49.8, 94.2,
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10955 Supplementary Figures Supplementary Figure 1. Electron-density maps and crystallographic dimer structures of the motor domain. (a f) Stereo views of the final electron-density maps
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/5/243/ra68/dc1 Supplementary Materials for Superbinder SH2 Domains Act as Antagonists of Cell Signaling Tomonori Kaneko, Haiming Huang, Xuan Cao, Xing Li, Chengjun
Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2
Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell
β1 Structure Prediction and Validation
13 Chapter 2 β1 Structure Prediction and Validation 2.1 Overview Over several years, GPCR prediction methods in the Goddard lab have evolved to keep pace with the changing field of GPCR structure. Despite
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Cryo-EM structure and model of the C. thermophilum 90S preribosome. a, Gold standard FSC curve showing the average resolution of the 90S preribosome masked and unmasked (left). FSC
Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
Potassium channel gating and structure!
Reading: Potassium channel gating and structure Hille (3rd ed.) chapts 10, 13, 17 Doyle et al. The Structure of the Potassium Channel: Molecular Basis of K1 Conduction and Selectivity. Science 280:70-77
SUPPLEMENTARY INFORMATION
www.nature.com/nature 1 Figure S1 Sequence alignment. a Structure based alignment of the plgic of E. chrysanthemi (ELIC), the acetylcholine binding protein from the snail Lymnea stagnalis (AchBP, PDB code
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.
Structural characterization of NiV N 0 P in solution and in crystal.
Supplementary Figure 1 Structural characterization of NiV N 0 P in solution and in crystal. (a) SAXS analysis of the N 32-383 0 -P 50 complex. The Guinier plot for complex concentrations of 0.55, 1.1,
Supporting information
Supporting information Fluorescent derivatives of AC-42 to probe bitopic orthosteric/allosteric binding mechanisms on muscarinic M1 receptors Sandrine B. Daval, Céline Valant, Dominique Bonnet, Esther
Supplementary Figure 3 a. Structural comparison between the two determined structures for the IL 23:MA12 complex. The overall RMSD between the two
Supplementary Figure 1. Biopanningg and clone enrichment of Alphabody binders against human IL 23. Positive clones in i phage ELISA with optical density (OD) 3 times higher than background are shown for
Bahnson Biochemistry Cume, April 8, 2006 The Structural Biology of Signal Transduction
Name page 1 of 6 Bahnson Biochemistry Cume, April 8, 2006 The Structural Biology of Signal Transduction Part I. The ion Ca 2+ can function as a 2 nd messenger. Pick a specific signal transduction pathway
Supporting Information
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2016 Supporting Information Lipid molecules can induce an opening of membrane-facing
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier
SUPPLEMENTARY INFORMATION
Fig. 1 Influences of crystal lattice contacts on Pol η structures. a. The dominant lattice contact between two hpol η molecules (silver and gold) in the type 1 crystals. b. A close-up view of the hydrophobic
Expanded View Figures
The EMBO Journal Structure of a Dm peptide bound to the OT module Tobias Raisch et al Expanded View Figures A Hs Dm 262 297 685 8 HEAT HEAT MIF4G 9BD 1SHD 761 91 193 169 1152 1317 16 1376 1467 HEAT HEAT
Supplementary Figure 1 Schematic overview of ASTNs in neuronal migration. (a) Schematic of roles played by ASTNs 1 and 2. ASTN-1-mediated adhesions
Supplementary Figure 1 Schematic overview of ASTNs in neuronal migration. (a) Schematic of roles played by ASTNs 1 and 2. ASTN-1-mediated adhesions undergo endocytosis into clathrin-coated vesicles dependent
Pymol Practial Guide
Pymol Practial Guide Pymol is a powerful visualizor very convenient to work with protein molecules. Its interface may seem complex at first, but you will see that with a little practice is simple and powerful
SUPPLEMENTARY INFORMATION
Figure S1. Secondary structure of CAP (in the camp 2 -bound state) 10. α-helices are shown as cylinders and β- strands as arrows. Labeling of secondary structure is indicated. CDB, DBD and the hinge are
Supplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine
Supplementary figure 1. Comparison of unbound and as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine GM-CSF (slate) with bound GM-CSF in the GIF:GM-CSF complex (GIF: green,
SUPPLEMENTARY INFORMATION
Supplementary Table S1 Kinetic Analyses of the AMSH-LP mutants AMSH-LP K M (μm) k cat x 10-3 (s -1 ) WT 71.8 ± 6.3 860 ± 65.4 T353A 76.8 ± 11.7 46.3 ± 3.7 F355A 58.9 ± 10.4 5.33 ± 0.30 proximal S358A 75.1
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),
Supplementary Figures
1 Supplementary Figures Supplementary Figure 1 Type I FGFR1 inhibitors (a) Chemical structures of a pyrazolylaminopyrimidine inhibitor (henceforth referred to as PAPI; PDB-code of the FGFR1-PAPI complex:
Apo and InsP 3 -bound crystal structures of the ligand-binding domain of an InsP 3 receptor
Published as: Nat Struct Mol Biol. ; 18(10): 1172 1174. Apo and InsP 3 -bound crystal structures of the ligand-binding domain of an InsP 3 receptor Chun-Chi Lin 1,2, Kyuwon Baek 1,2, and Zhe Lu 1 1 Department
Supplementary information
Supplementary information The structural basis of modularity in ECF-type ABC transporters Guus B. Erkens 1,2, Ronnie P-A. Berntsson 1,2, Faizah Fulyani 1,2, Maria Majsnerowska 1,2, Andreja Vujičić-Žagar
Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases
Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3
Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached
Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached to HpUreI. Urea hydrolysis products 2NH 3 and 1CO 2
Structural insights into Aspergillus fumigatus lectin specificity - AFL binding sites are functionally non-equivalent
Acta Cryst. (2015). D71, doi:10.1107/s1399004714026595 Supporting information Volume 71 (2015) Supporting information for article: Structural insights into Aspergillus fumigatus lectin specificity - AFL
SUPPLEMENTARY INFORMATION
Dph2 SeMet (iron-free) # Dph2 (iron-free) Dph2-[4Fe-4S] Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 58.26, 82.08, 160.42 58.74, 81.87, 160.01 55.70, 80.53,
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina
Supplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization
Supplementary Information Structural basis for precursor protein-directed ribosomal peptide macrocyclization Kunhua Li 1,3, Heather L. Condurso 1,3, Gengnan Li 1, Yousong Ding 2 and Steven D. Bruner 1*
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2
Protein Structure. W. M. Grogan, Ph.D. OBJECTIVES
Protein Structure W. M. Grogan, Ph.D. OBJECTIVES 1. Describe the structure and characteristic properties of typical proteins. 2. List and describe the four levels of structure found in proteins. 3. Relate
CH 3 CH 2 OH +H 2 O CHO. 2e + 2H + + O 2 H 2 O +HCOOH
2 4 H CH 3 2e + 2H + + 2 H 2 2 H CH 2 H 2e + 2H + + 2 H 2 2 H +H 2 CH 2e + 2H + + 2 H 2 2 H +HCH Supplemental Figure S. The three-step 4DM reaction, each step requires two reducing equivalents from ADPH
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Quantitation of the binding of pro53 peptide to sorla Vps10p measured by the AP reporter assay. The graph shows tracings of the typical chromogenic AP reaction observed with AP-pro53
Comparison between Bacteriorhodopsin and Halorhodopsin. Halorhodopsin (HR) and Bacteriorhodopsin (BR) belong to a subfamily of
Comparison between Bacteriorhodopsin and Halorhodopsin Halorhodopsin (HR) and Bacteriorhodopsin (BR) belong to a subfamily of heptahelical membrane proteins, the archaeal rhodopsins. They are found in
Identifying Interaction Hot Spots with SuperStar
Identifying Interaction Hot Spots with SuperStar Version 1.0 November 2017 Table of Contents Identifying Interaction Hot Spots with SuperStar... 2 Case Study... 3 Introduction... 3 Generate SuperStar Maps
SUPPLEMENTARY INFORMATION
doi:10.1038/nature17991 Supplementary Discussion Structural comparison with E. coli EmrE The DMT superfamily includes a wide variety of transporters with 4-10 TM segments 1. Since the subfamilies of the
BIRKBECK COLLEGE (University of London)
BIRKBECK COLLEGE (University of London) SCHOOL OF BIOLOGICAL SCIENCES M.Sc. EXAMINATION FOR INTERNAL STUDENTS ON: Postgraduate Certificate in Principles of Protein Structure MSc Structural Molecular Biology
Acta Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural characterization of the virulence factor Nuclease A from Streptococcus agalactiae
SI Text S1 Solution Scattering Data Collection and Analysis. SI references
SI Text S1 Solution Scattering Data Collection and Analysis. The X-ray photon energy was set to 8 kev. The PILATUS hybrid pixel array detector (RIGAKU) was positioned at a distance of 606 mm from the sample.
Supporting Information
Supporting Information Superagonist, Full Agonist, Partial Agonist and Antagonist Actions of Arylguanidines at 5-Hydroxytryptamine-3 (5-HT 3 ) Subunit A Receptors Katie Alix, Shailesh Khatri, Philip D.
FW 1 CDR 1 FW 2 CDR 2
Supplementary Figure 1 Supplementary Figure 1: Interface of the E9:Fas structure. The two interfaces formed by V H and V L of E9 with Fas are shown in stereo. The Fas receptor is represented as a surface
Supporting Information
Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,
Homology Models of Human Adrenergic Receptors
58 Chapter 4 Homology Models of Human Adrenergic Receptors The increased availability of high-resolution GPCR crystal structures has enabled deeper investigation into homology modeling as a method for
of the Guanine Nucleotide Exchange Factor FARP2
Structure, Volume 21 Supplemental Information Structural Basis for Autoinhibition of the Guanine Nucleotide Exchange Factor FARP2 Xiaojing He, Yi-Chun Kuo, Tyler J. Rosche, and Xuewu Zhang Inventory of
Supporting Information
Supporting Information Development of a human vasopressin V 1a -receptor antagonist from an evolutionary-related insect neuropeptide Maria Giulia Di Giglio, Markus Muttenthaler, Kasper Harpsøe, Zita Liutkeviciute,
Detailed description of overall and active site architecture of PPDC- 3dThDP, PPDC-2HE3dThDP, PPDC-3dThDP-PPA and PPDC- 3dThDP-POVA
Online Supplemental Results Detailed description of overall and active site architecture of PPDC- 3dThDP, PPDC-2HE3dThDP, PPDC-3dThDP-PPA and PPDC- 3dThDP-POVA Structure solution and overall architecture
Impact of the crystallization condition on importin-β conformation
Supporting information Volume 72 (2016) Supporting information for article: Impact of the crystallization condition on importin-β conformation Marcel J. Tauchert, Clément Hémonnot, Piotr Neumann, Sarah
Viewing and Analyzing Proteins, Ligands and their Complexes 2
2 Viewing and Analyzing Proteins, Ligands and their Complexes 2 Overview Viewing the accessible surface Analyzing the properties of proteins containing thousands of atoms is best accomplished by representing
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Different crystal forms obtained for Sky
Supplementary Figure 1 Different crystal forms obtained for Sky 1 353. (a) Crystal form 1 obtained in the presence of 20% PEG 3350 and 0.2 M ammonium citrate tribasic ph 7.0. (b) Crystal form 1 of the
NGF - twenty years a-growing
NGF - twenty years a-growing A molecule vital to brain growth It is twenty years since the structure of nerve growth factor (NGF) was determined [ref. 1]. This molecule is more than 'quite interesting'
SUPPLEMENTARY INFORMATION
UPPEER ORO doi:10.1038/nature10753 D D D D P E ntracellular C1 W P P C EC1 D Q R H C D W D R C C2 D E D E C R Q Q W P W W R P P EC2 EC3 P C C P W P W W P C W H R C R E C3 P R R P P P C Extracellular embrane
Protein Structure and Visualisation. Introduction to PDB and PyMOL
Protein Structure and Visualisation Introduction to PDB and PyMOL 1 Feedback Persons http://www.bio-evaluering.dk/ 2 Program 8.00-8.15 Quiz results 8.15-8.50 Introduction to PDB & PyMOL 8.50-9.00 Break
Supplementary Information. Viral immunoevasin targeting of a Natural Killer cell receptor family
Supplementary Information Viral immunoevasin targeting of a Natural Killer cell receptor family Richard Berry 1, Natasha Ng 1, Philippa M. Saunders 2, Julian P. Vivian 1, Jie Lin 2, Felix A. Deuss 1, Alexandra
SUPPLEMENTARY INFORMATION
Supplementary Figure 1: The HpUreI crystal used for collection of native diffraction data. The crystal belongs to spacegroup P4 2 2 1 2 and has an approximate maximal dimension of 0.25 mm. Supplementary
Nature Structural & Molecular Biology doi: /nsmb Supplementary Figure 1. CRBN binding assay with thalidomide enantiomers.
Supplementary Figure 1 CRBN binding assay with thalidomide enantiomers. (a) Competitive elution assay using thalidomide-immobilized beads coupled with racemic thalidomide. Beads were washed three times
Building a Homology Model of the Transmembrane Domain of the Human Glycine α-1 Receptor
Building a Homology Model of the Transmembrane Domain of the Human Glycine α-1 Receptor Presented by Stephanie Lee Research Mentor: Dr. Rob Coalson Glycine Alpha 1 Receptor (GlyRa1) Member of the superfamily
Supplementary Figure 1 Structure of the Orai channel. (a) The hexameric Drosophila Orai channel structure derived from crystallography 1 comprises
Supplementary Figure 1 Structure of the Orai channel. (a) The hexameric Drosophila Orai channel structure derived from crystallography 1 comprises six Orai subunits, each with identical amino acid sequences
T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp
S u p p l e m e n ta l m at e r i a l jgp Lee et al., http://www.jgp.org/cgi/content/full/jgp.201411219/dc1 T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y S u p p l e m e n ta l D I S C U S
Right click on the link and save the file on the disk (Save link target as...). Then execute this in the command window:
Läkemedelsutveckling ht 2005 Copyright 2005 Lars Brive Excercise Analysis of structures of protein ligand complexes In this excercise you will examine the geometrical features of six x ray structures in
Computational modeling of G-Protein Coupled Receptors (GPCRs) has recently become
Homology Modeling and Docking of Melatonin Receptors Andrew Kohlway, UMBC Jeffry D. Madura, Duquesne University 6/18/04 INTRODUCTION Computational modeling of G-Protein Coupled Receptors (GPCRs) has recently
The Fic protein Doc uses an inverted substrate to phosphorylate and. inactivate EF-Tu
The Fic protein Doc uses an inverted substrate to phosphorylate and inactivate EF-Tu Daniel Castro-Roa 1, Abel Garcia-Pino 2,3 *, Steven De Gieter 2,3, Nico A.J. van Nuland 2,3, Remy Loris 2,3, Nikolay
Supplemental Information
Supplemental Information Combinatorial Readout of Unmodified H3R2 and Acetylated H3K14 by the Tandem PHD Finger of MOZ Reveals a Regulatory Mechanism for HOXA9 Transcription Yu Qiu 1, Lei Liu 1, Chen Zhao
Design of a Novel Globular Protein Fold with Atomic-Level Accuracy
Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Brian Kuhlman, Gautam Dantas, Gregory C. Ireton, Gabriele Varani, Barry L. Stoddard, David Baker Presented by Kate Stafford 4 May 05 Protein
Dr. Yonca Yuzugullu PERG (Protein Engineering Research Group)
Dr. Yonca Yuzugullu PERG (Protein Engineering Research Group) BSc, 1997 Ankara University, Turkey PhD, 2010 Middle East Technical University, Turkey Lecturer in Department of Biology Kocaeli University,
Homology models of the tetramerization domain of six eukaryotic voltage-gated potassium channels Kv1.1-Kv1.6
Homology models of the tetramerization domain of six eukaryotic voltage-gated potassium channels Kv1.1-Kv1.6 Hsuan-Liang Liu* and Chin-Wen Chen Department of Chemical Engineering and Graduate Institute
Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
ENZYME MECHANISMS, PROTEASES, STRUCTURAL BIOLOGY
Supplementary Information SUBJECT AREAS: ENZYME MECHANISMS, PROTEASES, STRUCTURAL BIOLOGY Correspondence and requests for materials should be addressed to N.T. (ntanaka@pharm.showa-u.ac.jp) or W.O. (owataru@vos.nagaokaut.ac.jp)
RNA Polymerase I Contains a TFIIF-Related DNA-Binding Subcomplex
Molecular Cell, Volume 39 Supplemental Information RNA Polymerase I Contains a TFIIFRelated DNABinding Subcomplex Sebastian R. Geiger, Kristina Lorenzen, Amelie Schreieck, Patrizia Hanecker, Dirk Kostrewa,
Molecular Basis of K + Conduction and Selectivity
The Structure of the Potassium Channel: Molecular Basis of K + Conduction and Selectivity -Doyle, DA, et al. The structure of the potassium channel: molecular basis of K + conduction and selectivity. Science
Membrane proteins Porins: FadL. Oriol Solà, Dimitri Ivancic, Daniel Folch, Marc Olivella
Membrane proteins Porins: FadL Oriol Solà, Dimitri Ivancic, Daniel Folch, Marc Olivella INDEX 1. INTRODUCTION TO MEMBRANE PROTEINS 2. FADL: OUTER MEMBRANE TRANSPORT PROTEIN 3. MAIN FEATURES OF FADL STRUCTURE