SI Text S1 Solution Scattering Data Collection and Analysis. SI references
|
|
- Violet Mason
- 5 years ago
- Views:
Transcription
1 SI Text S1 Solution Scattering Data Collection and Analysis. The X-ray photon energy was set to 8 kev. The PILATUS hybrid pixel array detector (RIGAKU) was positioned at a distance of 606 mm from the sample. ΔTGEE heme rho-1 purified with the size-exclusion chromatography as described in Methods was concentrated up to 10 mg/ml. Scattering profile simulations from the crystal structure were carried out using CRYSOL (1). Ab initio dummy model was constructed with DAMMIN (2). SI references 1. Svergun D, Barberato C, Koch MHJ (1995) CRYSOL - a Program to Evaluate X- ray Solution Scattering of Biological Macromolecules from Atomic Coordinates. J. Appl. Crystallogr. 28: Svergun DI (1999) Restoring low resolution structure of biological macromolecules from solution scattering using simulated annealing. Biophys. J. 76:
2 Fig. S1 Confirmation of the generation of biliverdin-iron chelate during the single turnover reaction of heme-rho-1 supported with NADPH ΔTGEE system. The spectrum was recorded 70 min after the addition of desferrioxamine (final conc. 2 mm) into the reaction mixture at 220 min after the addition of NADPH at 25 C (Fig. 1B). Characteristic peak of biliverdin around 670 nm was observed.
3 (A) (B) ΔTGEE rho-1 (C) Fig. S2 Characterization of the co-eluted fraction shown in Fig. 3. (A) Absorption spectrum and (B) SDS/PAGE stained with Coomassie Brilliant Blue of the fraction (47.5 ml fraction in Fig. 3) co-eluted from the size-exclusion column onto which a mixture of ΔTGEE and heme rho-1 was applied. The absorption peak at 405 nm and the shoulder around nm represent heme rho-1 complex and ΔTGEE, respectively. (C) Elution profile of a mixture of ΔTGEE and apo rho-1 from size exclusion column. First and second peaks were eluted at 50.9 ml and 58.6 ml, respectively. The experimental conditions were the same as described in the legend for Fig. 3.
4 (A) (B) (C) (D) Fig. S3 Electron density of ΔTGEE heme rho-1 complex. (A) Cα trace of two independent ΔTGEE heme rho-1 complexes was superimposed on the electron density contoured by 1.0 σ. FMN and FAD domains, and rho-1 were colored yellow, orange, and magenta, respectively. Electron density and Cα trace were shown as a stereo diagram. (B) Close-up view of heme and FMN. Omit map of heme, FMN, FAD, and NADP + contoured by 3.0 σ (green) was also superimposed on the electron density (gray) and Cα trace. (C) Close-up view of FAD and NADP +. (D) Difference anomalous Fourier map calculated with the data obtained using 1.5 Å wavelength X-ray. Difference anomalous map (white) contoured by 4.5 σ was superimposed onto the ribbon model of the complex. Magenta and yellow chains showed ΔTGEE, whereas green and blue chains showed heme rho-1. Anomalous peaks were observed at the heme irons.
5 (A) (B). Fig. S4 Comparison of the crystal structure and SAXS result. (A) Experimental X-ray scattering curve from ΔTGEE heme rho-1 complex (solid line) and theoretical curve estimated from the crystal structure (dotted line). Radius of gyration from Guinier approximation was 3.05 nm, which is similar to that obtained from the crystal structure (2.92 nm). (B) Superimposition of the ribbon model of ΔTGEE heme rho-1 complex onto the ab initio dummy atom model obtained from SAXS result.
6 Fig. S5 Superimposition of ΔTGEE heme rho-1 onto ΔTGEE (PDB ID: 3ES9). ΔTGEE and rho-1 in ΔTGEE heme rho-1 was colored as yellow and pink, respectively. The least extended form of ΔTGEE (Mol A) was colored green. Other extended forms, Mols B and C, were shown in cyan and magenta, respectively. Only the co-factors of ΔTGEE in ΔTGEE heme rho-1 complex were shown for clarity. All FAD domains were fitting well, whereas FMN domain in each ΔTGEE showed different arrangements.
7 Fig. S6 Introduction of Cys mutations for formation of intermolecular disulfide bonds between CPR and rho-1. FMN and FAD domains and rho-1 were colored with yellow, orange, and pink, respectively. Mutated sites were shown as cyan stick models. FMN, FAD and heme were shown as blue stick models.
8 Fig. S7 Western blot analysis of artificial disulfide bond formation between CPR and heme rho-1 with anti-cpr or anti-rho-1 antibodies. SDS/PAGE was performed without 2-mercaptoethanol.
9 Fig. S8 Superimposition of ΔTGEE heme rho-1 onto the FMN and heme domains of cytochrome P450 BM3 (PDB ID: 1BVY). Superimposition was done so as to minimize the root-mean-square difference of FMN molecule. ΔTGEE heme rho-1 was colored as in Fig. 4. Ribbon model of FMN and heme domains of cytochrome P450 BM3 were yellow-green and red, respectively. FMN and heme in cytochrome P450 BM3 were shown as cyan stick models.
10 Table S1 Data collection and refinement statistics ΔTGEE heme rho-1 complex Data collection Space group P6 1 Cell dimensions (Å) a = b = 290.3, c = 83.6 Resolution (Å) ( ) * a R sy m (0.888) I / σi 6.2 (2.8) Completeness (%) 99.9(100) Redundancy 12.0 (10.3) Refinement Resolution (Å) No. reflections R work / R b free 0.22 / 0.26 No. atoms Protein Ligand 316 B-factors Protein Ligand R.m.s. deviations Bond lengths (Å) Bond angles ( ) *Values in parentheses are for highest-resolution shell. a R sym = Σ hkl Σ i I i (hkl) - <I(hkl)> / Σ hkl Σ i I i (hkl), <I(hkl)> is the mean intensity for multiple recorded reflections. b R work = Σ F obs (hkl) - F calc (hkl) / Σ F obs (hkl). R free is the R cryst calculated for the five percent of the dataset not included in the refinement.
11 Table S2. Oligonucleotide sequences to produce ΔTGEE and Cys-introduced mutants of CPR and rho-1. ΔTGEE-f GGCTTCTACCCCAAAGAACTC ΔTGEE-r TCGAGCATTCGCCAGTATGAG T88C-CPR-f CAGTGTGGAACCGCTGAGGAG T88C-CPR-r GGAGCCATAGAATACGATAATG Q517C-CPR-f TCTTGTTTCCGCTTGCCTTTCAAG Q517C-CPR-r TTTGCGCACGAACATGGGTAC V146C-HO-f CAGTGCCTGAAGAAGATTGCGC V146C-HO-r ACCCCCTGAGAGGTCACC K177C-HO-f ACCTGTTTCAAACAGCTCTATCGTG K177C-HO-r GGGGTTGTCGATGCTCGG The sites for Cys-introduced mutations were underlined.
SUPPLEMENTARY INFORMATION
www.nature.com/nature 1 Figure S1 Sequence alignment. a Structure based alignment of the plgic of E. chrysanthemi (ELIC), the acetylcholine binding protein from the snail Lymnea stagnalis (AchBP, PDB code
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the
More informationCrystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions. Implicated in Dimerization and Autoinhibition
JBC Papers in Press. Published on November 1, 2000 as Manuscript M006502200 Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions Implicated in Dimerization and Autoinhibition 1 Copyright
More informationSupplementary Figure 1. Biochemical and sequence alignment analyses the
Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).
More informationTable S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
More informationSUPPLEMENTARY INFORMATION. doi: /nature07461
Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.
More informationCharacterizing Biological Macromolecules by SAXS Detlef Beckers, Jörg Bolze, Bram Schierbeek, PANalytical B.V., Almelo, The Netherlands
Characterizing Biological Macromolecules by SAXS Detlef Beckers, Jörg Bolze, Bram Schierbeek, PANalytical B.V., Almelo, The Netherlands This document was presented at PPXRD - Pharmaceutical Powder X-ray
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),
More informationPlasmid Relevant features Source. W18N_D20N and TrXE-W18N_D20N-anti
Table S1. E. coli plasmids Plasmid Relevant features Source pdg680 T. reesei XynII AA 2-190 with C-terminal His 6 tag optimized for E. coli expression in pjexpress401 Wan et al. (in press) psbn44d psbn44h
More informationStructure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits AhpC and AhpF from Escherichia coli Phat Vinh Dip 1,#, Neelagandan Kamariah 2,#, Malathy Sony Subramanian Manimekalai
More informationTable 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2
Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell
More informationSOCS3 binds specific receptor JAK complexes to control cytokine signaling by direct kinase inhibition SUPPLEMENTARY INFORMATION
SOCS3 binds specific receptor JAK complexes to control cytokine signaling by direct kinase inhibition Nadia J. Kershaw 1,2, James M. Murphy 1,2, Nicholas P.D. Liau 1,2, Leila N. Varghese 1,2, Artem Laktyushin
More informationCrystal lattice Real Space. Reflections Reciprocal Space. I. Solving Phases II. Model Building for CHEM 645. Purified Protein. Build model.
I. Solving Phases II. Model Building for CHEM 645 Purified Protein Solve Phase Build model and refine Crystal lattice Real Space Reflections Reciprocal Space ρ (x, y, z) pronounced rho F hkl 2 I F (h,
More informationIgE binds asymmetrically to its B cell receptor CD23
Supplementary Information IgE binds asymmetrically to its B cell receptor CD23 Balvinder Dhaliwal 1*, Marie O. Y. Pang 2, Anthony H. Keeble 2,3, Louisa K. James 2,4, Hannah J. Gould 2, James M. McDonnell
More informationSUPPLEMENTARY INFORMATION
Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1: Amplitudes of three current levels. Level 0 (pa) Level 1 (pa) Level 2 (pa) TrkA- TrkH WT 200 K 0.01 ± 0.01 9.5 ± 0.01 18.7 ± 0.03 200 Na * 0.001 ± 0.01 3.9 ± 0.01 12.5 ± 0.03 200
More informationSUPPLEMENTARY INFORMATION
Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
More informationSUPPLEMENTARY INFORMATION
Supplementary Table S1 Kinetic Analyses of the AMSH-LP mutants AMSH-LP K M (μm) k cat x 10-3 (s -1 ) WT 71.8 ± 6.3 860 ± 65.4 T353A 76.8 ± 11.7 46.3 ± 3.7 F355A 58.9 ± 10.4 5.33 ± 0.30 proximal S358A 75.1
More informationSUPPLEMENTARY INFORMATION
Dph2 SeMet (iron-free) # Dph2 (iron-free) Dph2-[4Fe-4S] Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 58.26, 82.08, 160.42 58.74, 81.87, 160.01 55.70, 80.53,
More informationSupplementary Information
Supplementary Information The direct role of selenocysteine in [NiFeSe] hydrogenase maturation and catalysis Marta C. Marques a, Cristina Tapia b, Oscar Gutiérrez-Sanz b, Ana Raquel Ramos a, Kimberly L.
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11744 Supplementary Table 1. Crystallographic data collection and refinement statistics. Wild-type Se-Met-BcsA-B SmCl 3 -soaked EMTS-soaked Data collection Space
More informationID14-EH3. Adam Round
Bio-SAXS @ ID14-EH3 Adam Round Contents What can be obtained from Bio-SAXS Measurable parameters Modelling strategies How to collect data at Bio-SAXS Procedure Data collection tests Data Verification and
More informationSUPPLEMENTARY INFORMATION
Fig. 1 Influences of crystal lattice contacts on Pol η structures. a. The dominant lattice contact between two hpol η molecules (silver and gold) in the type 1 crystals. b. A close-up view of the hydrophobic
More informationSupplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases
Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3
More informationSUPPLEMENTARY INFORMATION
Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3
More informationActa Cryst. (2017). D73, doi: /s
Acta Cryst. (2017). D73, doi:10.1107/s2059798317010932 Supporting information Volume 73 (2017) Supporting information for article: Designing better diffracting crystals of biotin carboxyl carrier protein
More informationNitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein
Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08
More informationExpanded View Figures
The EMBO Journal Structure of a Dm peptide bound to the OT module Tobias Raisch et al Expanded View Figures A Hs Dm 262 297 685 8 HEAT HEAT MIF4G 9BD 1SHD 761 91 193 169 1152 1317 16 1376 1467 HEAT HEAT
More informationPurification, SDS-PAGE and cryo-em characterization of the MCM hexamer and Cdt1 MCM heptamer samples.
Supplementary Figure 1 Purification, SDS-PAGE and cryo-em characterization of the MCM hexamer and Cdt1 MCM heptamer samples. (a-b) SDS-PAGE analysis of the hexamer and heptamer samples. The eluted hexamer
More informationStabilizing the CH2 domain of an Antibody by Engineering in an Enhanced Aromatic Sequon
Stabilizing the CH2 domain of an Antibody by Engineering in an Enhanced Aromatic Sequon Wentao Chen,, Leopold Kong, Stephen Connelly, Julia M. Dendle,, Yu Liu,, Ian A. Wilson,#, Evan T. Powers, *, Jeffery
More informationElectronic Supplementary Information (ESI) for Chem. Commun. Unveiling the three- dimensional structure of the green pigment of nitrite- cured meat
Electronic Supplementary Information (ESI) for Chem. Commun. Unveiling the three- dimensional structure of the green pigment of nitrite- cured meat Jun Yi* and George B. Richter- Addo* Department of Chemistry
More informationSupplemental Information. Structural and Mechanistic Paradigm. of Leptin Receptor Activation Revealed
Structure, Volume 22 Supplemental Information Structural and Mechanistic Paradigm of Leptin Receptor Activation Revealed by Complexes with Wild-Type and Antagonist Leptins Kedar Moharana, Lennart Zabeau,
More informationSUPPLEMENTARY INFORMATION
Data collection Supplementary Table 1 Statistics of data collection, phasing and refinement Native Se-MAD Space group P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 50.4, 94.2, 115.4 49.8, 94.2,
More informationModelling against small angle scattering data. Al Kikhney EMBL Hamburg, Germany
Modelling against small angle scattering data Al Kikhney EMBL Hamburg, Germany Validation of atomic models CRYSOL Rigid body modelling SASREF BUNCH CORAL Oligomeric mixtures OLIGOMER Flexible systems EOM
More informationBiological Small Angle X-ray Scattering (SAXS) Dec 2, 2013
Biological Small Angle X-ray Scattering (SAXS) Dec 2, 2013 Structural Biology Shape Dynamic Light Scattering Electron Microscopy Small Angle X-ray Scattering Cryo-Electron Microscopy Wide Angle X- ray
More informationSmall-Angle X-ray Scattering (SAXS) SPring-8/JASRI Naoto Yagi
Small-Angle X-ray Scattering (SAXS) SPring-8/JASRI Naoto Yagi 1 Wikipedia Small-angle X-ray scattering (SAXS) is a small-angle scattering (SAS) technique where the elastic scattering of X-rays (wavelength
More informationSupplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer
More informationDiphthamide biosynthesis requires a radical iron-sulfur enzyme. Pennsylvania State University, University Park, Pennsylvania 16802, USA
Diphthamide biosynthesis requires a radical iron-sulfur enzyme Yang Zhang, 1,4 Xuling Zhu, 1,4 Andrew T. Torelli, 1 Michael Lee, 2 Boris Dzikovski, 1 Rachel Koralewski, 1 Eileen Wang, 1 Jack Freed, 1 Carsten
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting
More informationSupporting Information. UV-induced ligand exchange in MHC class I protein crystals
Supporting Information for the article entitled UV-induced ligand exchange in MHC class I protein crystals by Patrick H.N. Celie 1, Mireille Toebes 2, Boris Rodenko 3, Huib Ovaa 3, Anastassis Perrakis
More informationCH 3 CH 2 OH +H 2 O CHO. 2e + 2H + + O 2 H 2 O +HCOOH
2 4 H CH 3 2e + 2H + + 2 H 2 2 H CH 2 H 2e + 2H + + 2 H 2 2 H +H 2 CH 2e + 2H + + 2 H 2 2 H +HCH Supplemental Figure S. The three-step 4DM reaction, each step requires two reducing equivalents from ADPH
More informationSupplemental Data SUPPLEMENTAL FIGURES
Supplemental Data CRYSTAL STRUCTURE OF THE MG.ADP-INHIBITED STATE OF THE YEAST F 1 C 10 ATP SYNTHASE Alain Dautant*, Jean Velours and Marie-France Giraud* From Université Bordeaux 2, CNRS; Institut de
More informationSUPPLEMENTARY INFORMATION
doi:10.108/nature11899 Supplementar Table 1. Data collection and refinement statistics (+TPMP, native) (-TPMP, native) (+TPMP, recombinant) (MgCl ) (MgSO ) Data collection Space group C P 1 C P 1 1 P 1
More informationDr. Yonca Yuzugullu PERG (Protein Engineering Research Group)
Dr. Yonca Yuzugullu PERG (Protein Engineering Research Group) BSc, 1997 Ankara University, Turkey PhD, 2010 Middle East Technical University, Turkey Lecturer in Department of Biology Kocaeli University,
More informationExperimental and Computational Mutagenesis to Investigate the. Positioning of a General Base within an Enzyme Active Site
Experimental and Computational Mutagenesis to Investigate the Positioning of a General Base within an Enzyme Active Site Jason P. Schwans, Philip Hanoian, Benjamin J. Lengerich, Fanny Sunden, Ana Gonzalez
More informationActa Crystallographica Section F
Supporting information Acta Crystallographica Section F Volume 70 (2014) Supporting information for article: Chemical conversion of cisplatin and carboplatin with histidine in a model protein crystallised
More informationTHE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina
More informationActa Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural characterization of the virulence factor Nuclease A from Streptococcus agalactiae
More informationX-ray Crystallography. Kalyan Das
X-ray Crystallography Kalyan Das Electromagnetic Spectrum NMR 10 um - 10 mm 700 to 10 4 nm 400 to 700 nm 10 to 400 nm 10-1 to 10 nm 10-4 to 10-1 nm X-ray radiation was discovered by Roentgen in 1895. X-rays
More informationSupplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine
Supplementary figure 1. Comparison of unbound and as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine GM-CSF (slate) with bound GM-CSF in the GIF:GM-CSF complex (GIF: green,
More informationStructural characterization of NiV N 0 P in solution and in crystal.
Supplementary Figure 1 Structural characterization of NiV N 0 P in solution and in crystal. (a) SAXS analysis of the N 32-383 0 -P 50 complex. The Guinier plot for complex concentrations of 0.55, 1.1,
More informationStructural insights into WcbI, a novel polysaccharide-biosynthesis enzyme
Volume 1 (2014) Supporting information for article: Structural insights into WcbI, a novel polysaccharide-biosynthesis enzyme Mirella Vivoli, Emily Ayres, Edward Beaumont, Michail N. Isupov and Nicholas
More informationSupplementary materials. Crystal structure of the carboxyltransferase domain. of acetyl coenzyme A carboxylase. Department of Biological Sciences
Supplementary materials Crystal structure of the carboxyltransferase domain of acetyl coenzyme A carboxylase Hailong Zhang, Zhiru Yang, 1 Yang Shen, 1 Liang Tong Department of Biological Sciences Columbia
More informationElectron Density at various resolutions, and fitting a model as accurately as possible.
Section 9, Electron Density Maps 900 Electron Density at various resolutions, and fitting a model as accurately as possible. ρ xyz = (Vol) -1 h k l m hkl F hkl e iφ hkl e-i2π( hx + ky + lz ) Amplitude
More informationSupporting Information
Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)
More informationAnomalous dispersion
Selenomethionine MAD Selenomethionine is the amino acid methionine with the Sulfur replaced by a Selenium. Selenium is a heavy atom that also has the propery of "anomalous scatter" at some wavelengths,
More informationProtein crystallography. Garry Taylor
Protein crystallography Garry Taylor X-ray Crystallography - the Basics Grow crystals Collect X-ray data Determine phases Calculate ρ-map Interpret map Refine coordinates Do the biology. Nitrogen at -180
More informationSupporting Information
Supporting Information Oxaliplatin binding to human copper chaperone Atox1 and protein dimerization Benny D. Belviso, 1 Angela Galliani, 2 Alessia Lasorsa, 2 Valentina Mirabelli, 1,3 Rocco Caliandro, 1
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Definition and assessment of ciap1 constructs.
Supplementary Figure 1 Definition and assessment of ciap1 constructs. (a) ciap1 constructs used in this study are shown as primary structure schematics with domains colored as in the main text. Mutations
More informationtype GroEL-GroES complex. Crystals were grown in buffer D (100 mm HEPES, ph 7.5,
Supplementary Material Supplementary Materials and Methods Structure Determination of SR1-GroES-ADP AlF x SR1-GroES-ADP AlF x was purified as described in Materials and Methods for the wild type GroEL-GroES
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group
More informationfor Molecular Biology and Neuroscience and Institute of Medical Microbiology, Rikshospitalet-Radiumhospitalet
SUPPLEMENTARY INFORMATION TO Structural basis for enzymatic excision of N -methyladenine and N 3 -methylcytosine from DNA Ingar Leiros,5, Marivi P. Nabong 2,3,5, Kristin Grøsvik 3, Jeanette Ringvoll 2,
More informationStructural basis of PROTAC cooperative recognition for selective protein degradation
SUPPLEMENTARY INFORMATION Structural basis of PROTAC cooperative recognition for selective protein degradation Morgan S. Gadd 1, Andrea Testa 1, Xavier Lucas 1, Kwok-Ho Chan, Wenzhang Chen, Douglas J.
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/5/243/ra68/dc1 Supplementary Materials for Superbinder SH2 Domains Act as Antagonists of Cell Signaling Tomonori Kaneko, Haiming Huang, Xuan Cao, Xing Li, Chengjun
More informationThe structure of vanadium nitrogenase reveals an unusual bridging ligand
SUPPLEMENTARY INFORMATION The structure of vanadium nitrogenase reveals an unusual bridging ligand Daniel Sippel and Oliver Einsle Lehrstuhl Biochemie, Institut für Biochemie, Albert-Ludwigs-Universität
More informationRational Design of Thermodynamic and Kinetic Binding Profiles by. Optimizing Surface Water Networks Coating Protein Bound Ligands
SUPPORTING INFORMATION Rational Design of Thermodynamic and Kinetic Binding Profiles by Optimizing Surface Water Networks Coating Protein Bound Ligands Stefan G. Krimmer,, Jonathan Cramer,, Michael Betz,
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.
More informationSupplementary Information
Supplementary Information An engineered protein antagonist of K-Ras/B-Raf interaction Monique J. Kauke, 1,2 Michael W. Traxlmayr 1,2, Jillian A. Parker 3, Jonathan D. Kiefer 4, Ryan Knihtila 3, John McGee
More informationSmall-Angle Scattering Atomic Structure Based Modeling
Small-Angle Scattering Atomic Structure Based Modeling Alejandro Panjkovich EMBL Hamburg 07.12.2017 A. Panjkovich (EMBL) BioSAS atomic modeling 07.12.2017 1 / 49 From the forest to the particle accelerator
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1737 Supplementary Table 1 variant Description FSEC - 2B12 a FSEC - 6A1 a K d (leucine) c Leucine uptake e K (wild-type like) K (Y18F) K (TS) K (TSY) K288A mutant, lipid facing side chain
More informationSupplemental Information. Molecular Basis of Spectral Diversity. in Near-Infrared Phytochrome-Based. Fluorescent Proteins
Chemistry & Biology, Volume 22 Supplemental Information Molecular Basis of Spectral Diversity in Near-Infrared Phytochrome-Based Fluorescent Proteins Daria M. Shcherbakova, Mikhail Baloban, Sergei Pletnev,
More informationSupplementary Figures
1 Supplementary Figures Supplementary Figure 1 Type I FGFR1 inhibitors (a) Chemical structures of a pyrazolylaminopyrimidine inhibitor (henceforth referred to as PAPI; PDB-code of the FGFR1-PAPI complex:
More informationPhotosystem I in Arabidopsis Thaliana
Photosystem I in Arabidopsis Thaliana Part A. Photosystem I in Arabidopsis Thaliana Arabidopsis thaliana is a small flowering plant related to the cabbage and mustard plants. Like all plants, Arabidopsis
More informationStructural Mechanism for the Fidelity Modulation of DNA Polymerase λ. 128 Academia Road Sec. 2, Nankang, Taipei, 115, Taiwan
SUPPORTING INFORMATION Structural Mechanism for the Fidelity Modulation of DNA Polymerase λ Mu-Sen Liu, 1,3 Hsin-Yue Tsai, 1,# Xiao-Xia Liu, 1,# Meng-Chiao Ho, 1,3 Wen-Jin Wu, 1,* and Ming-Daw Tsai 1,2,3,*
More informationCryo-EM data collection, refinement and validation statistics
1 Table S1 Cryo-EM data collection, refinement and validation statistics Data collection and processing CPSF-160 WDR33 (EMDB-7114) (PDB 6BM0) CPSF-160 WDR33 (EMDB-7113) (PDB 6BLY) CPSF-160 WDR33 CPSF-30
More informationSupporting Information. Synthesis of Aspartame by Thermolysin : An X-ray Structural Study
Supporting Information Synthesis of Aspartame by Thermolysin : An X-ray Structural Study Gabriel Birrane, Balaji Bhyravbhatla, and Manuel A. Navia METHODS Crystallization. Thermolysin (TLN) from Calbiochem
More informationSupplemental Information
Supplemental Information Combinatorial Readout of Unmodified H3R2 and Acetylated H3K14 by the Tandem PHD Finger of MOZ Reveals a Regulatory Mechanism for HOXA9 Transcription Yu Qiu 1, Lei Liu 1, Chen Zhao
More informationSupplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,
More informationData reduction and processing tutorial
Data reduction and processing tutorial Petr V. Konarev European Molecular Biology Laboratory, Hamburg Outstation BioSAXS group EMBL BioSAXS beamline X33, 2012 Optics Vacuum cell Completely redesigned 2005-2012
More informationSupporting Information
Supporting Information Self-Assembly of 4-(Diethylboryl)pyridine: Crystal Structures of Cyclic Pentamer and Hexamer and Their Solvent-Dependent Selective Crystallization Shigeharu Wakabayashi, * Yuka Hori,
More informationScattering by two Electrons
Scattering by two Electrons p = -r k in k in p r e 2 q k in /λ θ θ k out /λ S q = r k out p + q = r (k out - k in ) e 1 Phase difference of wave 2 with respect to wave 1: 2π λ (k out - k in ) r= 2π S r
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2
More informationTrapped intermediates in crystals of the FMN-dependent oxidase PhzG provide insight into the final steps of phenazine biosynthesis
Supporting Materials: Trapped intermediates in crystals of the FMNdependent oxidase PhzG provide insight into the final steps of phenazine biosynthesis Ningna Xu ab, Ekta Gahanji Ahuja bc, Petra Janning
More informationCks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved
Cks1 d CKS1 Supplementary Figure 1 The -Cks1 crystal lattice. (a) Schematic of the - Cks1 crystal lattice. -Cks1 crystallizes in a lattice that contains c 4 copies of the t - Cks1 dimer in the crystallographic
More informationSAXS/SANS data processing and overall parameters
EMBO Global Exchange Lecture Course 30 November 2012 Hyderabad India SAXS/SANS data processing and overall parameters Petr V. Konarev European Molecular Biology Laboratory, Hamburg Outstation BioSAXS group
More informationSupplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).
Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted
More informationSupplementary Information
Supplementary Information Structural analysis of leader peptide binding enables leaderfree cyanobactin processing Jesko Koehnke 1,2, Greg Mann 1,2, Andrew F Bent 1,2, Hannes Ludewig 1, Sally Shirran 1,
More informationMacromolecular X-ray Crystallography
Protein Structural Models for CHEM 641 Fall 07 Brian Bahnson Department of Chemistry & Biochemistry University of Delaware Macromolecular X-ray Crystallography Purified Protein X-ray Diffraction Data collection
More informationBM29 biosaxs data processing tutorial
HERCULES 2014 BM29 biosaxs data processing tutorial Page 2 OUTLINE Sample Changer Primary Data Processing Model Validation HPLC-SAXS Primary Data Processing Model Validation Ab Initio Model Software in
More informationBiophysics 490M Project
Biophysics 490M Project Dan Han Department of Biochemistry Structure Exploration of aa 3 -type Cytochrome c Oxidase from Rhodobacter sphaeroides I. Introduction: All organisms need energy to live. They
More informationStructure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex
Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin
More informationTable S1. Theoretical and apparent molecular weights of the proteins and protein complexes used for ITC analysis
Table S1. Theoretical and apparent molecular weights of the proteins and protein complexes used for ITC analysis Sample Theoretical molecular weight (without glycosylation) Apparent molecular weight R-2
More informationSupporting Information
Supporting Information Structural Basis of the Antiproliferative Activity of Largazole, a Depsipeptide Inhibitor of the Histone Deacetylases Kathryn E. Cole 1, Daniel P. Dowling 1,2, Matthew A. Boone 3,
More informationActa Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural basis of the heterodimerization of the MST and RASSF SARAH domains in the Hippo signalling
More informationSmall-Angle Scattering from Biomolecular Solutions
T H E U N I V E R S I T Y of T E X A S S C H O O L O F H E A L T H I N F O R M A T I O N S C I E N C E S A T H O U S T O N Small-Angle Scattering from Biomolecular Solutions For students of HI 6001-125
More informationSupplementary Material for. Herapathite
Supplementary Material for Herapathite Bart Kahr, John Freudenthal, Shane Phillips, Werner Kaminsky Department of Chemistry, Box 351700, University of Washington, Seattle WA 98195-1700 Crystal Structure
More informationSupplementary Information for: A de novo peptide hexamer with a mutable channel. Walk, Bristol BS8 1TD, UK. UK.
SI.1 Supplementary Information for: A de novo peptide hexamer with a mutable channel Nathan R. Zaccai, 1 Bertie Chi, 1,2 Andrew R. Thomson, 2 Aimee L. Boyle, 2 Gail J. Bartlett, 2 Marc Bruning, 2 Noah
More information