Supporting Information
|
|
|
- Marilyn Wilkerson
- 5 years ago
- Views:
Transcription
1 Supporting Information Oxaliplatin binding to human copper chaperone Atox1 and protein dimerization Benny D. Belviso, 1 Angela Galliani, 2 Alessia Lasorsa, 2 Valentina Mirabelli, 1,3 Rocco Caliandro, 1 Fabio Arnesano, 2 and Giovanni Natile 2 1 Institute of Crystallography, Consiglio Nazionale delle Ricerche, via Amendola 122/o, Bari, Italy. 2 Department of Chemistry, University of Bari A. Moro, via E. Orabona 4, Bari, Italy. 3 Department of Economics, University of Foggia, Via A. Gramsci 89/91, Foggia, Italy. Contents Figure SI1. Size exclusion chromatograms of Atox1 treated with cisplatin Figure SI2. ESI-MS spectra of elution fractions obtained by SEC analysis of Atox1 treated with cisplatin Figure SI3. ESI-MS spectra of Atox1 treated with oxaliplatin and then with GSH Figure SI4. 1 H, 15 N-SOFAST HMQC spectra of 15 N-Atox1 apo, monomer and dimer, and 1 H, 15 N-HSQC spectra of 15 N-cisplatin incubated with 15 N-Atox1 Figure SI5. Superposition of the crystal structures containing dimers of Atox1 Figure SI6. H-bond inter dimer interactions Figure SI7. Supramolecular motif of Atox1 monomer superimposed to those of chains A and B of Atox1 dimers Table SI1. Diffraction data statistics of dimeric Atox1-platinum adduct Table SI2. Bond distances for Pt-binding sites in dimeric Atox1-platinum adduct Table SI3. Bond angles for Pt-binding sites in dimeric Atox1-platinum adduct Table SI4. H-bond distances below 3.5 Å between the two chains forming the Atox1 dimer Table SI5. Ionic radii for metal ions present in the tetrahedral cage 1
2 Figure SI1. Size exclusion chromatograms (SEC) of Atox1 treated with an equimolar amount of cisplatin, recorded at time zero (dashed line) and after 24 h incubation (solid line) (A). SDS-PAGE (4-20%) of monomeric (RV 13.1 ml) and dimeric (RV 11.6 ml) SEC fractions isolated after 24 h incubation of Atox1 with cisplatin. Bands corresponding to monomeric and dimeric protein adducts are indicated by arrowheads showing the molecular weight (B). Figure SI2. ESI-MS spectra and corresponding deconvoluted spectra of elution fractions, having retention volumes of 13.1 ml (A and B) and 11.6 ml (C and D), obtained by SEC analysis after 24 h incubation of Atox1 with cisplatin. 2
3 Figure SI3. ESI-MS spectra (+8 multiply charged state) of Atox1 incubated with oxaliplatin for 24 h (A) and then treated with 10-fold molar excess of GSH for additional 24 h (B). Figure SI4. 2D 1 H, 15 N-SOFAST HMQC and 2D 1 H, 15 N-HSQC spectra of Atox1 monomeric (B and E) and dimeric (C and F) samples obtained from SEC analysis performed after 48 h incubation of 15 N-Atox1 with 15 N-cisplatin. 2D 1 H, 15 N-SOFAST HMQC spectrum of apo 15 N-Atox1 (A) and 2D 1 H, 15 N-HSQC spectrum of 15 N-cisplatin (D) are also reported. In the spectra of panels D-E, cross-peaks are assigned to 15 NH3 trans to O, Cl, or S donor atoms. Cross-peaks belonging to the same species are connected by a straight line. 3
4 Figure SI5. Superposition of the crystal structures containing dimers of Atox1. Protein molecules are in ribbon representation while metal ions appear as sphere. Previously published 1FE0, 1FEE, 1FE4, and 3IWX are in red color, whilst the present crystal structure 4QOT is shown in green. The straight lines in the figure result from the linear interpolation of the Cα coordinates of each chain and are shown in the same color code of the protein molecules. Metal ions are Cd for 1FE0, Cu for 1FEE, Hg for 1FE4, Pt for 3IWX and 4QOT. Figure SI6. H-bond inter dimer interactions (H-acceptor/donor maximum distance = 3.5 Å). Interactions are shown as dashed lines between the H-acceptor and H-donor atoms. (a) Interactions between chains A (green) of three different dimers related by symmetry operations (marked by * and **). (b) Interactions between chains B (cyan) of three different dimers related by symmetry operation (marked by *** and ****). The central chains A and B which are partners in a dimer are shown in the same orientation to highlight the differences in orientation of the interacting, symmetry related, chains in the two cases. Platinum ions Pt1 are shown as violet spheres while oxygen, nitrogen, and sulfur atoms are shown in red, blue, and yellow, respectively. Water and sulfate molecules at a distance 3.5 Å from the chain interfaces are shown as red and yellow spheres. Helices, beta-strand, and beta-turn are labeled α, β, and β-turn with a preceding number that indicates their order in the protein chain. 4
5 Figure SI7. The supramolecular motif found in the crystal structure of the Atox1 monomer (only one chain in the asymmetric unit, PDB code 3IWL) is superimposed (blue cartoon) to the supramolecular motifs formed by chains A (green cartoon) and B (cyan cartoon) of Atox1 dimers. A nearly perfect match is found only for Atox1 monomer and chain B of Atox1 dimer. In order to show the primary metal-binding site for Atox1, the Cys12 and Cys15 are shown as sticks. 5
6 Table SI1. Diffraction data statistics of crystals obtained from co-crystallization of Atox1 and [Pt(R,R-1,2-DACH)(H2O)(SO4)] in 1:1 ratio (Atox12-platinum adduct). Wavelength (Å) Resolution range (Å) Space group P65 Unit cell parameters (Å) a b c Total number of reflection Total number of unique reflection 9647 <I/ (I)> 6.5 Rmerge 12.8% Completeness 99.5% Multiplicity 3.9 Table SI2. Bond distances for Pt-binding sites in Atox12-platinum crystals. For atoms involved in platinum binding, the atom name in PDB format, the residue number, and the protein chain are indicated. Distance (Å) Pt1-SG/Cys12/A 2.3±0.2 Pt1-SG/Cys15/A 2.3±0.3 Pt1-SG/Cys12/B 2.3±0.3 Pt1-SG/Cys15/B 2.3±0.3 Pt2-SG/Cys41/B 2.4±0.3 Pt2-O1/SO498/B 1.9±0.3 Pt2-NZ/Lys3/B 2.1±0.4 Pt2-OE1/Glu5/B 2.1±0.4 6
7 Table SI3. Bond angles for Pt-binding sites in Atox12-platinum crystals. For atoms involved in platinum binding, the atom name in PDB format, the residue number, and the protein chain are indicated. Angle ( ) SG/Cys12/A - Pt1 - SG/Cys12/B SG/Cys12/A - Pt1 - SG/Cys15/A SG/Cys15/B - Pt1 - SG/Cys15/A SG/Cys15/B - Pt1 - SG/Cys12/B SG/Cys15/B - Pt1 - SG/Cys12/A SG/Cys15/A - Pt1 - SG/Cys12/B O1/SO498/B - Pt2 - SG/Cys41/B 95.8 SG/Cys41/B -Pt2-OE1/Glu5/B 87.4 OE1/Glu5/B -Pt2-NZ/Lys3/B 87.0 NZ/Lys3/B - Pt2 - O1/SO498/B 88.2 O1/SO498/B - Pt2 - OE1/Glu5/B SG/Cys 41/B -Pt2-NZ/Lys3/B Table SI4. H-bond distances below 3.5 Å between the two chains forming the Atox1 dimer in Atox12-platinum crystals. For atoms involved in H-bond interactions, the atom name in PDB format, the residue number, and the protein chain are indicated. Interactions shown in Atom1 Atom2 Distance (Å) Figure 6a NH1/Arg21/B O/Gly59/A 2.7±0.2 OG1/Thr11/A SG/Cys12/B 2.9±0.2 O/Gly14/B O/wat77/A 3.1±0.2 O/Asp9/A O/wat77/A 3.2±0.3 NH2/Arg21/B OG1/Thr61/A 3.5±0.2 Figure 6b OD2/Asp9/B O/wat83/B 2.6±0.3 O/Asp9/B O/wat91/B 2.7±0.3 NH1/Arg21/A O/wat83/B 2.8±0.3 SG/Cys12/A OG1/Thr11/B 2.8±0.3 NH1/Arg21/A O/Gly59/B 2.8±0.3 OG1/Thr61/B O/wat83/B 2.9±0.3 O/wat91/B OG1/Thr11/B 3.1±0.3 N/Thr61/B O/wat83/B 3.2±0.2 NH2/Arg21/A O/wat83/B 3.3±0.3 NH2/Arg21/A OG1/Thr61/B 3.4±0.3 OD2/Asp9/B O/wat91/B 3.5±0.3 Figure 6c O/Thr58/A O/wat70/A 2.6±0.3 O/Thr58/B O/wat70/A 2.9±0.3 NZ/Lys60/A O/wat70/A 3.0±0.3 NZ/Lys60/A NZ/Lys60/B 3.0±0.3 NZ/Lys60/B O/wat70/A 3.4±0.3 7
8 Table SI5. Ionic radii of metal ions present in the tetrahedral cage of sulfur atoms found in crystal structures of Atox1 dimers, and volumes of the tetrahedron having at the vertices the four sulfur atoms. a Metal ion Ionic radius (Å) Cd Hg Cu Pt Tetrahedron volume (Å 3 ) a Ionic radii were taken from J.C. Slater (1964) J Chem Phys 41:3199 and from J.C. Slater (1965) Quantum Theory of Molecules and Solids. Symmetry and Bonds in Crystals. Vol 2. McGraw-Hill, New York. 8
SUPPLEMENTARY INFORMATION
Supplementary Table 1: Amplitudes of three current levels. Level 0 (pa) Level 1 (pa) Level 2 (pa) TrkA- TrkH WT 200 K 0.01 ± 0.01 9.5 ± 0.01 18.7 ± 0.03 200 Na * 0.001 ± 0.01 3.9 ± 0.01 12.5 ± 0.03 200
Acta Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural basis of the heterodimerization of the MST and RASSF SARAH domains in the Hippo signalling
Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein
Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08
Structural insights into WcbI, a novel polysaccharide-biosynthesis enzyme
Volume 1 (2014) Supporting information for article: Structural insights into WcbI, a novel polysaccharide-biosynthesis enzyme Mirella Vivoli, Emily Ayres, Edward Beaumont, Michail N. Isupov and Nicholas
Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions. Implicated in Dimerization and Autoinhibition
JBC Papers in Press. Published on November 1, 2000 as Manuscript M006502200 Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions Implicated in Dimerization and Autoinhibition 1 Copyright
SUPPLEMENTARY INFORMATION
Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
Structural insights into Aspergillus fumigatus lectin specificity - AFL binding sites are functionally non-equivalent
Acta Cryst. (2015). D71, doi:10.1107/s1399004714026595 Supporting information Volume 71 (2015) Supporting information for article: Structural insights into Aspergillus fumigatus lectin specificity - AFL
SUPPLEMENTARY INFORMATION
Fig. 1 Influences of crystal lattice contacts on Pol η structures. a. The dominant lattice contact between two hpol η molecules (silver and gold) in the type 1 crystals. b. A close-up view of the hydrophobic
Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina
SUPPORTING INFORMATION
Synthesis and Biological Evaluation of Direct Thrombin Inhibitors Bearing 4-(Piperidin-1- yl)pyridine at the P1 Position with Potent Anticoagulant Activity Modesto de Candia, Filomena Fiorella,,# Gianfranco
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier
SUPPLEMENTARY INFORMATION
www.nature.com/nature 1 Figure S1 Sequence alignment. a Structure based alignment of the plgic of E. chrysanthemi (ELIC), the acetylcholine binding protein from the snail Lymnea stagnalis (AchBP, PDB code
Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS
Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS CNS input file generatemetal.inp: remarks file generate/generatemetal.inp
SUPPLEMENTARY INFORMATION
Dph2 SeMet (iron-free) # Dph2 (iron-free) Dph2-[4Fe-4S] Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 58.26, 82.08, 160.42 58.74, 81.87, 160.01 55.70, 80.53,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11744 Supplementary Table 1. Crystallographic data collection and refinement statistics. Wild-type Se-Met-BcsA-B SmCl 3 -soaked EMTS-soaked Data collection Space
SUPPLEMENTARY INFORMATION. doi: /nature07461
Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of
Supplemental Information. Molecular Basis of Spectral Diversity. in Near-Infrared Phytochrome-Based. Fluorescent Proteins
Chemistry & Biology, Volume 22 Supplemental Information Molecular Basis of Spectral Diversity in Near-Infrared Phytochrome-Based Fluorescent Proteins Daria M. Shcherbakova, Mikhail Baloban, Sergei Pletnev,
Supplemental Data SUPPLEMENTAL FIGURES
Supplemental Data CRYSTAL STRUCTURE OF THE MG.ADP-INHIBITED STATE OF THE YEAST F 1 C 10 ATP SYNTHASE Alain Dautant*, Jean Velours and Marie-France Giraud* From Université Bordeaux 2, CNRS; Institut de
Cks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved
Cks1 d CKS1 Supplementary Figure 1 The -Cks1 crystal lattice. (a) Schematic of the - Cks1 crystal lattice. -Cks1 crystallizes in a lattice that contains c 4 copies of the t - Cks1 dimer in the crystallographic
SI Text S1 Solution Scattering Data Collection and Analysis. SI references
SI Text S1 Solution Scattering Data Collection and Analysis. The X-ray photon energy was set to 8 kev. The PILATUS hybrid pixel array detector (RIGAKU) was positioned at a distance of 606 mm from the sample.
Supplementary Information for
Supplementary Information for Structural basis for the inhibition of Mycobacterium tuberculosis L,D-transpeptidase by meropenem, a drug effective against extensively drug-resistant strains Hyoun Sook Kim
Silica surface - Materials Studio tutorial. CREATING SiO 2 SURFACE
Silica surface - Materials Studio tutorial CREATING SiO 2 SURFACE Our goal surface of SiO2 6.948 Ǻ Import structure The XRD experiment gives us such parameters as: lattice parameters, symmetry group and
Supplementary Figure 1. Biochemical and sequence alignment analyses the
Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).
Diphthamide biosynthesis requires a radical iron-sulfur enzyme. Pennsylvania State University, University Park, Pennsylvania 16802, USA
Diphthamide biosynthesis requires a radical iron-sulfur enzyme Yang Zhang, 1,4 Xuling Zhu, 1,4 Andrew T. Torelli, 1 Michael Lee, 2 Boris Dzikovski, 1 Rachel Koralewski, 1 Eileen Wang, 1 Jack Freed, 1 Carsten
SUPPLEMENTARY INFORMATION
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 SUPPLEMENTARY INFORMATION Novel hydrogen- and halogen-bonding anion receptors based on 3- iodopyridinium
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.
NGF - twenty years a-growing
NGF - twenty years a-growing A molecule vital to brain growth It is twenty years since the structure of nerve growth factor (NGF) was determined [ref. 1]. This molecule is more than 'quite interesting'
Creating a Pharmacophore Query from a Reference Molecule & Scaffold Hopping in CSD-CrossMiner
Table of Contents Creating a Pharmacophore Query from a Reference Molecule & Scaffold Hopping in CSD-CrossMiner Introduction... 2 CSD-CrossMiner Terminology... 2 Overview of CSD-CrossMiner... 3 Features
SUPPLEMENTARY INFORMATION
Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase
Sunhats for plants. How plants detect dangerous ultraviolet rays
Sunhats for plants How plants detect dangerous ultraviolet rays Anyone who has ever suffered sunburn will know about the effects of too much ultraviolet (UV) radiation, in particular UV-B (from 280-315
Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2
Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell
CHEMISTRY 121 PRACTICE EXAM 2
CHEMISTRY 121 PRACTICE EXAM 2 Slater s Rules 1. For an electron in an [ns np] group, electrons to the right contribute nothing to the screening (S). 2. For an electron in an [ns np] group, other electrons
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2
Nature Structural and Molecular Biology: doi: /nsmb.2938
Supplementary Figure 1 Characterization of designed leucine-rich-repeat proteins. (a) Water-mediate hydrogen-bond network is frequently visible in the convex region of LRR crystal structures. Examples
Structure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex
Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits AhpC and AhpF from Escherichia coli Phat Vinh Dip 1,#, Neelagandan Kamariah 2,#, Malathy Sony Subramanian Manimekalai
Supplementary Information
Supplementary Information The direct role of selenocysteine in [NiFeSe] hydrogenase maturation and catalysis Marta C. Marques a, Cristina Tapia b, Oscar Gutiérrez-Sanz b, Ana Raquel Ramos a, Kimberly L.
CHEM J-2 June 2014
CHEM1611 014-J- June 014 Reaction of nitrogen-14 with a neutron forms two products, one of which is carbon-14. Radiocarbon dating involves the carbon-14 isotope which undergoes β-decay (emission of an
SUPPLEMENTARY INFORMATION
Figure S1. Secondary structure of CAP (in the camp 2 -bound state) 10. α-helices are shown as cylinders and β- strands as arrows. Labeling of secondary structure is indicated. CDB, DBD and the hinge are
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Definition and assessment of ciap1 constructs.
Supplementary Figure 1 Definition and assessment of ciap1 constructs. (a) ciap1 constructs used in this study are shown as primary structure schematics with domains colored as in the main text. Mutations
Supplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine
Supplementary figure 1. Comparison of unbound and as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine GM-CSF (slate) with bound GM-CSF in the GIF:GM-CSF complex (GIF: green,
Supplementary Information Mechanism of influenza A M2 transmembrane domain assembly in lipid membranes
Supplementary Information Mechanism of influenza A M2 transmembrane domain assembly in lipid membranes Elka R. Georgieva 1,2*, Peter P. Borbat 1,2, Haley D. Norman 3 and Jack H. Freed 1,2* 1 Department
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the
Supplemental data for
Supplemental data for A Real-Time Guanine Nucleotide Exchange Assay using NMR: Activation of RhoA by PDZ- RhoGEF. Geneviève M.C. Gasmi-Seabrook 1,3, Christopher B. Marshall 1,3, Melissa Cheung 1,3, Bryan
Performing a Pharmacophore Search using CSD-CrossMiner
Table of Contents Introduction... 2 CSD-CrossMiner Terminology... 2 Overview of CSD-CrossMiner... 3 Searching with a Pharmacophore... 4 Performing a Pharmacophore Search using CSD-CrossMiner Version 2.0
LS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor
LS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor Note: Adequate space is given for each answer. Questions that require a brief explanation should
Supplementary Materials: Localization and Spectroscopic Analysis of the Cu(I) Binding Site in Wheat Metallothionein Ec-1
S1 of S8 Supplementary Materials: Localization and Spectroscopic Analysis of the Cu(I) Binding Site in Wheat Metallothionein Ec-1 Katsiaryna Tarasava, Jens Loebus and Eva Freisinger Figure S1. Deconvoluted
type GroEL-GroES complex. Crystals were grown in buffer D (100 mm HEPES, ph 7.5,
Supplementary Material Supplementary Materials and Methods Structure Determination of SR1-GroES-ADP AlF x SR1-GroES-ADP AlF x was purified as described in Materials and Methods for the wild type GroEL-GroES
Supporting Information. UV-induced ligand exchange in MHC class I protein crystals
Supporting Information for the article entitled UV-induced ligand exchange in MHC class I protein crystals by Patrick H.N. Celie 1, Mireille Toebes 2, Boris Rodenko 3, Huib Ovaa 3, Anastassis Perrakis
Supplementary Material (ESI) for CrystEngComm This journal is The Royal Society of Chemistry 2010
Electronic Supplementary Information (ESI) for: A bifunctionalized porous material containing discrete assemblies of copper-porphyrins and calixarenes metallated by ion diffusion Rita De Zorzi, Nicol Guidolin,
Acta Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural characterization of the virulence factor Nuclease A from Streptococcus agalactiae
From Last Time Important new Quantum Mechanical Concepts. Atoms and Molecules. Today. Symmetry. Simple molecules.
Today From Last Time Important new Quantum Mechanical Concepts Indistinguishability: Symmetries of the wavefunction: Symmetric and Antisymmetric Pauli exclusion principle: only one fermion per state Spin
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting
Bonding/Lewis Dots Lecture Page 1 of 12 Date. Bonding. What is Coulomb's Law? Energy Profile: Covalent Bonds. Electronegativity and Linus Pauling
Bonding/Lewis Dots Lecture Page 1 of 12 Date Bonding What is Coulomb's Law? Energy Profile: Covalent Bonds Electronegativity and Linus Pauling 2.1 H 1.0 Li 0.9 Na 0.8 K 0.8 Rb 0.7 Cs 0.7 Fr 1.5 Be 1.2
Conformational Geometry of Peptides and Proteins:
Conformational Geometry of Peptides and Proteins: Before discussing secondary structure, it is important to appreciate the conformational plasticity of proteins. Each residue in a polypeptide has three
Supplementary Information
1 Supplementary Information Figure S1 The V=0.5 Harker section of an anomalous difference Patterson map calculated using diffraction data from the NNQQNY crystal at 1.3 Å resolution. The position of the
CH 3 CH 2 OH +H 2 O CHO. 2e + 2H + + O 2 H 2 O +HCOOH
2 4 H CH 3 2e + 2H + + 2 H 2 2 H CH 2 H 2e + 2H + + 2 H 2 2 H +H 2 CH 2e + 2H + + 2 H 2 2 H +HCH Supplemental Figure S. The three-step 4DM reaction, each step requires two reducing equivalents from ADPH
Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27
Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase
Lecture 4! ü Review on atom/ion size! ü Crystal structure (Chap 4 of Nesseʼs book)!
Lecture 4! ü Review on atom/ion size! ü Crystal structure (Chap 4 of Nesseʼs book)! 15 C 4+ 42 Si 4+ Size of atoms! Hefferan and O Brien, 2010; Earth Materials Force balance! Crystal structure (Chap. 4)!
T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp
S u p p l e m e n ta l m at e r i a l jgp Lee et al., http://www.jgp.org/cgi/content/full/jgp.201411219/dc1 T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y S u p p l e m e n ta l D I S C U S
Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a
Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a series of tmfret-pairs comprised of single cysteine mutants
Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
Basics of protein structure
Today: 1. Projects a. Requirements: i. Critical review of one paper ii. At least one computational result b. Noon, Dec. 3 rd written report and oral presentation are due; submit via email to bphys101@fas.harvard.edu
The Mole Concept. It is easily converted to grams, no of particles or in the case of gas volume.
The Mole Concept The mole is a convenient unit A mole is the number of atoms present in exactly 12 g of the isotope carbon-12. In 12 g of carbon-12 there are 6.022 x 10 23 carbon atoms It is easily converted
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),
Current address: Department of Chemistry, Hong Kong Baptist University, Kowloon Tong, Hong Kong,
Hydrolysis of Cisplatin - A Metadynamics Study Supporting Information Justin Kai-Chi Lau a and Bernd Ensing* b Department of Chemistry and Applied Bioscience, ETH Zurich, USI Campus, Computational Science,
Photosystem I in Arabidopsis Thaliana
Photosystem I in Arabidopsis Thaliana Part A. Photosystem I in Arabidopsis Thaliana Arabidopsis thaliana is a small flowering plant related to the cabbage and mustard plants. Like all plants, Arabidopsis
Supplementary Figures
1 Supplementary Figures Supplementary Figure 1 Type I FGFR1 inhibitors (a) Chemical structures of a pyrazolylaminopyrimidine inhibitor (henceforth referred to as PAPI; PDB-code of the FGFR1-PAPI complex:
Supplementary Figure 1. Proposed mechanism for AusE, PrhA, and these mutants. (a) 5 is desaturated
S1 Supplementary Figure 1. Proposed mechanism for AusE, PrhA, and these mutants. (a) 5 is desaturated to form 6 through hydrogen atom abstraction at C-2 followed by the second hydrogen atom abstraction
Macromolecular X-ray Crystallography
Protein Structural Models for CHEM 641 Fall 07 Brian Bahnson Department of Chemistry & Biochemistry University of Delaware Macromolecular X-ray Crystallography Purified Protein X-ray Diffraction Data collection
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Cryo-EM structure and model of the C. thermophilum 90S preribosome. a, Gold standard FSC curve showing the average resolution of the 90S preribosome masked and unmasked (left). FSC
Chemical Equations. Chemical Reactions. The Hindenburg Reaction 5/25/11
Chemical Reactions CHM 1032C Chemical Equations Chemical change involves a reorganization of the atoms in one or more substances. The Hindenburg Reaction Reactants are on left, products to the right. Arrow
Ch 1-6 Working With Numbers; Scientific Notation pp Ch 1-5 to 1-6 Significant Figures pp 22-37
Ch 1-5 to 1-6 Significant Figures pp 22-37 Know how significant digits are found and used in calculations. Ch 1-6 Working With Numbers; Scientific Notation pp 30-32 Know how to use the calculator exponent
Plasmid Relevant features Source. W18N_D20N and TrXE-W18N_D20N-anti
Table S1. E. coli plasmids Plasmid Relevant features Source pdg680 T. reesei XynII AA 2-190 with C-terminal His 6 tag optimized for E. coli expression in pjexpress401 Wan et al. (in press) psbn44d psbn44h
1. What is an ångstrom unit, and why is it used to describe molecular structures?
1. What is an ångstrom unit, and why is it used to describe molecular structures? The ångstrom unit is a unit of distance suitable for measuring atomic scale objects. 1 ångstrom (Å) = 1 10-10 m. The diameter
Pymol Practial Guide
Pymol Practial Guide Pymol is a powerful visualizor very convenient to work with protein molecules. Its interface may seem complex at first, but you will see that with a little practice is simple and powerful
Supporting Information. for
Supporting Information for PtCl 2 (phen) Disrupts the Metal Ions Binding to Amyloid-β Peptide Guolin Ma, Erqiong Wang, Hao Wei, Kaiju Wei, Pingping Zhu and Yangzhong Liu Contents: Figure S1. Reactions
Supporting Information
Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)
Redox-Responsive Complexation between a. Pillar[5]arene with Mono ethylene oxide Substituents. and Paraquat
![Redox-Responsive Complexation between a. Pillar[5]arene with Mono ethylene oxide Substituents. and Paraquat](/thumbs/93/111729438.jpg "Redox-Responsive Complexation between a. Pillar[5]arene with Mono ethylene oxide Substituents. and Paraquat")
Redox-Responsive Complexation between a Pillar[5]arene with Mono ethylene oxide Substituents and Paraquat Xiaodong Chi, Min Xue, Yong Yao and Feihe Huang* MOE Key Laboratory of Macromolecular Synthesis
Section III - Designing Models for 3D Printing
Section III - Designing Models for 3D Printing In this section of the Jmol Training Guide, you will become familiar with the commands needed to design a model that will be built on a 3D Printer. As you
Detailed description of overall and active site architecture of PPDC- 3dThDP, PPDC-2HE3dThDP, PPDC-3dThDP-PPA and PPDC- 3dThDP-POVA
Online Supplemental Results Detailed description of overall and active site architecture of PPDC- 3dThDP, PPDC-2HE3dThDP, PPDC-3dThDP-PPA and PPDC- 3dThDP-POVA Structure solution and overall architecture
Supporting Information
Supporting Information Cyclodextrin Supramolecular Complex as Water Soluble Ratiometric Sensor for ferric Ion Sensing Meiyun Xu, Shuizhu Wu,* Fang Zeng, Changmin Yu College of Materials Science & Engineering,
Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
Supramolecular Hydrogel Formation in a Series of Self-Assembling. Lipopeptides with Varying Lipid Chain Length.
Supplementary Information Supramolecular Hydrogel Formation in a Series of Self-Assembling Lipopeptides with Varying Lipid Chain Length. V. Castelletto a, A. Kaur a, R. M. Kowalczyk a, I.W. Hamley a, M.
Potassium channel gating and structure!
Reading: Potassium channel gating and structure Hille (3rd ed.) chapts 10, 13, 17 Doyle et al. The Structure of the Potassium Channel: Molecular Basis of K1 Conduction and Selectivity. Science 280:70-77
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group
Structural and mechanistic insight into the substrate. binding from the conformational dynamics in apo. and substrate-bound DapE enzyme
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 215 Structural and mechanistic insight into the substrate binding from the conformational
Chem Homework = cm -1, HF; cm -1, H 35 Cl; cm -1, H 81 Br; cm -1, H 127 I
1. Chem 344 - Homework 10 2. 3. 4. 0 = 4141.3 cm -1, HF; 2988.9 cm -1, H 35 Cl; 2649.7 cm -1, H 81 Br; 2309.5 cm -1, H 127 I 5. 6. 7. Q16.26,27,28,29) Identify the molecular orbitals for F 2 in the images
Course theme. Three hours of lab Complete E1 (Parts 1, 2, 3, 4, and 5B) Prepare discussion presentation Prepare team report.
Experiment Session 2 Electrons and Solution Color Three hours of lab Complete E (Parts, 2, 3, 4, and 5B) Prepare discussion presentation Prepare team report. Course theme There are structure and property
Three hours of lab Complete E1 (Parts 1, 2, 3, 4, and 5B) Prepare discussion presentation Prepare team report. Course theme
Experiment 1 Session 2 Electrons and Solution Color Three hours of lab Complete E1 (Parts 1, 2, 3, 4, and 5B) Prepare discussion presentation Prepare team report. Course theme There are structure and property
Structural characterization of NiV N 0 P in solution and in crystal.
Supplementary Figure 1 Structural characterization of NiV N 0 P in solution and in crystal. (a) SAXS analysis of the N 32-383 0 -P 50 complex. The Guinier plot for complex concentrations of 0.55, 1.1,
RNA Polymerase I Contains a TFIIF-Related DNA-Binding Subcomplex
Molecular Cell, Volume 39 Supplemental Information RNA Polymerase I Contains a TFIIFRelated DNABinding Subcomplex Sebastian R. Geiger, Kristina Lorenzen, Amelie Schreieck, Patrizia Hanecker, Dirk Kostrewa,
Tutorial: Structural Analysis of a Protein-Protein Complex
Molecular Modeling Section (MMS) Department of Pharmaceutical and Pharmacological Sciences University of Padova Via Marzolo 5-35131 Padova (IT) @contact: stefano.moro@unipd.it Tutorial: Structural Analysis
NMR, X-ray Diffraction, Protein Structure, and RasMol
NMR, X-ray Diffraction, Protein Structure, and RasMol Introduction So far we have been mostly concerned with the proteins themselves. The techniques (NMR or X-ray diffraction) used to determine a structure
Electronic Structure and Photocatalytic Activity of Wurtzite Cu Ga S Nanocrystals and their Zn substitution
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2015 SUPPORTING INFORMATION Electronic Structure and Photocatalytic Activity