SUPPLEMENTARY INFORMATION
|
|
- Roy Chambers
- 5 years ago
- Views:
Transcription
1 Figure S1. Secondary structure of CAP (in the camp 2 -bound state) 10. α-helices are shown as cylinders and β- strands as arrows. Labeling of secondary structure is indicated. CDB, DBD and the hinge are colored blue, magenta and yellow, respectively (same color code as in Fig. 1a). 1
2 Figure S2. Structural comparison of apo-cap (orange) and CAP-cAMP 2 -DNA (blue) 9. View from the top of DNA showing the rigid-body rotation (indicated on the left subunit) that DBD undergoes upon camp binding. α-helices are shown as cylinders and DNA as green cartoon. 2
3 Figure S3. 1 H- 15 N TROSY-HSQC spectra of WT-CAP and CAP-S62F in all liganded states (apo, on the left; camp 2 -bound, in the middle; and camp 2 -DNA-bound, on the right). 3
4 Figure S4. Effect of camp and DNA binding on the structure of WT-CAP (a) and CAP-S62F (b) as assessed by chemical shift mapping. Chemical shift difference (Δω; p.p.m.) values are plotted as a function of residue number. The blue and magenta shaded regions in the graphs delineate the CBD and DBD regions, respectively. Δω for the DNA binding effect reflects the binding of DNA to the camp-bound CAP. Δω values for the camp binding effect are mapped by continuous-scale color onto the WT-CAP-cAMP 2 structure. Stepwise titration of up to 5 mm of camp to CAP-S62F shows that the nucleotide binding pocket becomes saturated at ~0.5 mm of camp. 4
5 Figure S5. camp versus cgmp binding to WT-CAP. In contrast to camp, cgmp binds to CBD but fails to elicit the DBD active, DNA-binding compatible conformation 9. The effect of cgmp is confined to CBD whereas DBD is not affected. a, Effect of camp and b, cgmp binding on the structure of WT-CAP as assessed by chemical shift mapping. Chemical shift difference (Δω) values are plotted as a function of the primary sequence and mapped by continuous-scale color onto the structure of CAP-cAMP 2 (for direct comparison both camp and cgmp effects are mapped on the structure of CAP-cAMP 2 ). c, 1 H- 15 N HSQC spectra of WT-CAP in apo, camp 2 -bound and cgmp 2 -bound states. The blue and magenta shaded regions in the graphs delineate the CBD and DBD regions, respectively. 5
6 Figure S6. Overlaid 1 H- 15 N HSQC spectra of WT-CAP and CAP-S62F in three liganded states (apo, camp 2 - bound and camp 2 -DNA-bound). Representative residues from the helix-turn-helix motif in DBD (G173 and G184) and the camp-binding site (E72, in the insert) in CBD are shown. The data show that while camp binds to CBD of CAP-S62F (saturated at ~0.5 mm camp), the DBD structure is not affected and both apo- CAP-S62F and CAP-S62F-cAMP 2 adopt the inactive, DNA-binding incompatible structure. The chemical shifts of apo-wt-cap and WT-CAP-cAMP 2 can be used as being indicative of the inactive and active state, respectively. A, C, and D refer to the apo, camp-bound state, and DNA-bound state, respectively. 6
7 Figure S7. Structural model of CAP-cAMP 2 wherein the S62F substitution has been modeled in the right subunit. camp is shown as green sticks. Substitution of Phe for Ser introduces a bulky side chain in the vicinity of the camp molecule. In CAP-S62F, the major steric clash between the aromatic side chain of Phe and the adenine base of camp will restrict camp from assuming its favorable position within the nucleotidebinding pocket. As a result the hydrogen bonds between the camp adenine base and the side-chain hydroxyls of Thr127 and Ser128 of the C-helix cannot form. These hydrogen bonds are required for the elongation of the C-helices that result in the stabilization of the active conformation of the DBD and the activation of CAP for DNA binding 9,10. Thus, the failure of camp binding to elicit the active DBD conformation in CAP-S62F is probably due to the inability of camp to form the hydrogen bonds with Thr127 and Ser128. This conclusion is strongly supported by the chemical shift analysis of the camp binding effect on CAP-S62F (Fig. 1c and Supplementary Fig. 4b): the analysis shows that camp binds to the camp binding pocket, and especially at the phosphate binding cassette (PBC), but Thr127, Ser128 and subsequently the C- helix are not stabilized by camp. 7
8 Figure S8. Overlaid 1 H- 15 N TROSY-HSQC spectra of WT-CAP-cAMP 2 -DNA (red) and CAP-S62F-cAMP 2 - DNA (blue) complexes. The data show that the mean structure of the two complexes is almost identical, especially for the DBD, but notable differences are observed for residues (indicated with *) that lie in the camp-binding pocket, close to the S62F substitution site. 8
9 Figure S9. Relaxation rates (R 1, R 2 and { 1 H}- 15 N-NOE) and N-H order parameters (S 2 ) for CAP-S62F-cAMP 2 - DNA as a function of residue number. 9
10 Figure S10. Relaxation rates (R 1, R 2 and { 1 H}- 15 N-NOE) and N-H order parameters (S 2 ) for WT-CAP-cAMP 2 - DNA as a function of residue number. 10
11 Figure S11. Relaxation rates (R 1, R 2 and { 1 H}- 15 N-NOE) and N-H order parameters (S 2 ) for CAP-S62F-cAMP 2 as a function of residue number. 11
12 Figure S12. Relaxation rates (R 1, R 2 and { 1 H}- 15 N-NOE) and N-H order parameters (S 2 ) for WT-CAP-cAMP 2 as a function of residue number. 12
13 Figure S13. Effect of DNA binding on the N-H order parameters (S 2 ) of a, WT-CAP-cAMP 2 and b, CAP-S62FcAMP 2. c, Changes in order parameters, ΔS 2, for WT-CAP-cAMP 2 (left) and CAP-S62F-cAMP 2 (right) upon DNA binding. ΔS 2 is given as S 2 (after DNA binding) S 2 (before DNA binding), so positive ΔS 2 values denote enhanced rigidity of the protein backbone upon DNA binding. The conformational entropy of DNA complex formation estimated through ΔS 2 values (Fig. 2b) is unfavorable for WT-CAP-cAMP 2 ( TΔS conf =39.2 kcal mol -1 ) and favorable for CAP-S62F-cAMP 2 ( TΔS conf = 22.3 kcal mol -1 ). 13
14 Figure S14. Activation of CAP and CAP*. a, Overlaid 1 H- 15 N-HSQC spectra of selected DBD residues of apo and camp 2 -bound WT-CAP and CAP*-G141S. The DBD in CAP*-G141S adopts the active conformation even in the absence of camp and, as a result, apo-cap*-g141s binds strongly to DNA (K d ~8 µm). b, Energetics of camp binding to WT-CAP and CAP*-G141S. Binding isotherms are also shown. c, The thermodynamic components of the allosteric structural transition undergone by DBD as it switches from the inactive to the active conformation. In a, the DBD peaks of apo-cap*-g141s fall in the line that connects the corresponding apo-cap and WT-CAP-cAMP 2 (or CAP*-G141S-cAMP 2 ) peaks. This behavior suggests that DBD in CAP*-G141S is sampling a rapid equilibrium between two conformations: the active and the inactive 54,55. The average chemical shift will be pa*δa+pb*δb, so we estimate the population of the active DBD state in apo-cap*- G141S to ~70-80%. 14
15 Figure S15. Structural vs dynamic activation of protein binding and function. a, The protein exists in an inactive ( T ) and an active ( R ) conformational state. According to the current paradigm, allosteric effector (yellow) binding to the protein induces an allosteric transition (T R) that activates the protein for binding to the ligand (magenta). b, The current paradigm can be modified to include an alternative view (dynamic activation): effector binding fails to induce (stabilize) the T R transition, but the protein becomes activated for binding as a result of changes in protein motions that give rise to favorable conformational entropy (the enhanced dynamic character of the protein is illustrated with a wavy line). 15
16 Figure S16. Characterization of the camp-binding effect on a number of CAP mutants, originally designated as CAP* mutants 14,56. Substitutions at positions 53, 62, 141, 142, 144 and 148 have been proposed to affect CAP activity. Here we characterized the following substitutions (shown in a): D53H; S62F; G141S; R142H/A144T; and, L148R. All of these substitutions are located at the interface between the two domains (CBD and DBD), with the single exception of S62F that is located in the camp-binding pocket. b, Overlaid 16
17 1 H- 15 N HSQC spectra of representative residues from the helix-turn-helix motif in DBD (G173 and G184). The color code corresponds to the one in panel a, with the spectrum of apo-wt-cap and WT-CAP-cAMP 2 in black and green, respectively. The chemical shifts of apo-wt-cap are characteristic of the inactive, DNAbinding incompatible conformation (denoted I for inactive), whereas the chemical shifts of WT-CAP-cAMP 2 are characteristic of the active, DNA-binding compatible conformation (denoted A for active). The data show that camp binding to any of the CAP-D53H, CAP-G141S, CAP-R142H/A144T or CAP-L148R derivatives elicit the active DBD conformation, as in the case of WT-CAP. Therefore, the binding mechanism to DNA of the camp-bound state of each one of these CAP derivatives appears to be very similar to the one of WT-CAP. In sharp contrast, CAP-S62F-cAMP 2 has its DBD in the inactive conformation, as explained in the main text, and binds to DNA with a distinct and unconventional mechanism that involves a large conformational entropy change. It is of interest to note that among these mutants S62F is the only one located in the camp-binding pocket; all other mutants are located at the interface between CBD and DBD. c, 1 H- 15 N HSQC spectra of the camp complex of WT-CAP and all of the CAP derivatives. 17
18 Supplementary References 54. Volkman, B. F., Lipson, D., Wemmer, D. E. & Kern, D. Two-state allosteric behavior in a single-domain signaling protein. Science 291, (2001). 55. Yao, X., Rosen, M. K. & Gardner, K. H. Estimation of the available free energy in a LOV2-J alpha photoswitch. Nat. Chem. Biol. 4, (2008). 56. Garges, S. & Adhya, S. Sites of allosteric shift in the structure of the cyclic AMP receptor protein. Cell 41, (1985). 18
Supplementary Information. Overlap between folding and functional energy landscapes for. adenylate kinase conformational change
Supplementary Information Overlap between folding and functional energy landscapes for adenylate kinase conformational change by Ulrika Olsson & Magnus Wolf-Watz Contents: 1. Supplementary Note 2. Supplementary
More informationIntroduction solution NMR
2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics
More informationSUPPLEMENTARY INFORMATION
Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.
More informationSUPPLEMENTARY FIGURES. Figure S1
SUPPLEMENTARY FIGURES Figure S1 The substrate for DH domain (2R,3R,4R,6R,7S,8S,9R)-3,7,9-trihydroxy-5-oxo-2,4,6,8 tetramethylundecanoate) was docked as two separate fragments shown in magenta and blue
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group
More informationSupporting Information
Supporting Information Allosteric communication disrupted by small molecule binding to the Imidazole glycerol phosphate synthase protein-protein interface. Ivan Rivalta*,#, George P. Lisi #, Ning-Shiuan
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the
More informationTracking Protein Allostery in Evolution
Tracking Protein Allostery in Evolution Glycogen phosphorylase frees sugars to provide energy GP orthologs diverged 600,000,000 years can respond to transcription controls, metabolite concentrations and
More informationSupplementary Figures:
Supplementary Figures: Supplementary Figure 1: The two strings converge to two qualitatively different pathways. A) Models of active (red) and inactive (blue) states used as end points for the string calculations
More informationSupplementary Figures
1 Supplementary Figures Supplementary Figure 1 Type I FGFR1 inhibitors (a) Chemical structures of a pyrazolylaminopyrimidine inhibitor (henceforth referred to as PAPI; PDB-code of the FGFR1-PAPI complex:
More informationNMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease
University of Wollongong Research Online Faculty of Science - Papers (Archive) Faculty of Science, Medicine and Health 2009 NMR study of complexes between low molecular mass inhibitors and the West Nile
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/3/4/e1600663/dc1 Supplementary Materials for A dynamic hydrophobic core orchestrates allostery in protein kinases Jonggul Kim, Lalima G. Ahuja, Fa-An Chao, Youlin
More informationSUPPLEMENTARY INFORMATION. doi: /nature07461
Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of
More informationSupplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,
More informationBacterial protease uses distinct thermodynamic signatures for substrate recognition
Bacterial protease uses distinct thermodynamic signatures for substrate recognition Gustavo Arruda Bezerra, Yuko Ohara-Nemoto, Irina Cornaciu, Sofiya Fedosyuk, Guillaume Hoffmann, Adam Round, José A. Márquez,
More informationSupporting Information
Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Resonance assignment and NMR spectra for hairpin and duplex A 6 constructs. (a) 2D HSQC spectra of hairpin construct (hp-a 6 -RNA) with labeled assignments. (b) 2D HSQC or SOFAST-HMQC
More informationNB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5
SUPPLEMENTARY TABLES Suppl. Table 1. Protonation states at ph 7.4 and 4.5. Protonation states of titratable residues in GCase at ph 7.4 and 4.5. Histidine: HID, H at δ-nitrogen; HIE, H at ε-nitrogen; HIP,
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting
More informationConformational Geometry of Peptides and Proteins:
Conformational Geometry of Peptides and Proteins: Before discussing secondary structure, it is important to appreciate the conformational plasticity of proteins. Each residue in a polypeptide has three
More informationProtein dynamics from NMR Relaxation data
Protein dynamics from NMR Relaxation data Clubb 3/15/17 (S f2 ) ( e ) Nitrogen-15 relaxation ZZ-exchange R 1 = 1/T 1 Longitudinal relaxation (decay back to z-axis) R 2 = 1/T 2 Spin-spin relaxation (dephasing
More information17. Biomolecular Interaction
17. Biomolecular Interaction Methods for characterizing biomolecular interactions Sequence-specific DNA binding ligands Molecular mechanisms of drug action and drug resistance In silico compound design
More informationUseful background reading
Overview of lecture * General comment on peptide bond * Discussion of backbone dihedral angles * Discussion of Ramachandran plots * Description of helix types. * Description of structures * NMR patterns
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationSupersecondary Structures (structural motifs)
Supersecondary Structures (structural motifs) Various Sources Slide 1 Supersecondary Structures (Motifs) Supersecondary Structures (Motifs): : Combinations of secondary structures in specific geometric
More informationSensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
More informationNitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein
Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
More informationIntroduction to Comparative Protein Modeling. Chapter 4 Part I
Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin
More informationChapter 1. Topic: Overview of basic principles
Chapter 1 Topic: Overview of basic principles Four major themes of biochemistry I. What are living organism made from? II. How do organism acquire and use energy? III. How does an organism maintain its
More informationLecture 2 and 3: Review of forces (ctd.) and elementary statistical mechanics. Contributions to protein stability
Lecture 2 and 3: Review of forces (ctd.) and elementary statistical mechanics. Contributions to protein stability Part I. Review of forces Covalent bonds Non-covalent Interactions: Van der Waals Interactions
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1737 Supplementary Table 1 variant Description FSEC - 2B12 a FSEC - 6A1 a K d (leucine) c Leucine uptake e K (wild-type like) K (Y18F) K (TS) K (TSY) K288A mutant, lipid facing side chain
More informationSupporting Information
Supporting Information Boehr et al. 10.1073/pnas.0914163107 SI Text Materials and Methods. R 2 relaxation dispersion experiments. 15 NR 2 relaxation dispersion data measured at 1 H Larmor frequencies of
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10955 Supplementary Figures Supplementary Figure 1. Electron-density maps and crystallographic dimer structures of the motor domain. (a f) Stereo views of the final electron-density maps
More informationSubstrate-dependent switching of the allosteric binding mechanism of a dimeric enzyme
Supplementary Information: Substrate-dependent switching of the allosteric binding mechanism of a dimeric enzyme Lee Freiburger, 1 Teresa Miletti, 1 Siqi Zhu, 1 Oliver Baettig, Albert Berghuis, Karine
More informationInterpreting and evaluating biological NMR in the literature. Worksheet 1
Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively
More informationSUPPLEMENTARY INFORMATION
5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.
More informationProteins are not rigid structures: Protein dynamics, conformational variability, and thermodynamic stability
Proteins are not rigid structures: Protein dynamics, conformational variability, and thermodynamic stability Dr. Andrew Lee UNC School of Pharmacy (Div. Chemical Biology and Medicinal Chemistry) UNC Med
More informationPresenter: She Zhang
Presenter: She Zhang Introduction Dr. David Baker Introduction Why design proteins de novo? It is not clear how non-covalent interactions favor one specific native structure over many other non-native
More informationSupplemental Data SUPPLEMENTAL FIGURES
Supplemental Data CRYSTAL STRUCTURE OF THE MG.ADP-INHIBITED STATE OF THE YEAST F 1 C 10 ATP SYNTHASE Alain Dautant*, Jean Velours and Marie-France Giraud* From Université Bordeaux 2, CNRS; Institut de
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Summary of 1D Experiment time domain data Fourier Transform (FT) frequency domain data or Transverse Relaxation Ensemble of Nuclear
More informationPhysiochemical Properties of Residues
Physiochemical Properties of Residues Various Sources C N Cα R Slide 1 Conformational Propensities Conformational Propensity is the frequency in which a residue adopts a given conformation (in a polypeptide)
More informationGene regulation I Biochemistry 302. Bob Kelm February 25, 2005
Gene regulation I Biochemistry 302 Bob Kelm February 25, 2005 Principles of gene regulation (cellular versus molecular level) Extracellular signals Chemical (e.g. hormones, growth factors) Environmental
More informationA Single Outer Sphere Mutation Stabilizes apo- Mn Superoxide Dismutase by 35 C and. Disfavors Mn Binding.
Supporting information for A Single Outer Sphere Mutation Stabilizes apo- Mn Superoxide Dismutase by 35 C and Disfavors Mn Binding. Anne-Frances Miller* and Ting Wang Department of Chemistry, University
More informationSignal Transduction Phosphorylation Protein kinases. Misfolding diseases. Protein Engineering Lysozyme variants
Signal Transduction Phosphorylation Protein kinases Misfolding diseases Protein Engineering Lysozyme variants Cells and Signals Regulation The cell must be able to respond to stimuli Cellular activities
More informationProblem Set 1
2006 7.012 Problem Set 1 Due before 5 PM on FRIDAY, September 15, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. For each of the following parts, pick
More informationOther Cells. Hormones. Viruses. Toxins. Cell. Bacteria
Other Cells Hormones Viruses Toxins Cell Bacteria ΔH < 0 reaction is exothermic, tells us nothing about the spontaneity of the reaction Δ H > 0 reaction is endothermic, tells us nothing about the spontaneity
More informationBasic structures of proteins
Basic structures of proteins Structural Hierarchy of Protein Primary structure Functional elements : α-helix, strands, β-sheet, loops.. - Structure, affinity, activity, specificity, stability etc. Secondary
More informationMicrocalorimetry for the Life Sciences
Microcalorimetry for the Life Sciences Why Microcalorimetry? Microcalorimetry is universal detector Heat is generated or absorbed in every chemical process In-solution No molecular weight limitations Label-free
More informationSupporting information to: Time-resolved observation of protein allosteric communication. Sebastian Buchenberg, Florian Sittel and Gerhard Stock 1
Supporting information to: Time-resolved observation of protein allosteric communication Sebastian Buchenberg, Florian Sittel and Gerhard Stock Biomolecular Dynamics, Institute of Physics, Albert Ludwigs
More informationFinal Chem 4511/6501 Spring 2011 May 5, 2011 b Name
Key 1) [10 points] In RNA, G commonly forms a wobble pair with U. a) Draw a G-U wobble base pair, include riboses and 5 phosphates. b) Label the major groove and the minor groove. c) Label the atoms of
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen Transverse Relaxation Ensemble
More informationType II Kinase Inhibitors Show an Unexpected Inhibition Mode against Parkinson s Disease-Linked LRRK2 Mutant G2019S.
Type II Kinase Inhibitors Show an Unexpected Inhibition Mode against Parkinson s Disease-Linked LRRK2 Mutant G219S. Min Liu@&*, Samantha A. Bender%*, Gregory D Cuny@, Woody Sherman, Marcie Glicksman@ Soumya
More informationTutorial: Structural Analysis of a Protein-Protein Complex
Molecular Modeling Section (MMS) Department of Pharmaceutical and Pharmacological Sciences University of Padova Via Marzolo 5-35131 Padova (IT) @contact: stefano.moro@unipd.it Tutorial: Structural Analysis
More informationSUPPLEMENTARY INFORMATION
Parallel Allostery by camp and PDE Coordinates Activation and Termination Phases in camp Signaling Srinath Krishnamurthy, 1 Nikhil Kumar Tulsian, 1 Arun Chandramohan, 1 and Ganesh S. Anand 1, * 1 Department
More informationNature Structural and Molecular Biology: doi: /nsmb.2938
Supplementary Figure 1 Characterization of designed leucine-rich-repeat proteins. (a) Water-mediate hydrogen-bond network is frequently visible in the convex region of LRR crystal structures. Examples
More informationObjective: Students will be able identify peptide bonds in proteins and describe the overall reaction between amino acids that create peptide bonds.
Scott Seiple AP Biology Lesson Plan Lesson: Primary and Secondary Structure of Proteins Purpose:. To understand how amino acids can react to form peptides through peptide bonds.. Students will be able
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11744 Supplementary Table 1. Crystallographic data collection and refinement statistics. Wild-type Se-Met-BcsA-B SmCl 3 -soaked EMTS-soaked Data collection Space
More informationTable S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
More informationSecondary Structure. Bioch/BIMS 503 Lecture 2. Structure and Function of Proteins. Further Reading. Φ, Ψ angles alone determine protein structure
Bioch/BIMS 503 Lecture 2 Structure and Function of Proteins August 28, 2008 Robert Nakamoto rkn3c@virginia.edu 2-0279 Secondary Structure Φ Ψ angles determine protein structure Φ Ψ angles are restricted
More informationSUPPLEMENTARY INFORMATION
www.nature.com/nature 1 Figure S1 Sequence alignment. a Structure based alignment of the plgic of E. chrysanthemi (ELIC), the acetylcholine binding protein from the snail Lymnea stagnalis (AchBP, PDB code
More informationApo and InsP 3 -bound crystal structures of the ligand-binding domain of an InsP 3 receptor
Published as: Nat Struct Mol Biol. ; 18(10): 1172 1174. Apo and InsP 3 -bound crystal structures of the ligand-binding domain of an InsP 3 receptor Chun-Chi Lin 1,2, Kyuwon Baek 1,2, and Zhe Lu 1 1 Department
More information1. What is an ångstrom unit, and why is it used to describe molecular structures?
1. What is an ångstrom unit, and why is it used to describe molecular structures? The ångstrom unit is a unit of distance suitable for measuring atomic scale objects. 1 ångstrom (Å) = 1 10-10 m. The diameter
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),
More informationAn Introduction to Metabolism
An Introduction to Metabolism I. All of an organism=s chemical reactions taken together is called metabolism. A. Metabolic pathways begin with a specific molecule, which is then altered in a series of
More informationBSc and MSc Degree Examinations
Examination Candidate Number: Desk Number: BSc and MSc Degree Examinations 2018-9 Department : BIOLOGY Title of Exam: Molecular Biology and Biochemistry Part I Time Allowed: 1 hour and 30 minutes Marking
More informationComparison between Bacteriorhodopsin and Halorhodopsin. Halorhodopsin (HR) and Bacteriorhodopsin (BR) belong to a subfamily of
Comparison between Bacteriorhodopsin and Halorhodopsin Halorhodopsin (HR) and Bacteriorhodopsin (BR) belong to a subfamily of heptahelical membrane proteins, the archaeal rhodopsins. They are found in
More informationSection Week 3. Junaid Malek, M.D.
Section Week 3 Junaid Malek, M.D. Biological Polymers DA 4 monomers (building blocks), limited structure (double-helix) RA 4 monomers, greater flexibility, multiple structures Proteins 20 Amino Acids,
More informationMajor Types of Association of Proteins with Cell Membranes. From Alberts et al
Major Types of Association of Proteins with Cell Membranes From Alberts et al Proteins Are Polymers of Amino Acids Peptide Bond Formation Amino Acid central carbon atom to which are attached amino group
More informationSection 10/5/06. Junaid Malek, M.D.
Section 10/5/06 Junaid Malek, M.D. Equilibrium Occurs when two interconverting states are stable This is represented using stacked arrows: State A State B, where State A and State B can represent any number
More informationcamp-dependent allostery and dynamics in Epac: an NMR view
Signalling 2011: a Biochemical Society Centenary Celebration 219 camp-dependent allostery and dynamics in Epac: an NMR view Rajeevan Selvaratnam*, Madoka Akimoto*, Bryan VanSchouwen* and Giuseppe Melacini*
More informationPart 7 Bonds and Structural Supports
Part 7 Bonds and Structural Supports http://cbm.msoe.edu/newwebsite/learntomodel Introduction In addition to covalent bonds between atoms in a molecule, Jmol has the ability to render Hydrogen Bonds and
More informationBonds and Structural Supports
Bonds and Structural Supports Part of the Jmol Training Guide from the MSOE Center for BioMolecular Modeling Interactive version available at http://cbm.msoe.edu/teachingresources/jmol/jmoltraining/struts.html
More informationChapter 9 DNA recognition by eukaryotic transcription factors
Chapter 9 DNA recognition by eukaryotic transcription factors TRANSCRIPTION 101 Eukaryotic RNA polymerases RNA polymerase RNA polymerase I RNA polymerase II RNA polymerase III RNA polymerase IV Function
More informationProtein Structure Refinement Using 13 C α Chemical. Shift Tensors. Benjamin J. Wylie, Charles D. Schwieters, Eric Oldfield and Chad M.
Protein Structure Refinement Using 13 C α Chemical Shift Tensors Benjamin J. Wylie, Charles D. Schwieters, Eric Oldfield and Chad M. Rienstra * Department of Chemistry, University of Illinois at Urbana-Champaign,
More informationAffinity labels for studying enzyme active sites. Irreversible Enzyme Inhibition. Inhibition of serine protease with DFP
Irreversible Enzyme Inhibition Irreversible inhibitors form stable covalent bonds with the enzyme (e.g. alkylation or acylation of an active site side chain) There are many naturally-occurring and synthetic
More informationSupplemental Information
Supplemental Information Combinatorial Readout of Unmodified H3R2 and Acetylated H3K14 by the Tandem PHD Finger of MOZ Reveals a Regulatory Mechanism for HOXA9 Transcription Yu Qiu 1, Lei Liu 1, Chen Zhao
More informationBIRKBECK COLLEGE (University of London)
BIRKBECK COLLEGE (University of London) SCHOOL OF BIOLOGICAL SCIENCES M.Sc. EXAMINATION FOR INTERNAL STUDENTS ON: Postgraduate Certificate in Principles of Protein Structure MSc Structural Molecular Biology
More informationBiophysical Model Building
Biophysical Model Building Step 1: Come up with a hypothesis about how a system works How many binding sites? Is there cooperativity? Step 2: Translate the qualitative hypotheses into an observable mathematical
More informationNMR Structure of the HWE Kinase Associated Response Regulator Sma0114 in Its Activated State
pubs.acs.org/biochemistry NMR Structure of the HWE Kinase Associated Response Regulator Sma0114 in Its Activated State Sarah R. Sheftic, Emma White, Daniel J. Gage, and Andrei T. Alexandrescu* Department
More informationBiology Chemistry & Physics of Biomolecules. Examination #1. Proteins Module. September 29, Answer Key
Biology 5357 Chemistry & Physics of Biomolecules Examination #1 Proteins Module September 29, 2017 Answer Key Question 1 (A) (5 points) Structure (b) is more common, as it contains the shorter connection
More informationLecture #8 9/21/01 Dr. Hirsh
Lecture #8 9/21/01 Dr. Hirsh Types of Energy Kinetic = energy of motion - force x distance Potential = stored energy In bonds, concentration gradients, electrical potential gradients, torsional tension
More informationLecture 10 (10/4/17) Lecture 10 (10/4/17)
Lecture 10 (10/4/17) Reading: Ch4; 125, 138-141, 141-142 Problems: Ch4 (text); 7, 9, 11 Ch4 (study guide); 1, 2 NEXT Reading: Ch4; 125, 132-136 (structure determination) Ch4; 12-130 (Collagen) Problems:
More informationATP Binding Enables Broad Antibiotic Selectivity of Aminoglycoside Phosphotransferase(3 )-IIIa: An Elastic Network Analysis
doi:10.1016/j.jmb.2011.03.061 J. Mol. Biol. (2011) 409, 450 465 Contents lists available at www.sciencedirect.com Journal of Molecular Biology journal homepage: http://ees.elsevier.com.jmb ATP Binding
More informationschematic diagram; EGF binding, dimerization, phosphorylation, Grb2 binding, etc.
Lecture 1: Noncovalent Biomolecular Interactions Bioengineering and Modeling of biological processes -e.g. tissue engineering, cancer, autoimmune disease Example: RTK signaling, e.g. EGFR Growth responses
More informationTHE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION
THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION AND CALIBRATION Calculation of turn and beta intrinsic propensities. A statistical analysis of a protein structure
More informationEnhancing hydrogen production of microalgae by redirecting electrons from photosystem I to hydrogenase
Electronic Supplementary Material (ESI) for Energy & Environmental Science. This journal is The Royal Society of Chemistry 2014 Supplementary information for Enhancing hydrogen production of microalgae
More informationSUPPLEMENTARY INFORMATION
Fig. 1 Influences of crystal lattice contacts on Pol η structures. a. The dominant lattice contact between two hpol η molecules (silver and gold) in the type 1 crystals. b. A close-up view of the hydrophobic
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/5/243/ra68/dc1 Supplementary Materials for Superbinder SH2 Domains Act as Antagonists of Cell Signaling Tomonori Kaneko, Haiming Huang, Xuan Cao, Xing Li, Chengjun
More informationElectronic Supplementary Information for
Electronic Supplementary Material (ESI) for Metallomics. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information for Metal ion mediated transition from random coil to β-sheet
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Experimental approach for enhancement of unbiased Fo Fc maps.
Supplementary Figure 1 Experimental approach for enhancement of unbiased Fo Fc maps. a, c, Unbiased Fo-Fc maps of the Tth 70S post-catalysis complex at 2.55 Å resolution with (a) or without (c) bulk solvent
More informationSupplemental data for
Supplemental data for A Real-Time Guanine Nucleotide Exchange Assay using NMR: Activation of RhoA by PDZ- RhoGEF. Geneviève M.C. Gasmi-Seabrook 1,3, Christopher B. Marshall 1,3, Melissa Cheung 1,3, Bryan
More informationPymol Practial Guide
Pymol Practial Guide Pymol is a powerful visualizor very convenient to work with protein molecules. Its interface may seem complex at first, but you will see that with a little practice is simple and powerful
More informationBiological Thermodynamics
Biological Thermodynamics Classical thermodynamics is the only physical theory of universal content concerning which I am convinced that, within the framework of applicability of its basic contents, will
More informationSupporting Information
Supporting Information Arai et al. 10.1073/pnas.15179911 SI Text Protein Expression and Purification. Myb3 (mouse, residues 84 315) was expressed in Escherichia coli as a fusion with the B1 domain of protein
More informationSequential resonance assignments in (small) proteins: homonuclear method 2º structure determination
Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield
More information