Timescales of Protein Dynamics

Size: px
Start display at page:

Download "Timescales of Protein Dynamics"

Transcription

1 Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007

2 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen

3 Transverse Relaxation Ensemble of Nuclear Spins Loss of NMR Signal T 2 Random Phase Phase Synchronization No NMR Signal NMR Signal!

4 Tranverse Relaxation Affects Resonance Linewidth FWHM= 1 π T 2 T2 is short (rapid dephasing) T2 is long (slow dephasing) Transverse Relaxation Rate Constant : R 2 =1/T 2

5 Relaxation of After 180 deg pulse Energy Time constant for return to equilibrium is T1

6 A Major Source of Relaxation is Brownian Rotational Diffusion! τ m θ H N d NH B local (t) t! τ m : rotational correlation time--the time to rotate through one radian B 0

7 The Frequency Dependence of Relexation Rates, R1 example! τ m θ H N After 180 ω B 0 Efficient relaxation if!! ω = 1 / τ m

8 Stokes-Einstein Equation for Rotational Diffusion And dependence of T1 and T2 on tumbling τ m = 4πηr3 3kT where: r = radius k = Boltzman constant h = viscosity coefficient Rule of thumb: For 20 kd at 298 K τ m (s) = 10ns! τ m (s)

9 Relaxation Rates Depend on Amplitude and Frequency of Local Field Fluctuations! R 1 (N) = c 2 J(ω) Square of fluctuating local field! Spectral Density Function! Note-the Spectral Density Function, J, is the Fourier Transform of the C rot (t), the correlation function for rotational diffusion J(ω) = τ m 1+ ( ωτ m )2

10 15 N- 1 H spin pair has four energy states N H! ω H ββ! ω N βα αβ! ω N αα! ω H

11 ( ) ( ) ( ) [ ] ( ) N N H N N H J c J J J d R ω ω ω ω ω ω = ( ) ( ) ( ) ( ) ( ) [ ] ( ) ( ) [ ] J J c J J J J J d R N N H H N N H = ω ω ω ω ω ω ω NH H N r h d = π γ γ µ = Δ 3 N c ω where Farrow et.al, (1995) J. Biomol. NMR 6, 153 Relaxation rates for spin-1/2 nucleus that has a dipolar interaction and chemical shift anisotropy Dipolar Coupling Chemical Shift Anisotropy

12 The spin echo to measure R T T FT Resonance intensity weighted by exp(-r 2 2T)

13 Spin Echo Spectra at Variable t Delay T=40 ms T=20 ms 0 T=0

14 Extracting R2 from Spin-Echo Data Remember: R 2 =1/T 2 I(t)! I(T)!=!exp(*R 2 2T) T

15 The Inversion Recovery Experiment to measure R1 90y T t

16 Inversion Recovery Data

17 Analysis of Inversion Recovery Data Mz eq M z (t) Mz = Mz eq ( 1-2 e -R1*T ) -Mz eq

18 T1 and T2 inform on dynamics for each residue!

19 Model Free formalism accounts for internal motions J Lipari-Szabo (Model Free) ( ω) ( 2 S τ 1 S ) τ ( ) ( ) m ω τ m 1+ ω τ = 2! τ m! τ e H θ N where 1 τ 1 1 = + τ e τ m B 0

20 Heteronuclear NOE measurements Measure saturated and unsaturated experiments and take the intensity ratio for each peak Farrow and Kay, Biochemistry, 1993

21 The heteronuclear NOE N H R 1H ββ R 1N M N (N αα - N βα ) + (N αβ - N ββ ) βα αβ M H (N αα - N αβ ) + (N βα - N ββ ) R 1N R 1H αα Saturation equalizes ββ and βα, αβ and αα à M H = 0 R 1 transitions are an independent return to equilibrium

22 N H The heteronuclear NOE ββ W 2NH M N (N αα - N βα ) + (N αβ - N ββ ) βα W 0NH αβ αα W 2 transitions increase N αα and decrease N ββ à M increases (positive NOE) M N decreases (negative NOE) W 0 transitions increase N βα and decrease N αβ à M decreases (negative NOE) M N increases (positive NOE) NOE= I(sat) I(unsat) =1+( γ H I(unsat) γ )d2 6J(ω +ω ) J(ω ω ) N N H N H /R 1 (N)

23 15 N-{ 1 H} Heteronuclear NOE versus rotational correlation time! I sat I unsat! τ m (s)

24 Model Free formalism accounts for internal motions J Lipari-Szabo (Model Free) ( ω) ( 2 S τ 1 S ) τ ( ) ( ) m ω τ m 1+ ω τ = 2! τ m! τ e H θ N where 1 τ 1 1 = + τ e τ m!s 2 and! τ m and! τ e obtained by fitting against R1, R2 and heteronuclear NOE B 0

25 Determining Structures by NMR

26

27 A Real 2D NOE Experiment of a Small Peptide A projection through both dimensions gives a 1D spectrum HN-Haliph crosspeaks HN-Ha crosspeaks 1H, ppm HN-HN crosspeaks 1H, ppm

28 Interpretation of NOESY Spectra Crosspeaks are a measure of NOE between two spins. Intensity proportional to The intensity of the crosspeak is used to quantify the interaction. 1H ppm 1H ppm

29 Higher Dimensionality 3 and 4D Heteronuclear Experiments on Isotopically Labeled (15N-13C) Proteins 2D NOESY of a 76 residue protein homodimer (effectively 18kD) in D2O 1H, ppm 1H, ppm In practice, even small proteins have very crowded 2D spectra making assignment very difficult. In this case the fact that it is in D2O simplifies the spectra because the amide protons exchange for deuterium and are not visible.

30 Benefit of C13 and N15 labeling of Proteins for NMR Higher Dimensionality (3 and 4D) Experiments Reduce Overlap Compared to 2D Experiments 1H! 15N! 1H! 1H! 1H! 2D noe Expt. on unlabeled protein 3D noe Expt. on N15-labeled protein Many More Types of Experiments Can be Done on Isotopically Labeled Protein 15N-1H! 1H-13C! noes between Protons Attached to N15 and Protons Attached to 13C 13C-1H! 1H-13C! noes between Protons Attached to 13C and Protons and Attached to 13C

31 Side-chain protein assignments R H-C-H H-C-H R N--C--C--N--C--C-- H H O H H O R H-C-H R H-C-H --N--C--C--N--C--C-- H H O H H O H(CCO)NH i - 1 res. All Carbon s H s at i-1 to N-H pair. 15N-TOCSY i res. All H s at i to N-H pair.

32 Close interatomic distances in secondary structures alpha-helix parallel beta-sheet antiparallel beta-sheet type I turn type II turn

33 H a chemical shifts and secondary structure the figure at right shows distributions of H a chemical shifts observed in sheets (lighter bars) and helices (darker bars). H a chemical shifts in a-helices are on average 0.39 ppm below random coil values, while b-sheet values are 0.37 ppm above random coil values. Wishart, Sykes & Richards J Mol Biol (1991) 222, 311.

34 Chemical shift index (CSI) trends like these led to the development of the concept of the chemical shift index* as a tool for assigning secondary structure using chemical shift values. one starts with a table of reference values for each aminoacid type, which is essentially a table of random coil H a values CSI s are then assigned as follows: exp tl H a shift rel. to reference assigned CSI within ± 0.1 ppm 0 >0.1 ppm lower -1 >0.1 ppm higher +1 *Wishart, Sykes & Richards Biochemistry (1992) 31,

35 Chemical shift indices CSI residue # any dense grouping of four or more -1 s, uninterrupted by 1 s is assigned as a helix, while any dense grouping of three or more 1 s, uninterrupted by -1 s, is assigned as a sheet. a dense grouping means at least 70% nonzero CSI s. other one regions are assigned as coil this simple technique assigns 2ndary structure w/90-95% accuracy similar useful relationships exist for 13 C a, 13 C C=O shifts

36 NMR provides information about structure chemical shifts <=> local electronic environment coupling constants <=> torsion angles NOE, ROE <=> interproton distances residual dipolar couplings <=> bond orientation and dynamics relaxation times NOE, ROE Most of the data describe local environment of the protons relative to each other not the global conformation of the molecule

37 Distance NOE: The distance between i and j is a function of the NOE intensity D ij ~ C(NOE ij ) -6 H-bonds: Identified by slowly exchanging amide H N protons Angles Side Chain and backbone torsion angles identified from J-coupling experiments Chemical Shift also gives Angular Information Residual Dipolar Couplings Bond Orientations Relative to an Alignment Tensor

38 Molecular Dynamics with Simulated Annealing starting from random coordinates Goal is to minimize the hybrid energy function Additional Unambiguous Experimental Restraints E-ForceField E-NOEs E-Angles E-H_bonds E-Chemical_shift E-Dipolar_couplings

39

40

41 Key problem is ambiguity in NOE assignments Need for higher dimensional data: 3D & 4D Need for heteronuclear data Need for better calculational strategies that can deal with ambiguous data

42

43 # residues # restraints/residue

44 Paper Discussion

45 P21 RAS(1-166) GDP structure determined by NMR Poorly Defined Loop Ensemble of structures: backbone RMSD in Switch 2

46 Loop containing critical residues for catalysis poorly defined

47 Disorder from lack of restraints or mobility?

48 What does T2 tell us about the Switch 2 loop containing Q61?! τ m (s)

49 Is the heteronuclear NOE consistent with fast ps-ns motions in active site?! τ m (s)

50 T1/T2 Proportional to! τ m for each resid

51 Mapping relaxation data onto structure S 2

52 Dynamic Switches as a handle for regulatory factors GEF Catalyzes product release Sondek and coworkers Nature, 2000

53 Order-disorder transitions accompany GEF activation Paper for Friday Aghazadeh et al, Cell 2000

Timescales of Protein Dynamics

Timescales of Protein Dynamics Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Summary of 1D Experiment time domain data Fourier Transform (FT) frequency domain data or Transverse Relaxation Ensemble of Nuclear

More information

Using NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017

Using NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017 Using NMR to study Macromolecular Interactions John Gross, BP204A UCSF Nov 27, 2017 Outline Review of basic NMR experiment Multidimensional NMR Monitoring ligand binding Structure Determination Review:

More information

Introduction to NMR for measuring structure and dynamics + = UCSF Macromolecular Interactions. John Gross, Ph.D.

Introduction to NMR for measuring structure and dynamics + = UCSF Macromolecular Interactions. John Gross, Ph.D. Introduction to NMR for measuring structure and dynamics + = UCSF Macromolecular Interactions John Gross, Ph.D. Nuclear Spins: Microscopic Bar Magnets H µ S N N + Protein Fragment Magnetic Moment Bar Magnet

More information

I690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy

I690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy I690/B680 Structural Bioinformatics Spring 2006 Protein Structure Determination by NMR Spectroscopy Suggested Reading (1) Van Holde, Johnson, Ho. Principles of Physical Biochemistry, 2 nd Ed., Prentice

More information

Protein dynamics from NMR Relaxation data

Protein dynamics from NMR Relaxation data Protein dynamics from NMR Relaxation data Clubb 3/15/17 (S f2 ) ( e ) Nitrogen-15 relaxation ZZ-exchange R 1 = 1/T 1 Longitudinal relaxation (decay back to z-axis) R 2 = 1/T 2 Spin-spin relaxation (dephasing

More information

Introduction solution NMR

Introduction solution NMR 2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics

More information

Spin Relaxation and NOEs BCMB/CHEM 8190

Spin Relaxation and NOEs BCMB/CHEM 8190 Spin Relaxation and NOEs BCMB/CHEM 8190 T 1, T 2 (reminder), NOE T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations

More information

NMR in Structural Biology

NMR in Structural Biology NMR in Structural Biology Exercise session 2 1. a. List 3 NMR observables that report on structure. b. Also indicate whether the information they give is short/medium or long-range, or perhaps all three?

More information

NMR journey. Introduction to solution NMR. Alexandre Bonvin. Topics. Why use NMR...? Bijvoet Center for Biomolecular Research

NMR journey. Introduction to solution NMR. Alexandre Bonvin. Topics. Why use NMR...? Bijvoet Center for Biomolecular Research 2 NMR journey Introduction to solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, CCMB, Hyderabad, India November 29th

More information

Biophysical Chemistry: NMR Spectroscopy

Biophysical Chemistry: NMR Spectroscopy Relaxation & Multidimensional Spectrocopy Vrije Universiteit Brussel 9th December 2011 Outline 1 Relaxation 2 Principles 3 Outline 1 Relaxation 2 Principles 3 Establishment of Thermal Equilibrium As previously

More information

NMR in Medicine and Biology

NMR in Medicine and Biology NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR

More information

BMB/Bi/Ch 173 Winter 2018

BMB/Bi/Ch 173 Winter 2018 BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.

More information

Slow symmetric exchange

Slow symmetric exchange Slow symmetric exchange ϕ A k k B t A B There are three things you should notice compared with the Figure on the previous slide: 1) The lines are broader, 2) the intensities are reduced and 3) the peaks

More information

- Basic understandings: - Mapping interactions:

- Basic understandings: - Mapping interactions: NMR-lecture April 6th, 2009, FMP Berlin Outline: Christian Freund - Basic understandings: Relaxation Chemical exchange - Mapping interactions: -Chemical shift mapping (fast exchange) Linewidth analysis

More information

NMR Spectroscopy: A Quantum Phenomena

NMR Spectroscopy: A Quantum Phenomena NMR Spectroscopy: A Quantum Phenomena Pascale Legault Département de Biochimie Université de Montréal Outline 1) Energy Diagrams and Vector Diagrams 2) Simple 1D Spectra 3) Beyond Simple 1D Spectra 4)

More information

Introduction to Relaxation Theory James Keeler

Introduction to Relaxation Theory James Keeler EUROMAR Zürich, 24 Introduction to Relaxation Theory James Keeler University of Cambridge Department of Chemistry What is relaxation? Why might it be interesting? relaxation is the process which drives

More information

Sequential Assignment Strategies in Proteins

Sequential Assignment Strategies in Proteins Sequential Assignment Strategies in Proteins NMR assignments in order to determine a structure by traditional, NOE-based 1 H- 1 H distance-based methods, the chemical shifts of the individual 1 H nuclei

More information

1. 3-hour Open book exam. No discussion among yourselves.

1. 3-hour Open book exam. No discussion among yourselves. Lecture 13 Review 1. 3-hour Open book exam. No discussion among yourselves. 2. Simple calculations. 3. Terminologies. 4. Decriptive questions. 5. Analyze a pulse program using density matrix approach (omonuclear

More information

NMR Relaxation and Molecular Dynamics

NMR Relaxation and Molecular Dynamics Ecole RMN Cargese Mars 2008 NMR Relaxation and Molecular Dynamics Martin Blackledge IBS Grenoble Carine van Heijenoort ICSN, CNRS Gif-sur-Yvette Solution NMR Timescales for Biomolecular Motion ps ns µs

More information

Introduction to solution NMR. Alexandre Bonvin. The NMR research group. Bijvoet Center for Biomolecular Research

Introduction to solution NMR. Alexandre Bonvin. The NMR research group. Bijvoet Center for Biomolecular Research Introduction to solution NMR 1 Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben Bente%Vestergaard% The NMR research group Prof. Marc Baldus Prof. Rolf Boelens

More information

Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination

Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield

More information

Deuteration: Structural Studies of Larger Proteins

Deuteration: Structural Studies of Larger Proteins Deuteration: Structural Studies of Larger Proteins Problems with larger proteins Impact of deuteration on relaxation rates Approaches to structure determination Practical aspects of producing deuterated

More information

Principles of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination

Principles of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination 1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination Protein Expression overexpression in E. coli - BL21(DE3) 1

More information

Biochemistry 530 NMR Theory and Practice

Biochemistry 530 NMR Theory and Practice Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:

More information

Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A

Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu " J.A. 12/11/13 Dec. 4 Dec. 9 Dec. 11" " Outline" " 1. Introduction / Spectroscopy Overview 2. NMR Spectroscopy

More information

T 1, T 2, NOE (reminder)

T 1, T 2, NOE (reminder) T 1, T 2, NOE (reminder) T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations of the system following perturbation

More information

Molecular Modeling lecture 2

Molecular Modeling lecture 2 Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography

More information

BMB/Bi/Ch 173 Winter 2018

BMB/Bi/Ch 173 Winter 2018 BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4-5pm and SFL 229, Monday 3/5 4-5:30pm. 1. NMR

More information

Quantification of Dynamics in the Solid-State

Quantification of Dynamics in the Solid-State Bernd Reif Quantification of Dynamics in the Solid-State Technische Universität München Helmholtz-Zentrum München Biomolecular Solid-State NMR Winter School Stowe, VT January 0-5, 206 Motivation. Solid

More information

PRACTICAL ASPECTS OF NMR RELAXATION STUDIES OF BIOMOLECULAR DYNAMICS

PRACTICAL ASPECTS OF NMR RELAXATION STUDIES OF BIOMOLECULAR DYNAMICS PRACTICAL ASPECTS OF MR RELAXATIO STUDIES OF BIOMOLECULAR DYAMICS Further reading: Can be downloaded from my web page Korzhnev D.E., Billeter M., Arseniev A.S., and Orekhov V. Y., MR Studies of Brownian

More information

The Physical Basis of the NMR Experiment

The Physical Basis of the NMR Experiment The Physical Basis of the NMR Experiment 1 Interaction of Materials with Magnetic Fields F F S N S N Paramagnetism Diamagnetism 2 Microscopic View: Single Spins an electron has mass and charge in addition

More information

K ex. Conformational equilibrium. equilibrium K B

K ex. Conformational equilibrium. equilibrium K B Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any yprocess in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar

More information

Presenter: She Zhang

Presenter: She Zhang Presenter: She Zhang Introduction Dr. David Baker Introduction Why design proteins de novo? It is not clear how non-covalent interactions favor one specific native structure over many other non-native

More information

PROTEIN NMR SPECTROSCOPY

PROTEIN NMR SPECTROSCOPY List of Figures List of Tables xvii xxvi 1. NMR SPECTROSCOPY 1 1.1 Introduction to NMR Spectroscopy 2 1.2 One Dimensional NMR Spectroscopy 3 1.2.1 Classical Description of NMR Spectroscopy 3 1.2.2 Nuclear

More information

Resonance assignments in proteins. Christina Redfield

Resonance assignments in proteins. Christina Redfield Resonance assignments in proteins Christina Redfield 1. Introduction The assignment of resonances in the complex NMR spectrum of a protein is the first step in any study of protein structure, function

More information

Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10

Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Instructions: This is an open book, limited time, exam. You may use notes you have from class and any text book you find useful. You may also use

More information

Triple Resonance Experiments For Proteins

Triple Resonance Experiments For Proteins Triple Resonance Experiments For Proteins Limitations of homonuclear ( 1 H) experiments for proteins -the utility of homonuclear methods drops quickly with mass (~10 kda) -severe spectral degeneracy -decreased

More information

NMR-spectroscopy of proteins in solution. Peter Schmieder

NMR-spectroscopy of proteins in solution. Peter Schmieder NMR-spectroscopy of proteins in solution Basic aspects of NMR-Spektroskopie Basic aspects of NMR-spectroscopy 3/84 Prerequisite for NMR-spectroscopy is a nuclear spin that can be thought of as a mixture

More information

5th CCPN Matt Crump. Thermodynamic quantities derived from protein dynamics

5th CCPN Matt Crump. Thermodynamic quantities derived from protein dynamics 5th CCPN 2005 -Matt Crump Thermodynamic quantities derived from protein dynamics Relaxation in Liquids (briefly!) The fluctuations of each bond vector can be described in terms of an angular correlation

More information

Structurele Biologie NMR

Structurele Biologie NMR MR journey Structurele Biologie MR 5 /3C 3 /65 MR & Structural biology course setup lectures - Sprangers R & Kay LE ature (27) basics of MR (Klaartje ouben: k.houben@uu.nl; 4/2) from peaks to data (ans

More information

CHEM / BCMB 4190/6190/8189. Introductory NMR. Lecture 10

CHEM / BCMB 4190/6190/8189. Introductory NMR. Lecture 10 CHEM / BCMB 490/690/889 Introductory NMR Lecture 0 - - CHEM 490/690 Spin-Echo The spin-echo pulse sequence: 90 - τ - 80 - τ(echo) Spins echoes are widely used as part of larger pulse sequence to refocus

More information

Lecture #7 In Vivo Water

Lecture #7 In Vivo Water Lecture #7 In Vivo Water Topics Hydration layers Tissue relaxation times Magic angle effects Magnetization Transfer Contrast (MTC) CEST Handouts and Reading assignments Mathur-De Vre, R., The NMR studies

More information

Filtered/edited NOESY spectra

Filtered/edited NOESY spectra Filtered/edited NOESY spectra NMR Seminar HS 207 Nina Ripin 22..7 Overview NMR of biomolecular complexes Problems and Solutions Filtered/edited nomenclature Experimental elements NOESY vs filtered pulse

More information

NMR Assay of Purity and Folding

NMR Assay of Purity and Folding NMR Assay of Purity and Folding Don t Need Resonance Assignments or Labeling 1D requires only 10-50 µm protein concentration 2D Provides A More Detailed Assay 15 N- 1 H HSQC 1 H COSY 13 C HSQC also! Analyze

More information

Lecture #6 (The NOE)

Lecture #6 (The NOE) Lecture #6 (The OE) 2/18/15 Clubb Determining Protein tructures by MR: Measure thousands of shorter inter-hydrogen atom distances. Use these to restrain the structure of protein computationally. Distance

More information

Lecture #6 (The NOE)

Lecture #6 (The NOE) Lecture #6 (The OE) 2/24/17 Clubb Determining Protein tructures by MR: Measure thousands of shorter inter-hydrogen atom distances. Use these to restrain the structure of protein computationally. Distances

More information

NMR Characterization of Partially Folded and Unfolded Conformational Ensembles of Proteins

NMR Characterization of Partially Folded and Unfolded Conformational Ensembles of Proteins Elisar Barbar Department of Chemistry and Biochemistry, Ohio University, Athens, OH 45701 NMR Characterization of Partially Folded and Unfolded Conformational Ensembles of Proteins Abstract: Studies of

More information

Introduction to NMR Product Operators. C. Griesinger. Max Planck Institute for Biophysical Chemistry. Am Faßberg 11. D Göttingen.

Introduction to NMR Product Operators. C. Griesinger. Max Planck Institute for Biophysical Chemistry. Am Faßberg 11. D Göttingen. ntroduction to NMR Product Operato C. Griesinger Max Planck nstitute for Biophysical Chemistry Am Faßberg 11 D-3777 Göttingen Germany cigr@nmr.mpibpc.mpg.de http://goenmr.de EMBO Coue Heidelberg Sept.

More information

Model-Free Approach to Internal Motions in Proteins

Model-Free Approach to Internal Motions in Proteins Model-Free Approach to Internal Motions in Proteins Lipari & Szabo, JACS 104, 4546 (1982) Palmer AG. Ann. Rev. Biophys. Biomol. Struc., 30, 129-155 (2001) Palmer AG, Kroenke CD, Loria JP, Meth. Enzymol.

More information

NMR BMB 173 Lecture 16, February

NMR BMB 173 Lecture 16, February NMR The Structural Biology Continuum Today s lecture: NMR Lots of slides adapted from Levitt, Spin Dynamics; Creighton, Proteins; And Andy Rawlinson There are three types of particles in the universe Quarks

More information

Chemistry 431. Lecture 23

Chemistry 431. Lecture 23 Chemistry 431 Lecture 23 Introduction The Larmor Frequency The Bloch Equations Measuring T 1 : Inversion Recovery Measuring T 2 : the Spin Echo NC State University NMR spectroscopy The Nuclear Magnetic

More information

UNIVERSITY OF CINCINNATI

UNIVERSITY OF CINCINNATI UNIVERSITY OF CINCINNATI Date: I,, hereby submit this work as part of the requirements for the degree of: in: It is entitled: This work and its defense approved by: Chair: Nuclear Magnetic Resonance Studies

More information

Protein Dynamics, Allostery and Function

Protein Dynamics, Allostery and Function Protein Dynamics, Allostery and Function Lecture 2. Protein Dynamics Xiaolin Cheng UT/ORNL Center for Molecular Biophysics SJTU Summer School 2017 1 Functional Protein Dynamics Proteins are dynamic and

More information

PRACTICAL ASPECTS OF NMR RELAXATION STUDIES OF BIOMOLECULAR DYNAMICS

PRACTICAL ASPECTS OF NMR RELAXATION STUDIES OF BIOMOLECULAR DYNAMICS PRACTICAL ASPECTS OF MR RELAXATIO STUDIES OF BIOMOLECULAR DYAMICS Further reading: (Can be downloaded from my web page Korzhnev D.E., Billeter M., Arseniev A.S., and Orekhov V. Y., MR Studies of Brownian

More information

Midterm Exam: CHEM/BCMB 8190 (148 points) Friday, 3 March, 2017

Midterm Exam: CHEM/BCMB 8190 (148 points) Friday, 3 March, 2017 Midterm Exam: CHEM/BCMB 8190 (148 points) Friday, 3 March, 2017 INSTRUCTIONS: You will have 50 minute to work on this exam. You can use any notes or books that you bring with you to assist you in answering

More information

NMR, X-ray Diffraction, Protein Structure, and RasMol

NMR, X-ray Diffraction, Protein Structure, and RasMol NMR, X-ray Diffraction, Protein Structure, and RasMol Introduction So far we have been mostly concerned with the proteins themselves. The techniques (NMR or X-ray diffraction) used to determine a structure

More information

Labelling strategies in the NMR structure determination of larger proteins

Labelling strategies in the NMR structure determination of larger proteins Labelling strategies in the NMR structure determination of larger proteins - Difficulties of studying larger proteins - The effect of deuteration on spectral complexity and relaxation rates - NMR expts

More information

1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )

1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,

More information

Protein Dynamics, Allostery and Function

Protein Dynamics, Allostery and Function Protein Dynamics, Allostery and Function Lecture 3. Protein Dynamics Xiaolin Cheng UT/ORNL Center for Molecular Biophysics SJTU Summer School 2017 1 Obtaining Dynamic Information Experimental Approaches

More information

NMR course at the FMP: NMR of organic compounds and small biomolecules - II -

NMR course at the FMP: NMR of organic compounds and small biomolecules - II - NMR course at the FMP: NMR of organic compounds and small biomolecules - II - 16.03.2009 The program 2/76 CW vs. FT NMR What is a pulse? Vectormodel Water-flip-back 3/76 CW vs. FT CW vs. FT 4/76 Two methods

More information

Biochemistry 530 NMR Theory and Practice

Biochemistry 530 NMR Theory and Practice Biochemistry 530 NMR Theory and Practice David Baker Autumn Quarter 2014 Slides Courtesy of Gabriele Varani Recommended NMR Textbooks Derome, A. E. (1987) Modern NMR Techniques for Chemistry Research,

More information

Relaxation, Multi pulse Experiments and 2D NMR

Relaxation, Multi pulse Experiments and 2D NMR Relaxation, Multi pulse Experiments and 2D NMR To Do s Read Chapter 6 Complete the end of chapter problems; 6 1, 6 2, 6 3, 6 5, 6 9 and 6 10. Read Chapter 15 and do as many problems as you can. Relaxation

More information

Practical Manual. General outline to use the structural information obtained from molecular alignment

Practical Manual. General outline to use the structural information obtained from molecular alignment Practical Manual General outline to use the structural information obtained from molecular alignment 1. In order to use the information one needs to know the direction and the size of the tensor (susceptibility,

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin

More information

Solid state and advanced NMR

Solid state and advanced NMR Solid state and advanced NMR Dr. Magnus Wolf-Watz Department of Chemistry Umeå University magnus.wolf-watz@chem.umu.se NMR is useful for many things!!! Chemistry Structure of small molecules, chemical

More information

Spin-spin coupling I Ravinder Reddy

Spin-spin coupling I Ravinder Reddy Spin-spin coupling I Ravinder Reddy Spin-interactions External interactions Magnetic field Bo, RF field B1 Internal Interactions Molecular motions Exchange Chemical shifts J-coupling Spin Diffusion Dipolar

More information

Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR

Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Residual Dipolar Couplings (RDC s) Relatively new technique ~ 1996 Nico Tjandra, Ad Bax- NIH, Jim Prestegard, UGA Combination of

More information

Interpreting and evaluating biological NMR in the literature. Worksheet 1

Interpreting and evaluating biological NMR in the literature. Worksheet 1 Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively

More information

Basic principles of multidimensional NMR in solution

Basic principles of multidimensional NMR in solution Basic principles of multidimensional NMR in solution 19.03.2008 The program 2/93 General aspects Basic principles Parameters in NMR spectroscopy Multidimensional NMR-spectroscopy Protein structures NMR-spectra

More information

Effects of Chemical Exchange on NMR Spectra

Effects of Chemical Exchange on NMR Spectra Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar

More information

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009 Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2009 Helical Hairpin Structure of a potent Antimicrobial Peptide MSI-594 in Lipopolysaccharide Micelles by NMR Anirban

More information

Introduction to biomolecular NMR spectroscopy

Introduction to biomolecular NMR spectroscopy Oct 2002 Introduction to biomolecular NMR spectroscopy Michael Sattler, Structural & Computational Biology EMBL Heidelberg Contents Introduction...2 History... 3 Methodological developments for structure

More information

Biochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington

Biochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1299 Protein fold determined by paramagnetic magic-angle spinning solid-state NMR spectroscopy Ishita Sengupta 1, Philippe S. Nadaud 1, Jonathan J. Helmus 1, Charles D. Schwieters 2

More information

8 NMR Interactions: Dipolar Coupling

8 NMR Interactions: Dipolar Coupling 8 NMR Interactions: Dipolar Coupling 8.1 Hamiltonian As discussed in the first lecture, a nucleus with spin I 1/2 has a magnetic moment, µ, associated with it given by µ = γ L. (8.1) If two different nuclear

More information

More NMR Relaxation. Longitudinal Relaxation. Transverse Relaxation

More NMR Relaxation. Longitudinal Relaxation. Transverse Relaxation More NMR Relaxation Longitudinal Relaxation Transverse Relaxation Copyright Peter F. Flynn 2017 Experimental Determination of T1 Gated Inversion Recovery Experiment The gated inversion recovery pulse sequence

More information

Supporting Information

Supporting Information Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,

More information

Relaxation. Ravinder Reddy

Relaxation. Ravinder Reddy Relaxation Ravinder Reddy Relaxation What is nuclear spin relaxation? What causes it? Effect on spectral line width Field dependence Mechanisms Thermal equilibrium ~10-6 spins leads to NMR signal! T1 Spin-lattice

More information

Finding Bonds, H-bonds

Finding Bonds, H-bonds Finding Bonds, H-bonds A hydrogen bond (HB) allows chunks of peptide relatively far away from each other to come close together. They are all over the place in globular proteins, so if we could identify

More information

8.2 The Nuclear Overhauser Effect

8.2 The Nuclear Overhauser Effect 8.2 The Nuclear Overhauser Effect Copyright Hans J. Reich 2016 All Rights Reserved University of Wisconsin An important consequence of DD relaxation is the Nuclear Overhauser Effect, which can be used

More information

Citation for published version (APA): Feenstra, K. A. (2002). Long term dynamics of proteins and peptides. Groningen: s.n.

Citation for published version (APA): Feenstra, K. A. (2002). Long term dynamics of proteins and peptides. Groningen: s.n. University of Groningen Long term dynamics of proteins and peptides Feenstra, Klaas Antoni IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from

More information

Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets

Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas

More information

Basics of protein structure

Basics of protein structure Today: 1. Projects a. Requirements: i. Critical review of one paper ii. At least one computational result b. Noon, Dec. 3 rd written report and oral presentation are due; submit via email to bphys101@fas.harvard.edu

More information

ELECTRON PARAMAGNETIC RESONANCE

ELECTRON PARAMAGNETIC RESONANCE ELECTRON PARAMAGNETIC RESONANCE = MAGNETIC RESONANCE TECHNIQUE FOR STUDYING PARAMAGNETIC SYSTEMS i.e. SYSTEMS WITH AT LEAST ONE UNPAIRED ELECTRON Examples of paramagnetic systems Transition-metal complexes

More information

Protein Structure Determination using NMR Spectroscopy. Cesar Trinidad

Protein Structure Determination using NMR Spectroscopy. Cesar Trinidad Protein Structure Determination using NMR Spectroscopy Cesar Trinidad Introduction Protein NMR Involves the analysis and calculation of data collected from multiple NMR techniques Utilizes Nuclear Magnetic

More information

Spin Dynamics Basics of Nuclear Magnetic Resonance. Malcolm H. Levitt

Spin Dynamics Basics of Nuclear Magnetic Resonance. Malcolm H. Levitt Spin Dynamics Basics of Nuclear Magnetic Resonance Second edition Malcolm H. Levitt The University of Southampton, UK John Wiley &. Sons, Ltd Preface xxi Preface to the First Edition xxiii Introduction

More information

Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190

Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,

More information

Effects of Chemical Exchange on NMR Spectra

Effects of Chemical Exchange on NMR Spectra Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar

More information

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small

More information

SUPPLEMENTARY ONLINE DATA

SUPPLEMENTARY ONLINE DATA SUPPLEMENTARY ONLINE DATA Secreted Isoform of Human Lynx1 (SLURP-2): Spatial Structure and Pharmacology of Interaction with Different Types of Acetylcholine Receptors E.N. Lyukmanova 1,2,*, M.A. Shulepko

More information

Supplementary Materials belonging to

Supplementary Materials belonging to Supplementary Materials belonging to Solution conformation of the 70 kda E.coli Hsp70 complexed with ADP and substrate. Eric B. Bertelsen 1, Lyra Chang 2, Jason E. Gestwicki 2 and Erik R. P. Zuiderweg

More information

NMR Spectroscopy of Polymers

NMR Spectroscopy of Polymers UNESCO/IUPAC Course 2005/2006 Jiri Brus NMR Spectroscopy of Polymers Brus J 1. part At the very beginning the phenomenon of nuclear spin resonance was studied predominantly by physicists and the application

More information

Analysis of MD trajectories in GROMACS David van der Spoel

Analysis of MD trajectories in GROMACS David van der Spoel Analysis of MD trajectories in GROMACS David van der Spoel What does MD produce? Energy terms E(t) Coordinates x(t) Velocities v(t) Forces f(t) Managing your files trjcat - merging trajectories concatenating

More information

Biophysical Chemistry: NMR Spectroscopy

Biophysical Chemistry: NMR Spectroscopy Spin Dynamics & Vrije Universiteit Brussel 25th November 2011 Outline 1 Pulse/Fourier Transform NMR Thermal Equilibrium Effect of RF Pulses The Fourier Transform 2 Symmetric Exchange Between Two Sites

More information

The Effect of Motional Averaging on the Calculation of NMR-Derived Structural Properties

The Effect of Motional Averaging on the Calculation of NMR-Derived Structural Properties PROTEINS: Structure, Function, and Genetics 6:542 555 (1999) The Effect of Motional Averaging on the Calculation of NMR-Derived Structural Properties Xavier Daura, 1 Iris Antes, 1,2 Wilfred F. van Gunsteren,

More information

PROTEIN'STRUCTURE'DETERMINATION'

PROTEIN'STRUCTURE'DETERMINATION' PROTEIN'STRUCTURE'DETERMINATION' USING'NMR'RESTRAINTS' BCMB/CHEM'8190' Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,

More information

H B. θ = 90 o. Lecture notes Part 4: Spin-Spin Coupling. θ θ

H B. θ = 90 o. Lecture notes Part 4: Spin-Spin Coupling. θ θ Lecture notes Part 4: Spin-Spin Coupling F. olger Försterling October 4, 2011 So far, spins were regarded spins isolated from each other. owever, the magnetic moment of nuclear spins also have effect on

More information

Magnetisation Transfer Schemes

Magnetisation Transfer Schemes Magnetisation Transfer Schemes P. K. Madhu Department of Chemical Sciences Tata Institute of Fundamental Research Homi Bhabha Road Colaba Mumbai 400 005, India Sensitivity of NMR Spectroscopy S/N Nγ exc

More information

Solid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum,

Solid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum, Solid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum, 16.02.2009 Solid-state and solution NMR spectroscopy have many things in common Several concepts have been/will

More information

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

More information