Supplementary Information. Overlap between folding and functional energy landscapes for. adenylate kinase conformational change
|
|
- Meagan Quinn
- 5 years ago
- Views:
Transcription
1 Supplementary Information Overlap between folding and functional energy landscapes for adenylate kinase conformational change by Ulrika Olsson & Magnus Wolf-Watz Contents: 1. Supplementary Note 2. Supplementary Figures S1-S11 3. Supplementary Table S1 4. Supplementary Methods 5. Supplementary References
2 Supplementary Note It might seem intuitive that the chemical shifts of the mutant AK variants should fall inbetween the chemical shifts of WT AK in open and closed states. However, a detailed consideration of the chemical shifts observed for the various states involved during the ATP binding event show that the chemical shifts of the mutants are not expected to fall in between open/closed states of WT AK. This feature is shown schematically in Supplementary Figure S11. First, the chemical shift change for WT AK in response to ATP binding is considered. WT does not populate the TS to an extent that affects the chemical shifts of either open and closed states. The blue circle representing WT AK in the apo state should be on top of the orange circle (open AK) but is shifted for clarity. When ATP is added the signal will progressively shift towards the closed conformation due to modulation of the open/closed equilibrium. Due to the ATP binding mechanism (i.e open and closed states populated equally at saturation) the signal will only move 50% of the distance expected for a fully closed ATPlid. Second, ATP binding to mutant AK is considered. Residues that have chemical shifts that are sensitive to the local unfolding/folding reaction of α6 and α7 will have a chemical shift shifted towards the TS in the apo state. When ATP is added the signal will progressively move to the closed chemical shift (due to the unity slope in Figure 6). It is clear from the figure that no correlation is expected between substrate free mutant chemical shifts and the chemical shifts of WT AK in open and closed states.
3 Supplementary Figures Supplementary Figure S1. Circular dichroism spectra (molar ellipticity) of AK e variants. WT AK e (filled circles), M1 (open circles) and M2 (filled triangles). The data are from measurements at 25 C with protein concentrations ranging between 9 11 µm.
4 Supplementary Figure S2. Isothermal titration calirometry data for binding of Ap5A to WT AK e. The upper panel show the baseline corrected instrumental response. The lower panel show the integrated data (solid squares) and the best fit to a 1:1 binding model (solid line).
5 Supplementary Figure S3. 1 H- 15 N HSQC spectra of M2 saturated with Ap5A. The experiment was acquired at 25 C and with 4 mm Ap5A.
6 Supplementary Figure S4. Chemical shift perturbations between WT and M2 AK e in complex with Ap5A at 25 C. Perturbations for non mutated residues were quantified based on combined absolute 15 N and 1 H chemical shift differences between WT and M2 calculated according to δω=0.2* 15 N + 1 H (ppm). The mutated positions (116 and 168) are indicated as red bars.
7 Supplementary Figure S5. M2 populates a closed state in complex with Ap5A. (a) Correlation between chemical shift perturbations in Ap5A saturated states: M2 vs. WT AK e. Chemical shift perturbations were calculated with respect to the apo states and are normalized according to δω = N + 1 H (ppm). The best fitted straight line is shown in red and the slope is 0.98 ± 0.03 with an R value of In all, 76 residues were used in the analysis. (b) The analysis in (a) is performed for residues 13-24, 23-72, 80-84, 90-98, and , and these residues are colored in gold on the open AK e structure (4AKE.pdb).
8 Supplementary Figure S6. 1 H- 15 N HSQC spectra of M1 and M2 saturated with ATP. M1 is shown with blue contouring and M2 is contoured orange. The experiments were acquired at 25 C and with 20 mm ATP.
9 Supplementary Figure S7. Chemical shift perturbations of M1 and WT AK e in response to ATP binding. Perturbations are calculated according to: δω = N + 1 H. The ATP concentrations in the experiments were 20 mm. (a) M1 (b) WT AK e (data adapted from 46 ).
10 Supplementary Figure S8. WT and M1 binds to ATP with overlapping binding surfaces. Residues with absolute chemical shift perturbations in ATP saturated states (relative to apo states) larger than 0.4 ppm (see Supplementary Figure S7) are colored red on the open AK e structure (4AKE). (a) M1 (b) WT AK e.
11 Supplementary Figure S9. Characterization of conformational exchange using chemical shifts. (a) AK e can adopt two forms: open in the absence of substrate (left) and closed when bound to the inhibitor Ap5A 46 (right). An amide proton with different chemical shifts in the open and closed states is indicated as a gray and red sphere, respectively. (b) Hypothetical 1 H- 15 N HSQC spectra highlighting the different chemical shifts for the amide proton in the open and closed states. (c, d) In the ATP saturated state, where AK e is interconverting between open and closed states, the observed chemical shift (ω OBS ) of the amide protein (yellow sphere) will be a population weighted average. The fractions open (p O ) and closed (p C ) states can be quantified from chemical shifts as indicated in the inset.
12 Supplementary Figure S10. Analysis of open/closed conformational equilibria. A two state conformational exchange process between open and closed states of an enzyme is assumed. Random noise, generating similar χ 2 values as in Figure 6, was added to 20 ideal data points representing equal populations of open and closed states. The observed chemical shift perturbations (δω OS ) are plotted against the open to closed (δω OC ) chemical shifts (filled circles). The red line corresponds to a linear fit of the data with random noise included. Open circles corresponds to the ideal data set with equal populations of open and closed states. A linear fit to the ideal data will give a slope of 0.5. It is clear that accurate fits of open/closed populations can be achieved with NMR data of the quality reported in Figure 6.
13 Supplementary Figure S11. Comparison of mutant and WT chemical shifts in open and closed states. (a) The reaction mechanism for ATP binding shown with a simplified AK representation (the AMPlid is omitted for clarity). (b) Hypothetical 1 H- 15 N HSQC spectrum illustrating the chemical shifts of the three states portrayed in (a) (orange). The closed state is in complex with Ap5A. The chemical shifts of an arbitrary amide proton (from the equivalent residue in WT and mutant and responsive to closure of the ATP lid ) for WT and mutant AK are shown as blue and green circles, respectively. The chemical shift of open WT AK has been shifted minutely from the open to state for clarity.
14 Supplementary Table Table S1. Thermal unfolding parameters of AK e variants Protein T m ( C) H vh (kj mol -1 ) a) Wild-type 56.6 ± ± 19 M ± ± 16 M ± ± 10 a) Defined in the direction of unfolding
15 Supplementary Methods Equilibrium populations in conformational exchange from chemical shifts Equilibrium populations of proteins undergoing conformational exchange between two states can under favorable conditions be quantified with chemical shifts 46. The chemical shift is the most readily accessible NMR parameter, and can be measured with high accuracy. In the following discussion we describe how equilibrium populations of open and closed AK e can be determined in the presence of saturating amounts of the substrate ATP. Saturation of AK e with ATP results in a mixture of open and closed states in fast exchange (NMR time scale) with each other. In a two state conformational exchange process (here open and closed states) the observed chemical shift (ω OBS ) will be an average of the two interconverting states weighted by their populations if 47 ; (i) the chemical shifts of a specific probe (for instance an amide proton) differs between open and closed states, and (ii) the exchange is fast on the NMR timescale. In the fast exchange regime the rate of exchange (k ex ) is larger than the absolute difference in resonance frequency (δν) between the exchanging states, which can be formulated as k ex > δν, where k ex = k open + k close, and δν = ν C ν O (superscripts C and O refers to closed and open, respectively). In AK e the chemical shifts of the open (ω O ) and closed (ω C ) states can be measured on individual samples containing substrate-free or Ap5A saturated AK e, respectively (Supplementary Fig. S9 a, b). A hypothetical NMR spectrum explaining chemical shift averaging in the ATP saturated AK e is shown in Supplementary Figure S9c, d. The relative populations of the open (p O ) and closed states (p O ) can be calculated from measurements of three chemical shifts (ω C, ω O and ω OBS ) derived from three independent experiments, where ω OBS is measured for the ATP
16 saturated state (and ω C, ω O are measured as stated above) using the equations in Supplementary Figure 9d. In a protein all probes that are sensitive to the same conformational exchange process should provide converging populations of the states involved. We previously developed a robust and simple method to globally fit populations from chemical shift data of residues that are undergoing the same exchange process 46. For all residues, the chemical shift difference between the open state and a state (S) of interest (in our analysis ATP saturated states),δω OS, (Supplementary Fig. S9d) is plotted against the total chemical shift difference between open and closed states (δω OC in Supplementary Fig. S9d). The slope of the linear correlation between δω OS and δω OC provides a direct measurement of the population closed enzyme at the particular condition. The method is illustrated on a synthetic dataset in Supplementary Figure S10. Random noise was added to this dataset to show that the method is adequate for real data. With the open and closed chemical shifts available from assignments of apo and Ap5A bound AK e variants, the method can be used to accurately quantify open and closed populations of WT and mutated AK e in the presence of the natural substrate ATP. As required for this analysis, binding of ATP to WT and the M1 and M2 variants is fast on the NMR timescale as verified with nucleotide titration experiments. Ligand binding in coupled equilibrium reactions The definition of the dissociation constant for a one to one binding reaction is given by (S1). (S1)
17 Here, E corresponds to enzyme, S to substrate and ES to the enzyme-substrate complex. In an ITC experiment that probe ligand binding following Supplementary Equation S1 the observed dissociation constant ( ) equals K d. For AK e binding of the substrate ATP is more complex (Figure 1, main text). In addition to association the reaction involves a conformational change (i.e. closing of the ATP lid ). In this coupled equilibrium reaction, defined by (S2) depend not only on the on and off rates but also on the relative magnitudes of k close and k open. (S2) The expression in (S2) can be simplified into (S5) by insertion of (S3) and (S4) that are definitions of the equilibrium constants for association of ATP (K d ) and the subsequent conformational change (K conf ). (S3) (S4) (S5) From equation (S5) it is apparent that is modulated by K conf. Both the M1 and M2 variants bind ATP with values that are significantly lower (tighter binding) compared to WT AK e. A decrease in can depend on either an increased value of K conf or a decreased value of K d. As discussed in the main text section Mutations modulate the open-to-closed
18 equilibrium constant, K conf is significantly increased in the mutated variants and accounts fully for the observed reduction in. For completion, if the structural mutations in the M1 and M2 variants would stabilize a binding incompetent state as discussed in 48 must by necessity increase (weaker binding). With this model scale with the degree of ATP lid unfolding according to (S6) 48,49. (S6) k unfold /k fold. Here K u is the equilibrium constant for ATP lid unfolding and is defined as: K u =
19 Supplementary References 46. Ådén, J. & Wolf-Watz, M. NMR identification of transient complexes critical to adenylate kinase catalysis. J. Am. Chem. Soc. 129, (2007). 47. Cavanagh, J., Fairbrother, W.J., Palmer, A.G. & Skelton, N.J. Protein NMR spectroscopy principles and practice. (Academic Press, San Diego, 1996). 48. Schrank, T.P., Bolen, D.W. & Hilser, V.J. Rational modulation of conformational fluctuations in adenylate kinase reveals a local unfolding mechanism for allostery and functional adaptation in proteins. Proc. Natl. Acad. Sci. U S A 106, (2009). 49. Dincbas-Renqvist, V., Lendel, C., Dogan, J., Wahlberg, E. & Härd, T. Thermodynamics of folding, stabilization, and binding in an engineered protein-protein complex. J. Am. Chem. Soc. 126, (2004).
Structural basis for catalytically restrictive dynamics of a high-energy enzyme state
Supplementary Material Structural basis for catalytically restrictive dynamics of a high-energy enzyme state Michael Kovermann, Jörgen Ådén, Christin Grundström, A. Elisabeth Sauer-Eriksson, Uwe H. Sauer
More informationSUPPLEMENTARY INFORMATION
Figure S1. Secondary structure of CAP (in the camp 2 -bound state) 10. α-helices are shown as cylinders and β- strands as arrows. Labeling of secondary structure is indicated. CDB, DBD and the hinge are
More informationOverlap between folding and functional energy landscapes for adenylate kinase conformational change
Received 15 Jul 2010 Accepted 5 Oct 2010 Published 16 Nov 2010 DOI: 10.1038/ncomms1106 Overlap between folding and functional energy landscapes for adenylate kinase conformational change Ulrika Olsson
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/3/4/e1600663/dc1 Supplementary Materials for A dynamic hydrophobic core orchestrates allostery in protein kinases Jonggul Kim, Lalima G. Ahuja, Fa-An Chao, Youlin
More informationSupplementary Figures
1 Supplementary Figures Supplementary Figure 1 Type I FGFR1 inhibitors (a) Chemical structures of a pyrazolylaminopyrimidine inhibitor (henceforth referred to as PAPI; PDB-code of the FGFR1-PAPI complex:
More informationLineShapeKin NMR Line Shape Analysis Software for Studies of Protein-Ligand Interaction Kinetics
LineShapeKin NMR Line Shape Analysis Software for Studies of Protein-Ligand Interaction Kinetics http://lineshapekin.net Spectral intensity Evgenii L. Kovrigin Department of Biochemistry, Medical College
More informationSubstrate-dependent switching of the allosteric binding mechanism of a dimeric enzyme
Supplementary Information: Substrate-dependent switching of the allosteric binding mechanism of a dimeric enzyme Lee Freiburger, 1 Teresa Miletti, 1 Siqi Zhu, 1 Oliver Baettig, Albert Berghuis, Karine
More informationInterpreting and evaluating biological NMR in the literature. Worksheet 1
Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Definition and assessment of ciap1 constructs.
Supplementary Figure 1 Definition and assessment of ciap1 constructs. (a) ciap1 constructs used in this study are shown as primary structure schematics with domains colored as in the main text. Mutations
More informationSupplemental data for
Supplemental data for A Real-Time Guanine Nucleotide Exchange Assay using NMR: Activation of RhoA by PDZ- RhoGEF. Geneviève M.C. Gasmi-Seabrook 1,3, Christopher B. Marshall 1,3, Melissa Cheung 1,3, Bryan
More informationThe Fic protein Doc uses an inverted substrate to phosphorylate and. inactivate EF-Tu
The Fic protein Doc uses an inverted substrate to phosphorylate and inactivate EF-Tu Daniel Castro-Roa 1, Abel Garcia-Pino 2,3 *, Steven De Gieter 2,3, Nico A.J. van Nuland 2,3, Remy Loris 2,3, Nikolay
More informationProtein dynamics from NMR Relaxation data
Protein dynamics from NMR Relaxation data Clubb 3/15/17 (S f2 ) ( e ) Nitrogen-15 relaxation ZZ-exchange R 1 = 1/T 1 Longitudinal relaxation (decay back to z-axis) R 2 = 1/T 2 Spin-spin relaxation (dephasing
More informationEffects of Chemical Exchange on NMR Spectra
Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar
More informationSupporting Information
Supporting Information Boehr et al. 10.1073/pnas.0914163107 SI Text Materials and Methods. R 2 relaxation dispersion experiments. 15 NR 2 relaxation dispersion data measured at 1 H Larmor frequencies of
More informationEffects of Chemical Exchange on NMR Spectra
Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar
More informationTITAN: Two-dimensional lineshape analysis
TITAN: Two-dimensional lineshape analysis Chris Waudby Christodoulou Group c.waudby@ucl.ac.uk Andres Ramos Lisa Cabrita John Christodoulou Inhibition of fatty acid synthesis for treatment of tularemia
More informationSupporting Information
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2014 An Ensemble of Rapidly Interconverting Orientations in Electrostatic Protein Peptide Complexes Characterized by NMR
More informationSupplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a
Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a series of tmfret-pairs comprised of single cysteine mutants
More informationSupporting Information
Supporting Information Arai et al. 10.1073/pnas.15179911 SI Text Protein Expression and Purification. Myb3 (mouse, residues 84 315) was expressed in Escherichia coli as a fusion with the B1 domain of protein
More informationNMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease
University of Wollongong Research Online Faculty of Science - Papers (Archive) Faculty of Science, Medicine and Health 2009 NMR study of complexes between low molecular mass inhibitors and the West Nile
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.
More informationSensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
More informationK ex. Conformational equilibrium. equilibrium K B
Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any yprocess in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar
More informationSUPPLEMENTARY MATERIAL FOR
SUPPLEMENTARY MATERIAL FOR THE LIPID-BINDING DOMAIN OF WILD TYPE AND MUTANT ALPHA- SYNUCLEIN: COMPACTNESS AND INTERCONVERSION BETWEEN THE BROKEN- AND EXTENDED-HELIX FORMS. Elka R. Georgieva 1, Trudy F.
More informationMolecular Interactions F14NMI. Lecture 4: worked answers to practice questions
Molecular Interactions F14NMI Lecture 4: worked answers to practice questions http://comp.chem.nottingham.ac.uk/teaching/f14nmi jonathan.hirst@nottingham.ac.uk (1) (a) Describe the Monte Carlo algorithm
More informationSupplemental Data for: Direct Observation of Translocation in Individual DNA Polymerase Complexes
Supplemental Data for: Direct Observation of Translocation in Individual DNA Polymerase Complexes Joseph M. Dahl 1, Ai H. Mai 1, Gerald M. Cherf 1, Nahid N. Jetha 4, Daniel R. Garalde 3, Andre Marziali
More informationProtein-protein interactions (PPIs) via NMR. Paola Turano
Protein-protein interactions (PPIs) via NMR Paola Turano turano@cerm.unifi.it The magnetic field at the The chemical shift nucleus (the effective field) is generally less than the applied field by a fraction
More informationProtein-protein interactions (PPIs) via NMR. Paola Turano
Protein-protein interactions (PPIs) via NMR Paola Turano turano@cerm.unifi.it The magnetic field at the The chemical shift nucleus (the effective field) is generally less than the applied field by a fraction
More informationChemical Exchange and Ligand Binding
Chemical Exchange and Ligand Binding NMR time scale Fast exchange for binding constants Slow exchange for tight binding Single vs. multiple binding mode Calcium binding process of calcium binding proteins
More informationStructure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex
Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin
More informationSupplementary Figure 1. Biochemical and sequence alignment analyses the
Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).
More informationLecture 13: Data Analysis for the V versus [S] Experiment and Interpretation of the Michaelis-Menten Parameters
Biological Chemistry Laboratory Biology 3515/Chemistry 3515 Spring 2018 Lecture 13: Data Analysis for the V versus [S] Experiment and Interpretation of the Michaelis-Menten Parameters 20 February 2018
More informationSupplementary Information
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2017 Supplementary Information Probing the excited-state chemical shifts and exchange
More informationFOCUS: HYDROGEN EXCHANGE AND COVALENT MODIFICATION
FOCUS: HYDROGEN EXCHANGE AND COVALENT MODIFICATION Accuracy of SUPREX (Stability of Unpurified Proteins from Rates of H/D Exchange) and MALDI Mass Spectrometry-Derived Protein Unfolding Free Energies Determined
More informationSupplementary Information for
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2015 Supplementary Information for The use of Ion Mobility Mass Spectrometry to assist Protein Design:
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Resonance assignment and NMR spectra for hairpin and duplex A 6 constructs. (a) 2D HSQC spectra of hairpin construct (hp-a 6 -RNA) with labeled assignments. (b) 2D HSQC or SOFAST-HMQC
More informationSupplemental Information for. Quaternary dynamics of B crystallin as a direct consequence of localised tertiary fluctuations in the C terminus
Supplemental Information for Quaternary dynamics of B crystallin as a direct consequence of localised tertiary fluctuations in the C terminus Andrew J. Baldwin 1, Gillian R. Hilton 2, Hadi Lioe 2, Claire
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationInverse Detection in Multinuclear NMR
Inverse Detection in Multinuclear NMR The HETCOR experiment is an example of a directly-detected heteronuclear experiment. The timing diagram for the most basic form of the HETCOR pulse sequence is shown
More informationNMR in Medicine and Biology
NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR
More informationBiochemistry 3100 Sample Problems Binding proteins, Kinetics & Catalysis
(1) Draw an approximate denaturation curve for a typical blood protein (eg myoglobin) as a function of ph. (2) Myoglobin is a simple, single subunit binding protein that has an oxygen storage function
More informationMicrocalorimetric techniques
Microcalorimetric techniques Isothermal titration calorimetry (ITC) Differential scanning calorimetry (DSC) Filip Šupljika Filip.Supljika@irb.hr Laboratory for the study of interactions of biomacromolecules
More informationMicrocalorimetry for the Life Sciences
Microcalorimetry for the Life Sciences Why Microcalorimetry? Microcalorimetry is universal detector Heat is generated or absorbed in every chemical process In-solution No molecular weight limitations Label-free
More informationFree Energy. because H is negative doesn't mean that G will be negative and just because S is positive doesn't mean that G will be negative.
Biochemistry 462a Bioenergetics Reading - Lehninger Principles, Chapter 14, pp. 485-512 Practice problems - Chapter 14: 2-8, 10, 12, 13; Physical Chemistry extra problems, free energy problems Free Energy
More informationA prevalent intraresidue hydrogen bond stabilizes proteins
Supplementary Information A prevalent intraresidue hydrogen bond stabilizes proteins Robert W. Newberry 1 & Ronald T. Raines 1,2 * 1 Department of Chemistry and 2 Department of Biochemistry, University
More informationCHEM4. General Certificate of Education Advanced Level Examination June Unit 4 Kinetics, Equilibria and Organic Chemistry
Centre Number Surname Candidate Number For Examiner s Use Other Names Candidate Signature Examiner s Initials General Certificate of Education Advanced Level Examination June 2011 Question 1 2 Mark Chemistry
More informationYou are advised to spend an equal amount of time on each question.
UNIVERSITY OF EAST ANGLIA School of Chemistry Main Series UG Examination 2015-16 BIOPHYSICAL CHEMISTRY CHE-5601Y Time allowed: 2 hours Answer THREE questions. You are advised to spend an equal amount of
More informationIsothermal Titration Calorimetry in Drug Discovery. Geoff Holdgate Structure & Biophysics, Discovery Sciences, AstraZeneca October 2017
Isothermal Titration Calorimetry in Drug Discovery Geoff Holdgate Structure & Biophysics, Discovery Sciences, AstraZeneca October 217 Introduction Introduction to ITC Strengths / weaknesses & what is required
More informationSlow symmetric exchange
Slow symmetric exchange ϕ A k k B t A B There are three things you should notice compared with the Figure on the previous slide: 1) The lines are broader, 2) the intensities are reduced and 3) the peaks
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supporting Information Kinetic Resolution of Constitutional Isomers Controlled by Selective Protection inside a Supramolecular Nanocapsule Simin Liu, Haiying Gan, Andrew T. Hermann,
More informationComputational Modeling of Protein Kinase A and Comparison with Nuclear Magnetic Resonance Data
Computational Modeling of Protein Kinase A and Comparison with Nuclear Magnetic Resonance Data ABSTRACT Keyword Lei Shi 1 Advisor: Gianluigi Veglia 1,2 Department of Chemistry 1, & Biochemistry, Molecular
More informationSupplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).
Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted
More informationChapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR
The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR 103 Abstract The interaction of the Src SH2 domain with the catalytic domain of FAK, including the Y397 SH2 domain
More informationFast reconstruction of four-dimensional NMR spectra from plane projections
Journal of Biomolecular NMR 28: 391 395, 2004. KLUWER/ESCOM 2004 Kluwer Academic Publishers. Printed in the Netherlands. 391 Fast reconstruction of four-dimensional NMR spectra from plane projections Eriks
More information17. Biomolecular Interaction
17. Biomolecular Interaction Methods for characterizing biomolecular interactions Sequence-specific DNA binding ligands Molecular mechanisms of drug action and drug resistance In silico compound design
More informationSUPPLEMENTARY INFORMATION
Parallel Allostery by camp and PDE Coordinates Activation and Termination Phases in camp Signaling Srinath Krishnamurthy, 1 Nikhil Kumar Tulsian, 1 Arun Chandramohan, 1 and Ganesh S. Anand 1, * 1 Department
More informationSolid state and advanced NMR
Solid state and advanced NMR Dr. Magnus Wolf-Watz Department of Chemistry Umeå University magnus.wolf-watz@chem.umu.se NMR is useful for many things!!! Chemistry Structure of small molecules, chemical
More informationStructural characterization of NiV N 0 P in solution and in crystal.
Supplementary Figure 1 Structural characterization of NiV N 0 P in solution and in crystal. (a) SAXS analysis of the N 32-383 0 -P 50 complex. The Guinier plot for complex concentrations of 0.55, 1.1,
More informationNational de la Recherche Scientifique and Université Paris Descartes, Paris, France.
FAST-RESPONSE CALMODULIN-BASED FLUORESCENT INDICATORS REVEAL RAPID INTRACELLULAR CALCIUM DYNAMICS Nordine Helassa a, Xiao-hua Zhang b, Ianina Conte a,c, John Scaringi b, Elric Esposito d, Jonathan Bradley
More informationSupplementary Information
Supplementary Information Adenosyltransferase Tailors and Delivers Coenzyme B 12 Dominique Padovani 1,2, Tetyana Labunska 2, Bruce A. Palfey 1, David P. Ballou 1 and Ruma Banerjee 1,2 * 1 Biological Chemistry
More informationSupporting Information
Supporting Information Li et al. 10.1073/pnas.1314303110 SI Text Preparation of NMR Samples. Mutagenesis, protein expression, and purification were performed as previously described (1), except that the
More informationPrevious Class. Reasons for analyzing pre-steady state conditions Methods for pre-steady state measurements. Today
Previous Class Reasons for analyzing pre-steady state conditions Methods for pre-steady state measurements Today Spectrophotometry Spectrofluorimetry Radioactive Procedures ph dependency Spectrophotometry
More informationLongitudinal-relaxation enhanced fast-pulsing techniques: New tools for biomolecular NMR spectroscopy
Longitudinal-relaxation enhanced fast-pulsing techniques: New tools for biomolecular NMR spectroscopy Bernhard Brutscher Laboratoire de Résonance Magnétique Nucléaire Institut de Biologie Structurale -
More informationSupporting Information
Supporting Information Allosteric-activation of GDP-bound Ras isoforms by bisphenol derivative plasticisers Miriam Schöpel 1, Oleksandr Shkura 1, Jana Seidel 1, Klaus Kock 1, Xueyin Zhong 1, Stefanie Löffek
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
More informationSupplementary Information for. Direct nitration and azidation of aliphatic carbons by an iron-dependent halogenase
Supplementary Information for Direct nitration and azidation of aliphatic carbons by an iron-dependent halogenase Megan L Matthews, Wei-chen Chang, Andrew P Layne, Linde A Miles, Carsten Krebs, J Martin
More informationSupplementary material
Supplementary material Phosphorylation of the mitochondrial autophagy receptor Nix enhances its interaction with LC3 proteins Vladimir V. Rogov 1,*, Hironori Suzuki 2,3,*, Mija Marinković 4, Verena Lang
More informationNB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5
SUPPLEMENTARY TABLES Suppl. Table 1. Protonation states at ph 7.4 and 4.5. Protonation states of titratable residues in GCase at ph 7.4 and 4.5. Histidine: HID, H at δ-nitrogen; HIE, H at ε-nitrogen; HIP,
More informationLecture #6 Chemical Exchange
Lecture #6 Chemical Exchange Topics Introduction Effects on longitudinal magnetization Effects on transverse magnetization Examples Handouts and Reading assignments Kowalewski, Chapter 13 Levitt, sections
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1737 Supplementary Table 1 variant Description FSEC - 2B12 a FSEC - 6A1 a K d (leucine) c Leucine uptake e K (wild-type like) K (Y18F) K (TS) K (TSY) K288A mutant, lipid facing side chain
More information- Basic understandings: - Mapping interactions:
NMR-lecture April 6th, 2009, FMP Berlin Outline: Christian Freund - Basic understandings: Relaxation Chemical exchange - Mapping interactions: -Chemical shift mapping (fast exchange) Linewidth analysis
More informationSupplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer
More informationMolecular Mechanism for Conformational Dynamics of Ras GTP Elucidated from In-Situ Structural Transition in Crystal
Molecular Mechanism for Conformational Dynamics of Ras GTP Elucidated from In-Situ Structural Transition in Crystal Shigeyuki Matsumoto, Nao Miyano, Seiki Baba, Jingling Liao, Takashi Kawamura, Chiemi
More informationSupporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS
Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS CNS input file generatemetal.inp: remarks file generate/generatemetal.inp
More informationSUPPLEMENTARY INFORMATION
5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.
More informationA Single Outer Sphere Mutation Stabilizes apo- Mn Superoxide Dismutase by 35 C and. Disfavors Mn Binding.
Supporting information for A Single Outer Sphere Mutation Stabilizes apo- Mn Superoxide Dismutase by 35 C and Disfavors Mn Binding. Anne-Frances Miller* and Ting Wang Department of Chemistry, University
More informationSupporting Information
Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,
More informationValues are straight multiplications of WT affinities, so that 25 x WT is weaker binding and ½ WT is tighter binding. IPTG ph 7.4. IPTG ph 9.
1 of 6 10/9/2012 1:05 PM nown functional effects of mutating hypothesized charged residues. Values are straight multiplications of WT affinities, so that 25 x WT is weaker binding and ½ WT is tighter binding.
More informationMapping Protein Folding Landscapes by NMR Relaxation
1 Mapping Protein Folding Landscapes by NMR Relaxation P.E. Wright, D.J. Felitsky, K. Sugase, and H.J. Dyson Abstract. The process of protein folding provides an excellent example of the interactions of
More informationT H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp
S u p p l e m e n ta l m at e r i a l jgp Lee et al., http://www.jgp.org/cgi/content/full/jgp.201411219/dc1 T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y S u p p l e m e n ta l D I S C U S
More informationSUPPLEMENTARY FIGURES. Figure S1
SUPPLEMENTARY FIGURES Figure S1 The substrate for DH domain (2R,3R,4R,6R,7S,8S,9R)-3,7,9-trihydroxy-5-oxo-2,4,6,8 tetramethylundecanoate) was docked as two separate fragments shown in magenta and blue
More informationSupplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases
Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3
More informationSupporting Information
Supporting Information To Engineered Holliday Junctions as Single-Molecule Reporters for Protein-DNA Interactions with Application to a MerR-family Regulator Susanta K. Sarkar, a Nesha May Andoy, a Jaime
More informationLecture 34 Protein Unfolding Thermodynamics
Physical Principles in Biology Biology 3550 Fall 2018 Lecture 34 Protein Unfolding Thermodynamics Wednesday, 21 November c David P. Goldenberg University of Utah goldenberg@biology.utah.edu Clicker Question
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10458 Active Site Remodeling in the Bifunctional Fructose-1,6- bisphosphate aldolase/phosphatase Juan Du, Rafael F. Say, Wei Lü, Georg Fuchs & Oliver Einsle SUPPLEMENTARY FIGURES Figure
More informationENZYME KINETICS. Medical Biochemistry, Lecture 24
ENZYME KINETICS Medical Biochemistry, Lecture 24 Lecture 24, Outline Michaelis-Menten kinetics Interpretations and uses of the Michaelis- Menten equation Enzyme inhibitors: types and kinetics Enzyme Kinetics
More informationSUPPLEMENTARY ONLINE DATA
SUPPLEMENTARY ONLINE DATA Secreted Isoform of Human Lynx1 (SLURP-2): Spatial Structure and Pharmacology of Interaction with Different Types of Acetylcholine Receptors E.N. Lyukmanova 1,2,*, M.A. Shulepko
More informationMolecular dynamics simulations of anti-aggregation effect of ibuprofen. Wenling E. Chang, Takako Takeda, E. Prabhu Raman, and Dmitri Klimov
Biophysical Journal, Volume 98 Supporting Material Molecular dynamics simulations of anti-aggregation effect of ibuprofen Wenling E. Chang, Takako Takeda, E. Prabhu Raman, and Dmitri Klimov Supplemental
More informationTracking Protein Allostery in Evolution
Tracking Protein Allostery in Evolution Glycogen phosphorylase frees sugars to provide energy GP orthologs diverged 600,000,000 years can respond to transcription controls, metabolite concentrations and
More informationSupplementary Figures:
Supplementary Figures: Supplementary Figure 1: The two strings converge to two qualitatively different pathways. A) Models of active (red) and inactive (blue) states used as end points for the string calculations
More informationISoTherMal TITraTIon Calorimetry
ISoTherMal TITraTIon Calorimetry With the Nano ITC, heat effects as small as 1 nanojoules are detectable using one nanomole or less of biopolymer. The Nano ITC uses a solid-state thermoelectric heating
More informationNMR Characterization of Partially Folded and Unfolded Conformational Ensembles of Proteins
Elisar Barbar Department of Chemistry and Biochemistry, Ohio University, Athens, OH 45701 NMR Characterization of Partially Folded and Unfolded Conformational Ensembles of Proteins Abstract: Studies of
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature09450 Supplementary Table 1 Summary of kinetic parameters. Kinetic parameters were V = V / 1 K / ATP and obtained using the relationships max ( + m [ ]) V d s /( 1/ k [ ATP] + 1 k ) =,
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/10/eaat8797/dc1 Supplementary Materials for Single-molecule observation of nucleotide induced conformational changes in basal SecA-ATP hydrolysis Nagaraju Chada,
More informationSCORING. The exam consists of 5 questions totaling 100 points as broken down in this table:
UNIVERSITY OF CALIFORNIA, BERKELEY CHEM C130/MCB C100A MIDTERM EXAMINATION #2 OCTOBER 20, 2016 INSTRUCTORS: John Kuriyan and David Savage THE TIME LIMIT FOR THIS EXAMINATION: 1 HOUR 50 MINUTES SIGNATURE:
More informationSupporting Information for: A Substrate Radical Intermediate in Catalysis by the. Antibiotic Resistance Protein Cfr
Supporting Information for: A Substrate Radical Intermediate in Catalysis by the Antibiotic Resistance Protein Cfr Tyler L. Grove 1, Jovan Livada 1, Erica L. Schwalm 1, Michael T. Green 1, Squire J. Booker
More informationNature Structural & Molecular Biology: doi: /nsmb.3194
Supplementary Figure 1 Mass spectrometry and solution NMR data for -syn samples used in this study. (a) Matrix-assisted laser-desorption and ionization time-of-flight (MALDI-TOF) mass spectrum of uniformly-
More informationSUPPLEMENTARY INFORMATION. Structural basis of laminin binding to the LARGE glycans on dystroglycan
SUPPLEMENTARY INFORMATION Structural asis of laminin inding to the LARGE glycans on dystroglycan David C. Briggs 1, Takako Yoshida-Moriguchi 2, Tianqing Zheng 2, David Venzke 2, Mary Anderson 2, Andrea
More informationSupplementary Materials: Probing the Ion Binding Site in a DNA Holliday Junction Using Förster Resonance Energy Transfer (FRET)
S1 of S5 Supplementary Materials: Probing the Ion Binding Site in a DNA Holliday Junction Using Förster Resonance Energy Transfer (FRET) Jacob L. Litke, Yan Li, Laura M. Nocka and Ishita Mukerji (a) (b)
More information