Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).
|
|
|
- Kenneth Harper
- 6 years ago
- Views:
Transcription
1 Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted 2Fo-Fc maps (gray meshes contoured at 1.5 ) are shown.
2 Supplementary Figure 2 Structure-guided sequence alignments of light-driven ion-pumping microbial rhodopsins. Secondary structure elements are based on the ClR structure and represented by red-rectangles for -helices and green arrows for -strands. Identical and similar residues are highlighted in black and gray, respectively. The conserved amino acid residues forming the 3 omega motif (blue-open rectangles), the NTQ motif (or corresponding residues in other rhodopsins) (red-open rectangles), and Schiff base linkage (yellow-open rectangle) are indicated. Chloridepumping rhodopsins from Nonlabens marinus (ClR) and Fulvimarina pelagi (FR), sodiumpumping rhodopsins from Nonlabens dokdonensis (NdNaR) and Dokdonia eikasta (Krokinobacter eikastus) (KR2), xanthorhodopsin (XR), bacteriorhodopsin (BR), halorhodopsins from Halobacterium salinarum (HsHR) and Natronomonas pharaonis (NpHR), and proteorhodopsin (PR).
3 Supplementary Figure 3 3 omega motif and orientation of B-C loop. (a) Comparison of B-C loop conformation between ClR and HR. Crystal structures of ClR and HR (PDB ID: 1E12) 1 are superimposed and the B-C loops of ClR and HR are depicted in blue and pink, respectively. (b) 3 omega motives and B-C loops of ClR (blue), NaR (KR2) (salmon, PDB ID: 3X3B) 2,andXR (green, PDB ID: 3DDL) 3.(c) Phylogenetic relationship among microbial rhodopsins. Microbial rhodopsins containing the conserved 3 omega motif are enclosed by a blue-rectangle. (d) Fluorescence thermal stability profiles of wild-type (WT) and mutant ClRs (mutations in 3 omega motif). Tm values are WT, 74 C; F15A, 74 C; W72A, 71 C; and Y83A, 72 C. F90A and Y76A are negative control and two mutants are no difference compared to the wild type. The curves are representative of three experiments and the error bars represent the mean s.d. a.u., arbitrary units.
4 Supplementary Figure 4 Comparison of active center structures between ClR (a) and HR (b). Chloride ion and water molecules are shown by green and red spheres, respectively. Hydrogenbonds are shown in dashed lines and ATR is shown in yellow stick model. (c) K235-all transretinal (yellow stick model) shown in 2Fo-Fc map (contoured at 1.5 ). (d) Superimposition of lysine-atr of ClR (sky blue), NaR (3X3B, magenta), XR (3DDL, grey), ChR (3UG9, green), HsHR (1E12, salmon), NpHR (3A7K, purple), BR (1QKO, lemon) and PR (4JQ6, marine blue).
5 Supplementary Figure 5 Absorption spectra and structures at PSB. (a) Absorption spectra of wildtype (WT) and mutants of ClR (T102N and T102D) in a solvent without (blue) and with NaCl (red). (b) Comparison of structures at PSB among wild-type ClR and mutants.
6 Supplementary Figure 6 Internal cavities (ICs) of ClR structure. (a) Comparison of IC1 of ClR (blue) and NaR (KR2) (pink, PDB ID: 3X3B) 2. (b) A putative chloride ion entry hole connected to IC1 of ClR and the hydrophobic membrane core boundaries calculated with the PPM server4. (c) and (d), IC2 and IC3 of ClR, respectively. (e) Internal cavities (ICs) of NpHR (3A7K). IC figures are in the same orientation as those of ClR. Red spheres and dashed lines represent water molecules and hydrogen-bonds.
7 Supplementary Figure 7 Models of ion translocation by ClR and NaR. The sequence of lightabsorption, isomerization of retinal, and ion transfer steps are indicated by numbers in red. The sodium transfer model by NaR was proposed in the previous studies 2,5. Key amino acid residues and retinal are shown in sticks model. Four internal cavities (IC1-IC4) inside the ClR and NaR structures are highlighted in transparent blue. Chloride ion and sodium ion are shown by green and orange spheres, respectively.
8 Supplementary References 1. Kolbe, M., Besir, H., Essen, L.O. & Oesterhelt, D. Structure of the light-driven chloride pump halorhodopsin at 1.8 Å resolution. Science 288, (2000). 2. Kato, H.K. et al. Structural basis for Na + transport mechanism by a light-driven Na + pump. Nature. 521, (2015). 3. Luecke, H. et al. Crystallographic structure of xanthorhodopsin, the light-driven proton pump with a dual chromophore. Proc. Natl. Acad. Sci. USA. 105, (2008). 4. Lomize, M.A., Pogozheva, I.D., Joo, H., Mosberg, H.I. & Lomize, A.L. OPM database and PPM web server: resources for positioning of proteins in membranes. Nucleic. Acids. Res. 40, D370 D376 (2012). 5. Gushchin, I. et al. Crystal structure of a light-driven sodium pump. Nat. Struct. Mol. Biol. 22, (2015).
Comparison between Bacteriorhodopsin and Halorhodopsin. Halorhodopsin (HR) and Bacteriorhodopsin (BR) belong to a subfamily of
Comparison between Bacteriorhodopsin and Halorhodopsin Halorhodopsin (HR) and Bacteriorhodopsin (BR) belong to a subfamily of heptahelical membrane proteins, the archaeal rhodopsins. They are found in
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting
SUPPLEMENTARY INFORMATION
Supplementary Table 1: Amplitudes of three current levels. Level 0 (pa) Level 1 (pa) Level 2 (pa) TrkA- TrkH WT 200 K 0.01 ± 0.01 9.5 ± 0.01 18.7 ± 0.03 200 Na * 0.001 ± 0.01 3.9 ± 0.01 12.5 ± 0.03 200
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group
SUPPLEMENTARY INFORMATION
Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,
Ion Translocation Across Biological Membranes. Janos K. Lanyi University of California, Irvine
Ion Translocation Across Biological Membranes Janos K. Lanyi University of California, Irvine Examples of transmembrane ion pumps Protein Cofactor, substrate, etc. MW Subunits Mitoch. cytochrome oxidase
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the
SUPPLEMENTARY INFORMATION
Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3
Microbial and Animal Rhodopsins: Structures, Functions and Molecular Mechanisms
Microbial and Animal Rhodopsins: Structures, Functions and Molecular Mechanisms Oliver P. Ernst 1, David T. Lodowski 2, Marcus Elstner 3, Peter Hegemann 4, Leonid S. Brown 5, and Hideki Kandori 6 1 Departments
Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein
Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08
Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases
Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3
SUPPLEMENTARY INFORMATION. doi: /nature07461
Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of
Structure of the SPRY domain of human DDX1 helicase, a putative interaction platform within a DEAD-box protein
Supporting information Volume 71 (2015) Supporting information for article: Structure of the SPRY domain of human DDX1 helicase, a putative interaction platform within a DEAD-box protein Julian Kellner
Proteorhodopsin phototrophy in the ocean
Nature 411, 786-789 (14 June 2001) doi:10.1038/35081051; Received 3 January 2001; Accepted 26 March 2001 Proteorhodopsin phototrophy in the ocean Oded Béjà, Elena N. Spudich, John L. Spudich, Marion Leclerc
Supporting Information
Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11744 Supplementary Table 1. Crystallographic data collection and refinement statistics. Wild-type Se-Met-BcsA-B SmCl 3 -soaked EMTS-soaked Data collection Space
Hydration switch model for the proton transfer in the Schiff base region of bacteriorhodopsin
Biochimica et Biophysica Acta 1658 (2004) 72 79 Review Hydration switch model for the proton transfer in the Schiff base region of bacteriorhodopsin Hideki Kandori* Department of Materials Science and
SUPPLEMENTARY INFORMATION
Supplementary Table S1 Kinetic Analyses of the AMSH-LP mutants AMSH-LP K M (μm) k cat x 10-3 (s -1 ) WT 71.8 ± 6.3 860 ± 65.4 T353A 76.8 ± 11.7 46.3 ± 3.7 F355A 58.9 ± 10.4 5.33 ± 0.30 proximal S358A 75.1
SUPPLEMENTARY INFORMATION
Supplementary Table 1: Data collection, phasing and refinement statistics ChbC/Ta 6 Br 12 Native ChbC Data collection Space group P4 3 2 1 2 P4 3 2 1 2 Cell dimensions a, c (Å) 132.75, 453.57 132.81, 452.95
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.
Biophysics 490M Project
Biophysics 490M Project Dan Han Department of Biochemistry Structure Exploration of aa 3 -type Cytochrome c Oxidase from Rhodobacter sphaeroides I. Introduction: All organisms need energy to live. They
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Chemical structure of LPS and LPS biogenesis in Gram-negative bacteria. a. Chemical structure of LPS. LPS molecule consists of Lipid A, core oligosaccharide and O-antigen. The polar
NB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5
SUPPLEMENTARY TABLES Suppl. Table 1. Protonation states at ph 7.4 and 4.5. Protonation states of titratable residues in GCase at ph 7.4 and 4.5. Histidine: HID, H at δ-nitrogen; HIE, H at ε-nitrogen; HIP,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
Chapter 10. Thermodynamics of Transport. Thermodynamics of Transport, con t. BCH 4053 Summer 2001 Chapter 10 Lecture Notes. Slide 1.
BCH 4053 Summer 2001 Chapter 10 Lecture Notes 1 Chapter 10 Membrane Transport 2 3 Thermodynamics of Transport Free Energy change is given by difference in electrochemical potential and the quantity transported
Structure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex
Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin
SUPPLEMENTARY INFORMATION
doi:1.138/nature1737 Supplementary Table 1 variant Description FSEC - 2B12 a FSEC - 6A1 a K d (leucine) c Leucine uptake e K (wild-type like) K (Y18F) K (TS) K (TSY) K288A mutant, lipid facing side chain
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10955 Supplementary Figures Supplementary Figure 1. Electron-density maps and crystallographic dimer structures of the motor domain. (a f) Stereo views of the final electron-density maps
Supporting Information
Supporting Information Wilson et al. 10.1073/pnas.0804276105 Fig. S1. Sites of oxazolidinone resistance mutations in bacteria and archaea. (a) Secondary structure of the peptidyltransferase ring of the
Cks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved
Cks1 d CKS1 Supplementary Figure 1 The -Cks1 crystal lattice. (a) Schematic of the - Cks1 crystal lattice. -Cks1 crystallizes in a lattice that contains c 4 copies of the t - Cks1 dimer in the crystallographic
Supporting Information. Spectral Tuning in Halorhodopsin: The Chloride Pump Photoreceptor
Supporting Information Spectral Tuning in Halorhodopsin: The Chloride Pump Photoreceptor Rhitankar Pal, Sivakumar Sekharan * and Victor S. Batista * Department of Chemistry, Yale University, P.O. Box 208107,
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2
Supplemental Information. Molecular Basis of Spectral Diversity. in Near-Infrared Phytochrome-Based. Fluorescent Proteins
Chemistry & Biology, Volume 22 Supplemental Information Molecular Basis of Spectral Diversity in Near-Infrared Phytochrome-Based Fluorescent Proteins Daria M. Shcherbakova, Mikhail Baloban, Sergei Pletnev,
Structural characterization of NiV N 0 P in solution and in crystal.
Supplementary Figure 1 Structural characterization of NiV N 0 P in solution and in crystal. (a) SAXS analysis of the N 32-383 0 -P 50 complex. The Guinier plot for complex concentrations of 0.55, 1.1,
Experimental and Computational Mutagenesis to Investigate the. Positioning of a General Base within an Enzyme Active Site
Experimental and Computational Mutagenesis to Investigate the Positioning of a General Base within an Enzyme Active Site Jason P. Schwans, Philip Hanoian, Benjamin J. Lengerich, Fanny Sunden, Ana Gonzalez
Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27
Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase
SUPPLEMENTARY INFORMATION
Dph2 SeMet (iron-free) # Dph2 (iron-free) Dph2-[4Fe-4S] Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 58.26, 82.08, 160.42 58.74, 81.87, 160.01 55.70, 80.53,
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina
Structure of the light-driven sodium pump KR2 and its implications for optogenetics
STRUCTURAL SNAPSHOT Structure of the light-driven sodium pump KR2 and its implications for optogenetics Ivan Gushchin 1,2, Vitaly Shevchenko 1,2, Vitaly Polovinkin 1,2,3,4,5, Valentin Borshchevskiy 1,2,
sensors ISSN
Sensors 2009, 9, 9741-9804; doi:10.3390/s91209741 OPEN ACCESS sensors ISSN 1424-8220 www.mdpi.com/journal/sensors Review Photoreactions and Structural Changes of Anabaena Sensory Rhodopsin Akira Kawanabe
Nature Structural and Molecular Biology: doi: /nsmb.2938
Supplementary Figure 1 Characterization of designed leucine-rich-repeat proteins. (a) Water-mediate hydrogen-bond network is frequently visible in the convex region of LRR crystal structures. Examples
Characterization of the Azide-Dependent Bacteriorhodopsin-Like Photocycle of Salinarum Halorhodopsin
Biophysical Journal Volume 82 April 2002 1687 1695 1687 Characterization of the Azide-Dependent Bacteriorhodopsin-Like Photocycle of Salinarum Halorhodopsin Melinda Lakatos,* Géza I. Groma,* Constanta
Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached
Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached to HpUreI. Urea hydrolysis products 2NH 3 and 1CO 2
Supplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine
Supplementary figure 1. Comparison of unbound and as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine GM-CSF (slate) with bound GM-CSF in the GIF:GM-CSF complex (GIF: green,
6 Discussion. 6.1 Bacterial reaction center X-Ray crystallography of RC mutants
6.1 Bacterial reaction center Proton and electron transfer in bacterial reaction centers were investigated using time-resolved FTIR spectroscopy and X-ray crystallography. The effect of sitespecific mutations
SUPPLEMENTARY INFORMATION
Fig. 1 Influences of crystal lattice contacts on Pol η structures. a. The dominant lattice contact between two hpol η molecules (silver and gold) in the type 1 crystals. b. A close-up view of the hydrophobic
.crystal structure; KR2; light-driven ion pump;
Prospects & Overviews The light-driven sodium ion pump: A new player in rhodopsin research Hideaki E. Kato 1), Keiichi Inoue 2)3)4), Hideki Kandori 2)3) and Osamu Nureki 5) Rhodopsins are one of the most
Impact of the crystallization condition on importin-β conformation
Supporting information Volume 72 (2016) Supporting information for article: Impact of the crystallization condition on importin-β conformation Marcel J. Tauchert, Clément Hémonnot, Piotr Neumann, Sarah
Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a
Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a series of tmfret-pairs comprised of single cysteine mutants
Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,
Basics of protein structure
Today: 1. Projects a. Requirements: i. Critical review of one paper ii. At least one computational result b. Noon, Dec. 3 rd written report and oral presentation are due; submit via email to bphys101@fas.harvard.edu
Purification, SDS-PAGE and cryo-em characterization of the MCM hexamer and Cdt1 MCM heptamer samples.
Supplementary Figure 1 Purification, SDS-PAGE and cryo-em characterization of the MCM hexamer and Cdt1 MCM heptamer samples. (a-b) SDS-PAGE analysis of the hexamer and heptamer samples. The eluted hexamer
Supporting Information
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2016 Supporting Information Lipid molecules can induce an opening of membrane-facing
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits AhpC and AhpF from Escherichia coli Phat Vinh Dip 1,#, Neelagandan Kamariah 2,#, Malathy Sony Subramanian Manimekalai
Supplementary information
Supplementary information The structural basis of modularity in ECF-type ABC transporters Guus B. Erkens 1,2, Ronnie P-A. Berntsson 1,2, Faizah Fulyani 1,2, Maria Majsnerowska 1,2, Andreja Vujičić-Žagar
Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
Supplementary Figure 1 Schematic overview of ASTNs in neuronal migration. (a) Schematic of roles played by ASTNs 1 and 2. ASTN-1-mediated adhesions
Supplementary Figure 1 Schematic overview of ASTNs in neuronal migration. (a) Schematic of roles played by ASTNs 1 and 2. ASTN-1-mediated adhesions undergo endocytosis into clathrin-coated vesicles dependent
SUPPLEMENTARY INFORMATION
Figure S1. Secondary structure of CAP (in the camp 2 -bound state) 10. α-helices are shown as cylinders and β- strands as arrows. Labeling of secondary structure is indicated. CDB, DBD and the hinge are
RNA Polymerase I Contains a TFIIF-Related DNA-Binding Subcomplex
Molecular Cell, Volume 39 Supplemental Information RNA Polymerase I Contains a TFIIFRelated DNABinding Subcomplex Sebastian R. Geiger, Kristina Lorenzen, Amelie Schreieck, Patrizia Hanecker, Dirk Kostrewa,
Supplementary Information. Overlap between folding and functional energy landscapes for. adenylate kinase conformational change
Supplementary Information Overlap between folding and functional energy landscapes for adenylate kinase conformational change by Ulrika Olsson & Magnus Wolf-Watz Contents: 1. Supplementary Note 2. Supplementary
Molecular details of the unique mechanism of chloride transport by a cyanobacterial rhodopsin
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2017 Molecular details of the unique mechanism of chloride transport by a cyanobacterial
Supplementary Figure 1. Biochemical and sequence alignment analyses the
Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).
of the Guanine Nucleotide Exchange Factor FARP2
Structure, Volume 21 Supplemental Information Structural Basis for Autoinhibition of the Guanine Nucleotide Exchange Factor FARP2 Xiaojing He, Yi-Chun Kuo, Tyler J. Rosche, and Xuewu Zhang Inventory of
SUPPLEMENTARY INFORMATION
doi:10.1038/nature17991 Supplementary Discussion Structural comparison with E. coli EmrE The DMT superfamily includes a wide variety of transporters with 4-10 TM segments 1. Since the subfamilies of the
Identification of core amino acids stabilizing rhodopsin
Identification of core amino acids stabilizing rhodopsin A. J. Rader, Gulsum Anderson, Basak Isin, H. Gobind Khorana, Ivet Bahar, and Judith Klein- Seetharaman Anes Aref BBSI 2004 Outline Introduction
SI Text S1 Solution Scattering Data Collection and Analysis. SI references
SI Text S1 Solution Scattering Data Collection and Analysis. The X-ray photon energy was set to 8 kev. The PILATUS hybrid pixel array detector (RIGAKU) was positioned at a distance of 606 mm from the sample.
T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp
S u p p l e m e n ta l m at e r i a l jgp Lee et al., http://www.jgp.org/cgi/content/full/jgp.201411219/dc1 T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y S u p p l e m e n ta l D I S C U S
Time-dependence of key H-bond/electrostatic interaction distances in the sirna5-hago2 complexes... Page S14
Supporting Information Probing the Binding Interactions between Chemically Modified sirnas and Human Argonaute 2 Using Microsecond Molecular Dynamics Simulations S. Harikrishna* and P. I. Pradeepkumar*
Acta Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural characterization of the virulence factor Nuclease A from Streptococcus agalactiae
Supplementary Figure 1. Voltage clamp speed. Capacity membrane current in response to a 4- mv voltage step (black). Solid red line corresponds to a
Supplementary Figure 1. Voltage clamp speed. Capacity membrane current in response to a 4- mv voltage step (black). Solid red line corresponds to a mono-exponential fit with a time constant of 5.5 µs.
Salt bridge in the conserved His Asp cluster in Gloeobacter rhodopsin contributes to trimer formation
FEBS Letters 587 (2013) 322 327 journal homepage: www.febsletters.org Salt bridge in the conserved His Asp cluster in Gloeobacter rhodopsin contributes to trimer formation Takashi Tsukamoto a, Takashi
Design of a Novel Globular Protein Fold with Atomic-Level Accuracy
Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Brian Kuhlman, Gautam Dantas, Gregory C. Ireton, Gabriele Varani, Barry L. Stoddard, David Baker Presented by Kate Stafford 4 May 05 Protein
Identifying Interaction Hot Spots with SuperStar
Identifying Interaction Hot Spots with SuperStar Version 1.0 November 2017 Table of Contents Identifying Interaction Hot Spots with SuperStar... 2 Case Study... 3 Introduction... 3 Generate SuperStar Maps
Apo and InsP 3 -bound crystal structures of the ligand-binding domain of an InsP 3 receptor
Published as: Nat Struct Mol Biol. ; 18(10): 1172 1174. Apo and InsP 3 -bound crystal structures of the ligand-binding domain of an InsP 3 receptor Chun-Chi Lin 1,2, Kyuwon Baek 1,2, and Zhe Lu 1 1 Department
CH 3 CH 2 OH +H 2 O CHO. 2e + 2H + + O 2 H 2 O +HCOOH
2 4 H CH 3 2e + 2H + + 2 H 2 2 H CH 2 H 2e + 2H + + 2 H 2 2 H +H 2 CH 2e + 2H + + 2 H 2 2 H +HCH Supplemental Figure S. The three-step 4DM reaction, each step requires two reducing equivalents from ADPH
Supplementary Information. The Solution Structural Ensembles of RNA Kink-turn Motifs and Their Protein Complexes
Supplementary Information The Solution Structural Ensembles of RNA Kink-turn Motifs and Their Protein Complexes Xuesong Shi, a Lin Huang, b David M. J. Lilley, b Pehr B. Harbury a,c and Daniel Herschlag
SUPPLEMENTARY INFORMATION
www.nature.com/nature 1 Figure S1 Sequence alignment. a Structure based alignment of the plgic of E. chrysanthemi (ELIC), the acetylcholine binding protein from the snail Lymnea stagnalis (AchBP, PDB code
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Different crystal forms obtained for Sky
Supplementary Figure 1 Different crystal forms obtained for Sky 1 353. (a) Crystal form 1 obtained in the presence of 20% PEG 3350 and 0.2 M ammonium citrate tribasic ph 7.0. (b) Crystal form 1 of the
Structures of holo wild-type human cellular retinol-binding protein II (hcrbpii) bound to retinol and retinal
Supporting information Volume 70 (2014) Supporting information for article: Structures of holo wild-type human cellular retinol-binding protein II (hcrbpii) bound to retinol and retinal Zahra Nossoni,
Supplementary information for:
SUPPLEMETARY IFRMATI Supplementary information for: Structure of a β 1 -adrenergic G protein-coupled receptor Tony Warne, Maria J. Serrano-Vega, Jillian G. Baker#, Rouslan Moukhametzianov, Patricia C.
Infrared Spectra of Protonated Networks of Water Molecules in the Interior of Bacteriorhodopsin: A QM/MM Molecular Dynamics Study. Volker Kleinschmidt
Infrared Spectra of Protonated Networks of Water Molecules in the Interior of Bacteriorhodopsin: A QM/MM Molecular Dynamics Study Volker Kleinschmidt Bochum, 2006 Infrared Spectra of Protonated Networks
Three-dimensional structure of a viral genome-delivery portal vertex
Three-dimensional structure of a viral genome-delivery portal vertex Adam S. Olia 1, Peter E. Prevelige Jr. 2, John E. Johnson 3 and Gino Cingolani 4 1 Department of Biological Sciences, Purdue University,
DNP enhanced frequency-selective TEDOR experiments in bacteriorhodopsin
DNP enhanced frequency-selective TEDOR experiments in bacteriorhodopsin Journal of Magnetic Resonance 202 (2010) 9-13 Bajaj S. V., Mak-Jurkauskus, A. L., Belenky, M., Herzfeld, J. and Griffin, R. MR Seminar
Bacterial protease uses distinct thermodynamic signatures for substrate recognition
Bacterial protease uses distinct thermodynamic signatures for substrate recognition Gustavo Arruda Bezerra, Yuko Ohara-Nemoto, Irina Cornaciu, Sofiya Fedosyuk, Guillaume Hoffmann, Adam Round, José A. Márquez,
SUPPLEMENTARY INFORMATION
Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase
SUPPLEMENTARY FIGURES. Structure of the cholera toxin secretion channel in its. closed state
SUPPLEMENTARY FIGURES Structure of the cholera toxin secretion channel in its closed state Steve L. Reichow 1,3, Konstantin V. Korotkov 1,3, Wim G. J. Hol 1$ and Tamir Gonen 1,2$ 1, Department of Biochemistry
Examples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE
Examples of Protein Modeling Protein Modeling Visualization Examination of an experimental structure to gain insight about a research question Dynamics To examine the dynamics of protein structures To
Supplementary Figure 1 Structure of the Orai channel. (a) The hexameric Drosophila Orai channel structure derived from crystallography 1 comprises
Supplementary Figure 1 Structure of the Orai channel. (a) The hexameric Drosophila Orai channel structure derived from crystallography 1 comprises six Orai subunits, each with identical amino acid sequences
Retinal Proteins (Rhodopsins) Vision, Bioenergetics, Phototaxis. Bacteriorhodopsin s Photocycle. Bacteriorhodopsin s Photocycle
Molecular chanisms of Photoactivation and Spectral Tuning in Retinal Proteins Emad Tajkhorshid Theoretical and Computational Biophysics Group Beckman Institute University of Illinois at Urbana-Champaign
Rho1 binding site PtdIns(4,5)P2 binding site Both sites
localization Mutation site DMSO LatB WT F77A I115A I131A K134A Rho1 binding site PtdIns(4,5)P2 binding site Both sites E186A E199A N201A R84A-E186A-E199A L131A-K136A-E186A L131A-E186A-E199A K136A-E186A-E199A
Supplementary Figure 1
Supplementary Figure 1 a Tyr191 Trp265 4-5 Å Tyr268 ~14 Å 4.3 Å 16 17 19 20 4.4 Å 11 15 Lys296 N 8 10 12 14 7.3 Å 18 Tyr191 4-5 Å 18 3.8-4 Å 8 10 12 11 17 16 19 ~ Å ~4 Å Tyr268 5.5-6.3 Å 14 N Lys296 15
Expanded View Figures
The EMBO Journal Structure of a Dm peptide bound to the OT module Tobias Raisch et al Expanded View Figures A Hs Dm 262 297 685 8 HEAT HEAT MIF4G 9BD 1SHD 761 91 193 169 1152 1317 16 1376 1467 HEAT HEAT
Potassium channel gating and structure!
Reading: Potassium channel gating and structure Hille (3rd ed.) chapts 10, 13, 17 Doyle et al. The Structure of the Potassium Channel: Molecular Basis of K1 Conduction and Selectivity. Science 280:70-77
Supplemental Information
Supplemental Information Combinatorial Readout of Unmodified H3R2 and Acetylated H3K14 by the Tandem PHD Finger of MOZ Reveals a Regulatory Mechanism for HOXA9 Transcription Yu Qiu 1, Lei Liu 1, Chen Zhao