Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
|
|
|
- Kristian Maxwell
- 5 years ago
- Views:
Transcription
1 Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT- FITC EC [cm 1 M 1 ] D ± ± ± D2 D3 D ± 8 n.b. * > ± 10 >50 n.b. * ± 2 n.b. * 314 ± D ± 3 n/d ** n/d ** D23 D ± 2 n/d ** n/d ** ± 2 n/d ** 204 ± D ± 1 n/d ** n/d ** D ± 0.5 n/d ** n/d ** D ± ± ± MUT ± ± ± FL ± ± ± ** n.b., no binding ** n/d., not determined Table S1 legend. List of PDZK1 constructs and affinities. Details of the PDZK1 constructs: Residues ranges for the different constructs, molecular weights (MW) including affinity tags and calculated molar extinction coefficients (EC). These columns are followed by dissociation constants of the PDZK1 constructs with the PEPT2-CT-FITC, NHE3-CT-FITC and PDZK1-CT peptides (C-terminal peptides from these proteins). Values were obtained by fluorescence polarization experiments. K D s were calculated from three replicate experiments, where the uncertainty corresponds to the standard error of the fit.
2 A B 670 kda 17 kda 1.35 kda 670 kda 17 kda 1.35 kda A 280 [ma] D1 D2 D3 D4 A 280 [ma] D12 D23 D34 volume [ml] volume [ml] C D 670 kda 17 kda 1.35 kda 670 kda 17 kda 1.35 kda A 280 [ma] D13 D13 D24 D24 A 280 [ma] D14 MUT FL E volume [ml] kda M volume [ml] Lane PDZK1 domain MW [kda] 1 D D D D D D D D D D MUT FL 59.8 Figure S1. Quality control of PDZK1 constructs by analytical gel filtration and SDS PAGE. Related to figure 1. Chromatograms show samples analyzed on a Superdex 75 (SD75) 5/150 home-packed column using the 1260 Infinity Bio-inert high-performance liquid chromatography system (Agilent Technologies). (A) Gel-filtration chromatogram of single domains, (B) double domains, (C) triple domains and (D) tetra domain constructs. The void volume of the column is indicated by a black arrow and elution volumes of
3 protein standards by a dots. (E) Representative SDS-PAGE gel showing the purity of the samples. For reference, the SDS gel was run together with a molecular weight (MW) marker (M) (molecular weights for reference proteins are indicated in kda). Lanes 1-4: single domain constructs, lanes 5-7: double domain construct, lanes 8-9: triple domain constructs and lanes 10-12: tetra domain constructs. MWs of constructs are shown in the table on the right.
4
5 Figure S2. Supplementary SAXS data. Related to figure 2-5 and 7. (A,B,C) Guinier plots of Log(s) vs s 2 in the low angle region for the three four domain constructs. (A) D14. (B) MUT, and (C) FL. The residuals from the linear fit are shown below each plot. (D,E) SAXS profiles of single, double and triple domains shown on a log(i(s)) vs s normalized by concentration scale. The profiles are offset for clarity. (D) Double and triple domain constructs: D12, D23, D34, D13, and D24. (E) Single domain constructs: D1, D2, D3, and D4. (F) P(r) profile for triple domain constructs. There is a clear difference in shape of the P(r) between D13 and D24. D24 has a slower decay indicative of an extended protein. D13 has a second peak, indicating regularity in interdomain distances. (G,H) SAXS profile for titration studies of D14 with inset graph showing the low-s region. (G) D14 alone and with PEPT2-CT at three different protein to peptide ratios. PEPT2-CT binds to D14 without inducing structural changes. (H) D14 alone and with NHE3-CT at three different protein to peptide ratios. Similarly to PEPT2-CT, NHE3-CT binds without changing the overall shape of D14. (N no peptide, 1:2 two-fold excess peptide, 1:1 equal ratio of peptide and protein, 1:5, five-fold excess of peptide)
6 Table S2. SAXS parameters for the individual PDZK1 domains. Related to figure 1-3. D1 D2 D3 D4 Structural Parameters I(0) (cm -1 ) [from P(r)] R g (Å) [from P(r)] I(0) (cm -1 ) [from Guinier] R g (Å) [from Guinier] d max (Å) Dry volume calculated from seq. (Å 3 ) Guinier region Molecular-mass determination Partial specific volume (cm 3 g -1 ) Contrast Molecular mass from (from I(0)) (kda) Molecular mass from Standard P. (kda) Calculated monomeric Mr from sequence (kda) Organism Source Sample Details Homo sapiens E. coli; BL21(DE3) Injection volume (microliters) 30 Concentration range (mg/ml) Solvent (Buffer) 20mM HEPES, 150 Mm NaCl, 0.5 mm TCEP
7 Figure S3. The ConSurf platform was used to calculate the sequence conservation and solvent accessibility for PDZK1-FL (Berezin et al., 2004). Related to figure 1. Note that the residue numbers are all shifted by +23 compared to Figure 1 because of the N-terminal affinity tag. e - exposed residue according to the neural-network algorithm. b buried residue according to neural network algorithm. f predicted functional residue (highly conserved and exposed). s predicted structural residue (highly conserved and buried). The ConSurf results were generated with default settings. The linker regions are sparsely conserved, however, there are some buried residues, most notably in the beginning of the linker between D3-D4 ( ). The conservation score for the residues are overall higher in the tail region ( ) compared to the linker. In particular residues and Many of these aforementioned residues are predicted to be potentially of functional interest and a smaller number are also predicted to
8 be structurally important. Taken together, this could suggest that the tail region may adapt a structured conformation.
9 Figure S4. PSIPRED platform ( was used for secondary structure prediction (Buchan et al., 2013) of PDZK1-FL. Related to figure 1. The linker regions are predicted to be mostly coils (non-secondary structure). In contrast, there is a high propensity for a helical structure for the residues DNMYRLAH (348:356), which overlap with the mutated residues
10 in MUT (351:359). Residue numbers are all shifted by +23 compared to Figure 1 because of the N-terminal affinity tag.
11 A B C D Figure S5. Ab-initio and Rigid body model of PDZK1-FL protein. Related to figure 2 and 3. (A) Nine superimposed GASBOR Ab-initio models (B) Representative fit of a GASBOR model to the SAXS profile, χ 2 =0.51. (C) 10 superimposed BUNCH models. Tail region shown in red. (D) Representative fit from one run, χ 2 =0.67.
12 A B 250 Anisotropy [ma] D1 D3 Anisotropy [ma] FL D14 MUT C Anisotropy [ma] conc [µm] D1 D2 D conc [µm] D Anisotropy [ma] conc [µm] FL D14 MUT conc [µm] Figure S6. Binding of PDZK1 domains to NHE3-CT-FITC peptide and PDZK1- CT-FITC peptide as monitored by fluorescence polarization. Related to figure 7. The graphs represent fluorescence anisotropy as a function of protein concentration. (A) Binding of PDZK1 single domains to the NHE3-CT-FITC peptide. Data points are shown in blue for D1 and in red for D3. (B) Binding of PDZK1 multiple domain constructs to the NHE3-CT-FITC peptide. Data points are marked in red for FL, black for D14, and blue for MUT. (C) Binding of PDZK1 single domains to the PDZK1-CT-FITC peptide. Data points are marked in blue for D1, green for D2, and black for D4. (D) Binding of PDZK1 multiple domains to the PDZK1-CT-FITC peptide. Data points are marked with a red square for FL, red dot for D14, and black triangle for MUT. All data points were recorded in triplicates and error bars indicate the standard deviation of these measurements. The K D values calculated from three replicate experiments are listed in Table S1.
13 Figure S7. X-ray structure of D4 in complex with the C-terminal peptide of PEPT2. Related to figure 1 and 7. D4 has the typical PDZ domain fold (Doyle et al., 1996; Von Ossowski et al., 2006; Kocher et al., 2010) with a six-stranded antiparallel β-sheet (β1 to β6) flanked by two α-helices (α1 and α2) similar to the mouse homologue (4R2Z.pdb). (A) Cartoon model of the derived complex showing the overall structure of D4 in grey and the C-terminal peptide of PEPT2 in pink. D4 binds PEPT2-CT in a similar fashion as described for other PDZ domains bound to target peptides (Karthikeyan, Leung and Ladias, 2001; Kocher et al., 2011). Binding occurs via beta-sheet complementation, and the peptide is stabilized by an intensive network of hydrogen bonds (partly mediated by water molecules) and hydrophobic interactions, which extends the β-sheet of D4 and forms an additional β- strand (β7) that runs antiparallel to β2. N- and C-termini are labeled. (B) Zoom-in of the dashed box in (A) illustrating main chain interactions (dashed yellow lines) between D4 and the peptide. The residues involved in the formation of the β-sheet (sticks) and the length of the bonds are indicated. Oxygen and nitrogen atoms are colored in red and blue, respectively. For clarity, the side chains have been removed and the rest of the protein is shown as a transparent cartoon model. (C) Close up view of side chain interactions between D4 and PEPT2. Residues (sticks) are labeled, water molecules are colored in cyan and a glycerol molecule that was observed in
14 the electron density is colored in yellow (carbon atoms). Oxygen and nitrogen atoms are colored as in (B). In particular, Leu 729 and Thr 727 are the key residues in PEPT2 for establishing an interaction with D4. Table S3. Crystallographic table for D4 in complex with PEPT2-CT. Related to figure 1 and 7. Wavelength (Å) Resolution range (Å) ( ) Space group P Unit cell dimensions a, b, c (Å) 54.4, 54.4, α, β, γ ( ) 90, 90, 120 Total reflections (73014) Unique reflections (2107) Multiplicity 35.0 (34.70) Completeness (%) 1.00 (0.99) Mean I/σ(I) (3.96) Wilson B-factor (Å 2 ) R-merge 0.06 (0.96) R-meas 0.06 (0.97) CC1/2 1 (0.62) CC* 1 (0.87) Reflections used in refinement (2107) Reflections used for R- free 1093 (105) R-work 0.19 (0.38) R-free 0.21 (0.40) CC(work) 0.97 (0.75) CC(free) 0.96 (0.68) Number of non-hydrogen atoms 917 Macromolecules 787 Ligands 6 Protein residues 94 RMS (bonds) (Å) RMS (angles) ( ) 0.84 Ramachandran favored (%) 100 Ramachandran allowed (%) 0
15 Ramachandran outliers (%) 0 Rotamer outliers (%) 1.2 Clashscore 3.09 B-factors (Å 2 ) Average Macromolecules Ligands Solvent Number of TLS groups 5 Table S3 legend. Crystallographic parameters Table. Data collection and refinement statistics for the crystal structure of D4 in complex with C- terminal peptide PEPT2 are shown. Statistics for the highest-resolution shell are shown in parentheses. The final model was refined at 1.5Å resolution with R work and R free of 0.19 and 0.21, respectively. Residues 457 to 460 in addition to the side chains of residues 374, 375 and 456 from D4, and residues in addition to the side chains of residues from PEPT2-CT could not be modeled due to missing electron density.
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),
Supplementary Figure 1. Biochemical and sequence alignment analyses the
Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).
High-resolution crystal structure of ERAP1 with bound phosphinic transition-state analogue inhibitor
High-resolution crystal structure of ERAP1 with bound phosphinic transition-state analogue inhibitor Petros Giastas 1, Margarete Neu 2, Paul Rowland 2, and Efstratios Stratikos 1 1 National Center for
SUPPLEMENTARY INFORMATION
doi:1.138/nature1737 Supplementary Table 1 variant Description FSEC - 2B12 a FSEC - 6A1 a K d (leucine) c Leucine uptake e K (wild-type like) K (Y18F) K (TS) K (TSY) K288A mutant, lipid facing side chain
Acta Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural basis of the heterodimerization of the MST and RASSF SARAH domains in the Hippo signalling
Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a
Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a series of tmfret-pairs comprised of single cysteine mutants
Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2
Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell
Supplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine
Supplementary figure 1. Comparison of unbound and as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine GM-CSF (slate) with bound GM-CSF in the GIF:GM-CSF complex (GIF: green,
SUPPLEMENTARY INFORMATION
Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10955 Supplementary Figures Supplementary Figure 1. Electron-density maps and crystallographic dimer structures of the motor domain. (a f) Stereo views of the final electron-density maps
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.
ml. ph 7.5 ph 6.5 ph 5.5 ph 4.5. β 2 AR-Gs complex + GDP β 2 AR-Gs complex + GTPγS
a UV28 absorption (mau) 9 8 7 5 3 β 2 AR-Gs complex β 2 AR-Gs complex + GDP β 2 AR-Gs complex + GTPγS β 2 AR-Gs complex dissociated complex excess nucleotides b 9 8 7 5 3 β 2 AR-Gs complex β 2 AR-Gs complex
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting
SUPPLEMENTARY INFORMATION
Fig. 1 Influences of crystal lattice contacts on Pol η structures. a. The dominant lattice contact between two hpol η molecules (silver and gold) in the type 1 crystals. b. A close-up view of the hydrophobic
SI Text S1 Solution Scattering Data Collection and Analysis. SI references
SI Text S1 Solution Scattering Data Collection and Analysis. The X-ray photon energy was set to 8 kev. The PILATUS hybrid pixel array detector (RIGAKU) was positioned at a distance of 606 mm from the sample.
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer
SUPPLEMENTARY INFORMATION
Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2
SUPPLEMENTARY INFORMATION
Supplementary Table 1: Data collection, phasing and refinement statistics ChbC/Ta 6 Br 12 Native ChbC Data collection Space group P4 3 2 1 2 P4 3 2 1 2 Cell dimensions a, c (Å) 132.75, 453.57 132.81, 452.95
Supplementary Figures
1 Supplementary Figures Supplementary Figure 1 Type I FGFR1 inhibitors (a) Chemical structures of a pyrazolylaminopyrimidine inhibitor (henceforth referred to as PAPI; PDB-code of the FGFR1-PAPI complex:
Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions. Implicated in Dimerization and Autoinhibition
JBC Papers in Press. Published on November 1, 2000 as Manuscript M006502200 Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions Implicated in Dimerization and Autoinhibition 1 Copyright
type GroEL-GroES complex. Crystals were grown in buffer D (100 mm HEPES, ph 7.5,
Supplementary Material Supplementary Materials and Methods Structure Determination of SR1-GroES-ADP AlF x SR1-GroES-ADP AlF x was purified as described in Materials and Methods for the wild type GroEL-GroES
SUPPLEMENTARY INFORMATION
Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,
NB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5
SUPPLEMENTARY TABLES Suppl. Table 1. Protonation states at ph 7.4 and 4.5. Protonation states of titratable residues in GCase at ph 7.4 and 4.5. Histidine: HID, H at δ-nitrogen; HIE, H at ε-nitrogen; HIP,
Structural insights into WcbI, a novel polysaccharide-biosynthesis enzyme
Volume 1 (2014) Supporting information for article: Structural insights into WcbI, a novel polysaccharide-biosynthesis enzyme Mirella Vivoli, Emily Ayres, Edward Beaumont, Michail N. Isupov and Nicholas
Cryo-EM data collection, refinement and validation statistics
1 Table S1 Cryo-EM data collection, refinement and validation statistics Data collection and processing CPSF-160 WDR33 (EMDB-7114) (PDB 6BM0) CPSF-160 WDR33 (EMDB-7113) (PDB 6BLY) CPSF-160 WDR33 CPSF-30
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the
Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27
Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits AhpC and AhpF from Escherichia coli Phat Vinh Dip 1,#, Neelagandan Kamariah 2,#, Malathy Sony Subramanian Manimekalai
SUPPLEMENTARY INFORMATION
Supplementary Table 1: Amplitudes of three current levels. Level 0 (pa) Level 1 (pa) Level 2 (pa) TrkA- TrkH WT 200 K 0.01 ± 0.01 9.5 ± 0.01 18.7 ± 0.03 200 Na * 0.001 ± 0.01 3.9 ± 0.01 12.5 ± 0.03 200
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier
CH 3 CH 2 OH +H 2 O CHO. 2e + 2H + + O 2 H 2 O +HCOOH
2 4 H CH 3 2e + 2H + + 2 H 2 2 H CH 2 H 2e + 2H + + 2 H 2 2 H +H 2 CH 2e + 2H + + 2 H 2 2 H +HCH Supplemental Figure S. The three-step 4DM reaction, each step requires two reducing equivalents from ADPH
Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing
Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing 0.1% SDS without boiling. The gel was analyzed by a fluorescent
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Definition and assessment of ciap1 constructs.
Supplementary Figure 1 Definition and assessment of ciap1 constructs. (a) ciap1 constructs used in this study are shown as primary structure schematics with domains colored as in the main text. Mutations
Structure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex
Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10458 Active Site Remodeling in the Bifunctional Fructose-1,6- bisphosphate aldolase/phosphatase Juan Du, Rafael F. Say, Wei Lü, Georg Fuchs & Oliver Einsle SUPPLEMENTARY FIGURES Figure
SUPPLEMENTARY INFORMATION
www.nature.com/nature 1 Figure S1 Sequence alignment. a Structure based alignment of the plgic of E. chrysanthemi (ELIC), the acetylcholine binding protein from the snail Lymnea stagnalis (AchBP, PDB code
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.
Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,
Introduction to Comparative Protein Modeling. Chapter 4 Part I
Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature
Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases
Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3
Model Mélange. Physical Models of Peptides and Proteins
Model Mélange Physical Models of Peptides and Proteins In the Model Mélange activity, you will visit four different stations each featuring a variety of different physical models of peptides or proteins.
SUPPLEMENTARY INFORMATION
Supplementary Table S1 Kinetic Analyses of the AMSH-LP mutants AMSH-LP K M (μm) k cat x 10-3 (s -1 ) WT 71.8 ± 6.3 860 ± 65.4 T353A 76.8 ± 11.7 46.3 ± 3.7 F355A 58.9 ± 10.4 5.33 ± 0.30 proximal S358A 75.1
Supplemental Information. Molecular Basis of Spectral Diversity. in Near-Infrared Phytochrome-Based. Fluorescent Proteins
Chemistry & Biology, Volume 22 Supplemental Information Molecular Basis of Spectral Diversity in Near-Infrared Phytochrome-Based Fluorescent Proteins Daria M. Shcherbakova, Mikhail Baloban, Sergei Pletnev,
Acta Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural characterization of the virulence factor Nuclease A from Streptococcus agalactiae
Supplementary Information
1 Supplementary Information Figure S1 The V=0.5 Harker section of an anomalous difference Patterson map calculated using diffraction data from the NNQQNY crystal at 1.3 Å resolution. The position of the
The Fic protein Doc uses an inverted substrate to phosphorylate and. inactivate EF-Tu
The Fic protein Doc uses an inverted substrate to phosphorylate and inactivate EF-Tu Daniel Castro-Roa 1, Abel Garcia-Pino 2,3 *, Steven De Gieter 2,3, Nico A.J. van Nuland 2,3, Remy Loris 2,3, Nikolay
IgE binds asymmetrically to its B cell receptor CD23
Supplementary Information IgE binds asymmetrically to its B cell receptor CD23 Balvinder Dhaliwal 1*, Marie O. Y. Pang 2, Anthony H. Keeble 2,3, Louisa K. James 2,4, Hannah J. Gould 2, James M. McDonnell
Full-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),
Supplementary Methods Protein expression and purification Full-length GlpG sequence was generated by PCR from E. coli genomic DNA (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),
Bacterial protease uses distinct thermodynamic signatures for substrate recognition
Bacterial protease uses distinct thermodynamic signatures for substrate recognition Gustavo Arruda Bezerra, Yuko Ohara-Nemoto, Irina Cornaciu, Sofiya Fedosyuk, Guillaume Hoffmann, Adam Round, José A. Márquez,
Acta Cryst. (2017). D73, doi: /s
Acta Cryst. (2017). D73, doi:10.1107/s2059798317010932 Supporting information Volume 73 (2017) Supporting information for article: Designing better diffracting crystals of biotin carboxyl carrier protein
Supplemental Data SUPPLEMENTAL FIGURES
Supplemental Data CRYSTAL STRUCTURE OF THE MG.ADP-INHIBITED STATE OF THE YEAST F 1 C 10 ATP SYNTHASE Alain Dautant*, Jean Velours and Marie-France Giraud* From Université Bordeaux 2, CNRS; Institut de
Supplementary information for:
SUPPLEMETARY IFRMATI Supplementary information for: Structure of a β 1 -adrenergic G protein-coupled receptor Tony Warne, Maria J. Serrano-Vega, Jillian G. Baker#, Rouslan Moukhametzianov, Patricia C.
Principles of Physical Biochemistry
Principles of Physical Biochemistry Kensal E. van Hold e W. Curtis Johnso n P. Shing Ho Preface x i PART 1 MACROMOLECULAR STRUCTURE AND DYNAMICS 1 1 Biological Macromolecules 2 1.1 General Principles
Physiochemical Properties of Residues
Physiochemical Properties of Residues Various Sources C N Cα R Slide 1 Conformational Propensities Conformational Propensity is the frequency in which a residue adopts a given conformation (in a polypeptide)
SUPPLEMENTARY INFORMATION. doi: /nature07461
Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11744 Supplementary Table 1. Crystallographic data collection and refinement statistics. Wild-type Se-Met-BcsA-B SmCl 3 -soaked EMTS-soaked Data collection Space
Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
Supporting Information
Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,
SUPPLEMENTARY INFORMATION
Dph2 SeMet (iron-free) # Dph2 (iron-free) Dph2-[4Fe-4S] Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 58.26, 82.08, 160.42 58.74, 81.87, 160.01 55.70, 80.53,
Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein
Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08
Supporting Information
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2016 Supporting Information Lipid molecules can induce an opening of membrane-facing
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Jan 14, 2019 11:10 AM EST PDB ID : 6GYW Title : Crystal structure of DacA from Staphylococcus aureus Authors : Tosi, T.; Freemont, P.S.; Grundling, A. Deposited
Supporting Information
Supporting Information Oxaliplatin binding to human copper chaperone Atox1 and protein dimerization Benny D. Belviso, 1 Angela Galliani, 2 Alessia Lasorsa, 2 Valentina Mirabelli, 1,3 Rocco Caliandro, 1
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 8, 2018 08:34 pm GMT PDB ID : 1RUT Title : Complex of LMO4 LIM domains 1 and 2 with the ldb1 LID domain Authors : Deane, J.E.; Ryan, D.P.; Maher, M.J.;
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/5/243/ra68/dc1 Supplementary Materials for Superbinder SH2 Domains Act as Antagonists of Cell Signaling Tomonori Kaneko, Haiming Huang, Xuan Cao, Xing Li, Chengjun
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group
Rational Design of Thermodynamic and Kinetic Binding Profiles by. Optimizing Surface Water Networks Coating Protein Bound Ligands
SUPPORTING INFORMATION Rational Design of Thermodynamic and Kinetic Binding Profiles by Optimizing Surface Water Networks Coating Protein Bound Ligands Stefan G. Krimmer,, Jonathan Cramer,, Michael Betz,
Supplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization
Supplementary Information Structural basis for precursor protein-directed ribosomal peptide macrocyclization Kunhua Li 1,3, Heather L. Condurso 1,3, Gengnan Li 1, Yousong Ding 2 and Steven D. Bruner 1*
LS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor
LS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor Note: Adequate space is given for each answer. Questions that require a brief explanation should
Supplemental Methods. Protein expression and purification
Supplemental Methods Protein expression and purification The isolated collagen-binding domain of hlair-1, amino acid 22-122, was cloned into pet3xa using introduced BamHI and NotI sites at the 5 and 3
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 14, 2018 02:00 pm GMT PDB ID : 3RRQ Title : Crystal structure of the extracellular domain of human PD-1 Authors : Lazar-Molnar, E.; Ramagopal, U.A.; Nathenson,
Cks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved
Cks1 d CKS1 Supplementary Figure 1 The -Cks1 crystal lattice. (a) Schematic of the - Cks1 crystal lattice. -Cks1 crystallizes in a lattice that contains c 4 copies of the t - Cks1 dimer in the crystallographic
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 8, 2018 06:13 pm GMT PDB ID : 5G5C Title : Structure of the Pyrococcus furiosus Esterase Pf2001 with space group C2221 Authors : Varejao, N.; Reverter,
Supporting information for
Supporting information for Rewiring multi-domain protein switches: transforming a fluorescent Zn 2+ -sensor into a light-responsive Zn 2+ binding protein Stijn J.A. Aper and Maarten Merkx Laboratory of
Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Jan 28, 2019 11:10 AM EST PDB ID : 6A5H Title : The structure of [4+2] and [6+4] cyclase in the biosynthetic pathway of unidentified natural product Authors
FW 1 CDR 1 FW 2 CDR 2
Supplementary Figure 1 Supplementary Figure 1: Interface of the E9:Fas structure. The two interfaces formed by V H and V L of E9 with Fas are shown in stereo. The Fas receptor is represented as a surface
Biomolecules: lecture 10
Biomolecules: lecture 10 - understanding in detail how protein 3D structures form - realize that protein molecules are not static wire models but instead dynamic, where in principle every atom moves (yet
Structural characterization of NiV N 0 P in solution and in crystal.
Supplementary Figure 1 Structural characterization of NiV N 0 P in solution and in crystal. (a) SAXS analysis of the N 32-383 0 -P 50 complex. The Guinier plot for complex concentrations of 0.55, 1.1,
Table S1. Theoretical and apparent molecular weights of the proteins and protein complexes used for ITC analysis
Table S1. Theoretical and apparent molecular weights of the proteins and protein complexes used for ITC analysis Sample Theoretical molecular weight (without glycosylation) Apparent molecular weight R-2
Supplementary Figure 1. Stability constants of metal monohydroxides. The log K values are summarized according to the atomic number of each element
Supplementary Figure 1. Stability constants of metal monohydroxides. The log K values are summarized according to the atomic number of each element as determined in a previous study 1. The log K value
ID14-EH3. Adam Round
Bio-SAXS @ ID14-EH3 Adam Round Contents What can be obtained from Bio-SAXS Measurable parameters Modelling strategies How to collect data at Bio-SAXS Procedure Data collection tests Data Verification and
Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps
Cell Reports Supplemental Information Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps Chih-Chia Su, Jani Reddy Bolla, Nitin Kumar, Abhijith Radhakrishnan,
Supplementary Figure 1 Schematic overview of ASTNs in neuronal migration. (a) Schematic of roles played by ASTNs 1 and 2. ASTN-1-mediated adhesions
Supplementary Figure 1 Schematic overview of ASTNs in neuronal migration. (a) Schematic of roles played by ASTNs 1 and 2. ASTN-1-mediated adhesions undergo endocytosis into clathrin-coated vesicles dependent
Impact of the crystallization condition on importin-β conformation
Supporting information Volume 72 (2016) Supporting information for article: Impact of the crystallization condition on importin-β conformation Marcel J. Tauchert, Clément Hémonnot, Piotr Neumann, Sarah
The Structure and Functions of Proteins
Wright State University CORE Scholar Computer Science and Engineering Faculty Publications Computer Science and Engineering 2003 The Structure and Functions of Proteins Dan E. Krane Wright State University
Computational engineering of cellulase Cel9A-68 functional motions through mutations in its linker region. WT 1TF4 (crystal) -90 ERRAT PROVE VERIFY3D
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 218 Supplementary Material: Computational engineering of cellulase Cel9-68 functional
Structural insights into Aspergillus fumigatus lectin specificity - AFL binding sites are functionally non-equivalent
Acta Cryst. (2015). D71, doi:10.1107/s1399004714026595 Supporting information Volume 71 (2015) Supporting information for article: Structural insights into Aspergillus fumigatus lectin specificity - AFL
Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition
Supplementary Information to Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition Nadine Czudnochowski 1,2, *, Christian A. Bösken 1, * & Matthias Geyer 1 1 Max-Planck-Institut
Chapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR
The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR 103 Abstract The interaction of the Src SH2 domain with the catalytic domain of FAK, including the Y397 SH2 domain
Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).
Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted
Exam I Answer Key: Summer 2006, Semester C
1. Which of the following tripeptides would migrate most rapidly towards the negative electrode if electrophoresis is carried out at ph 3.0? a. gly-gly-gly b. glu-glu-asp c. lys-glu-lys d. val-asn-lys
BSc and MSc Degree Examinations
Examination Candidate Number: Desk Number: BSc and MSc Degree Examinations 2018-9 Department : BIOLOGY Title of Exam: Molecular Biology and Biochemistry Part I Time Allowed: 1 hour and 30 minutes Marking
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 10, 2018 01:44 am GMT PDB ID : 1MWP Title : N-TERMINAL DOMAIN OF THE AMYLOID PRECURSOR PROTEIN Authors : Rossjohn, J.; Cappai, R.; Feil, S.C.; Henry,
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Jan 17, 2019 09:42 AM EST PDB ID : 6D3Z Title : Protease SFTI complex Authors : Law, R.H.P.; Wu, G. Deposited on : 2018-04-17 Resolution : 2.00 Å(reported)
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Quantitation of the binding of pro53 peptide to sorla Vps10p measured by the AP reporter assay. The graph shows tracings of the typical chromogenic AP reaction observed with AP-pro53
Supplementary materials. Crystal structure of the carboxyltransferase domain. of acetyl coenzyme A carboxylase. Department of Biological Sciences
Supplementary materials Crystal structure of the carboxyltransferase domain of acetyl coenzyme A carboxylase Hailong Zhang, Zhiru Yang, 1 Yang Shen, 1 Liang Tong Department of Biological Sciences Columbia