Computational engineering of cellulase Cel9A-68 functional motions through mutations in its linker region. WT 1TF4 (crystal) -90 ERRAT PROVE VERIFY3D

Size: px
Start display at page:

Download "Computational engineering of cellulase Cel9A-68 functional motions through mutations in its linker region. WT 1TF4 (crystal) -90 ERRAT PROVE VERIFY3D"

Transcription

1 Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 218 Supplementary Material: Computational engineering of cellulase Cel9-68 functional motions through mutations in its linker region M. G. S. Costa, a Y. F. Silva a and P. R. atista* a a. Programa de Computação Científica (PROCC), Fundação Oswaldo Cruz, Rio de Janeiro, razil. pbatista@fiocruz.br Fig. S1. 1TF4 (crystal) G46P General Glycine General Glycine Proline -9 9 Pre-Proline -9 9 Proline -9 9 Pre-Proline Overall quality factor: Overall quality factor: % of buried protein atoms are outliers 3.9 % of buried protein atoms are outliers 97.19% of the residues had an averaged 3D-1D score >= % of the residues had an averaged 3D-1D score >=.2 G46+ Overall quality factor: % of buried protein atoms are outliers 97.64% of the residues had an averaged 3D-1D score >=.2 Overall quality factor: % of buried protein atoms are outliers 97.98% of the residues had an averaged 3D-1D score >=.2 Fig.S1 Validation of the models. The Ramachandran plots and the results returned by, and VERIFY 3D are given for each system considered in this work, including the crystallographic Cel9-68 structure (PD ID: 1TF4).

2 Fig. S2. cum. contribu,on (%) collec,vity G46P G mode # C D RMSF (Å) Δ RMSF (Å) CD residue # linker CM G46P - G Fig.S2 Normal mode analysis of Cel9-68 variants. In, cumulative contribution of the first ten low-frequency normal modes to the overall atomic fluctuations. In, Collectivity of motions described by low frequency modes. In C, absolute fluctuations per residue. In D, relative fluctuations (taking as reference) per mode coloured as indicated in the legend. The Cel9-68 domain definitions are indicated above the plot. Fig. S3. G46+ G46P run 1 run 2 run 3 Fig.S3 Time evolution of backbone RMSD per replica. The simulated systems are identified above each plot and the results obtained for each independent run are coloured as indicated in the legend.

3 Fig. S4. G46P G46+ run 1 run 2 run 3 radius of gyra7on (Å) distance between domains (Å) Time (ns) Fig.S4 Time evolution of the interdomain distances (in ) and the radius of gyration of Cel9-68 (in ), per replica, along the MD simulations. The simulated systems are identified above each plot and the results obtained for each independent run are coloured as indicated in the legend. Fig. S5. Fig.S5 Distribution of RMSD distances for all pairs of conformations obtained in the concatenated trajectories for each simulated system. Coloured as indicated in the legend.

4 Fig. S6. mode 7 mode 8 mode 9 Fig.S6 Results of population analysis based on projections of the conformations sampled during explicit solvent MD onto the three low-frequency normal modes calculated for the system (top) or (bottom). Coloured as indicated in the legend.

5 Captions of supplementary movies Supplementary movie 1: Displacements along normal mode 7 calculated for the Cel9-68 wild type system. Each structural domain was differentially coloured as in Figure 1: catalytic domain (red), linker (cyan) and carbohydrate binding module (green). Supplementary movie 2: Displacements along normal mode 8 calculated for the Cel9-68 wild type system. The protein is coloured as in supplementary movie 1. Supplementary movie 3: Displacements along normal mode 9 calculated for the Cel9-68 wild type system. The protein is coloured as in supplementary movie 1. Supplementary movie 4: Differences between the lowest frequency normal mode calculated for the and systems (related to Figure 3). The Cel9-68 structural domains are indicated in the left part of the video. Different colouring of the CM was applied to highlight the conformational states reached after displacements along each sense of the lowest frequency modes.

Insights into the Biotransformation of 2,4,6- Trinitrotoluene by the Old Yellow Enzyme Family of Flavoproteins. A Computational Study

Insights into the Biotransformation of 2,4,6- Trinitrotoluene by the Old Yellow Enzyme Family of Flavoproteins. A Computational Study Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2019 Supporting Information for Insights into the Biotransformation of 2,4,6- Trinitrotoluene

More information

Supplementary Information

Supplementary Information Supplementary Information Resveratrol Serves as a Protein-Substrate Interaction Stabilizer in Human SIRT1 Activation Xuben Hou,, David Rooklin, Hao Fang *,,, Yingkai Zhang Department of Medicinal Chemistry

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2016 Supporting Information Lipid molecules can induce an opening of membrane-facing

More information

Supporting Information How does Darunavir prevent HIV-1 protease dimerization?

Supporting Information How does Darunavir prevent HIV-1 protease dimerization? Supporting Information How does Darunavir prevent HIV- protease dimerization? Danzhi Huang and Amedeo Caflisch a Department of Biochemistry University of Zürich, Winterthurerstrasse 9 CH-7 Zürich, Switzerland

More information

Structural and mechanistic insight into the substrate. binding from the conformational dynamics in apo. and substrate-bound DapE enzyme

Structural and mechanistic insight into the substrate. binding from the conformational dynamics in apo. and substrate-bound DapE enzyme Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 215 Structural and mechanistic insight into the substrate binding from the conformational

More information

Experimental and Computational Mutagenesis to Investigate the. Positioning of a General Base within an Enzyme Active Site

Experimental and Computational Mutagenesis to Investigate the. Positioning of a General Base within an Enzyme Active Site Experimental and Computational Mutagenesis to Investigate the Positioning of a General Base within an Enzyme Active Site Jason P. Schwans, Philip Hanoian, Benjamin J. Lengerich, Fanny Sunden, Ana Gonzalez

More information

T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp

T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp S u p p l e m e n ta l m at e r i a l jgp Lee et al., http://www.jgp.org/cgi/content/full/jgp.201411219/dc1 T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y S u p p l e m e n ta l D I S C U S

More information

Supporting information for: Mechanism of lignin inhibition of enzymatic. biomass deconstruction

Supporting information for: Mechanism of lignin inhibition of enzymatic. biomass deconstruction Supporting information for: Mechanism of lignin inhibition of enzymatic biomass deconstruction Josh V. Vermaas,, Loukas Petridis, Xianghong Qi,, Roland Schulz,, Benjamin Lindner, and Jeremy C. Smith,,

More information

Mechanism of water/ion exchange at a protein surface: a weakly bound chloride in Helicobacter pylori apoflavodoxin.

Mechanism of water/ion exchange at a protein surface: a weakly bound chloride in Helicobacter pylori apoflavodoxin. Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 25 ELECTRONIC SUPPLEMENTARY INFORMATION Mechanism of water/ion exchange at a protein

More information

IgE binds asymmetrically to its B cell receptor CD23

IgE binds asymmetrically to its B cell receptor CD23 Supplementary Information IgE binds asymmetrically to its B cell receptor CD23 Balvinder Dhaliwal 1*, Marie O. Y. Pang 2, Anthony H. Keeble 2,3, Louisa K. James 2,4, Hannah J. Gould 2, James M. McDonnell

More information

Structural basis for catalytically restrictive dynamics of a high-energy enzyme state

Structural basis for catalytically restrictive dynamics of a high-energy enzyme state Supplementary Material Structural basis for catalytically restrictive dynamics of a high-energy enzyme state Michael Kovermann, Jörgen Ådén, Christin Grundström, A. Elisabeth Sauer-Eriksson, Uwe H. Sauer

More information

Assessing the potential of atomistic molecular dynamics simulations to probe reversible. protein-protein recognition and binding

Assessing the potential of atomistic molecular dynamics simulations to probe reversible. protein-protein recognition and binding Supporting information for Assessing the potential of atomistic molecular dynamics simulations to probe reversible protein-protein recognition and binding Luciano A. Abriata and Matteo Dal Peraro Laboratory

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),

More information

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-

More information

Tu 1,*, , Sweden

Tu 1,*, , Sweden Supplementary Material Computational studiess of the binding profile of phosphoinositide PtdIns(,4,5)P with the pleckstrin homology domain d of an oomycetee cellulose synthase Guanglin Kuang 1, Vincent

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier

More information

Supporting Information

Supporting Information Supporting Information Critical role of inter-domain interactions on the conformational change and catalytic mechanism of Endoplasmic Reticulum Aminopeptidase 1 Athanasios Stamogiannos 1, Zachary Maben

More information

Enhancing Specificity in the Janus Kinases: A Study on the Thienopyridine. JAK2 Selective Mechanism Combined Molecular Dynamics Simulation

Enhancing Specificity in the Janus Kinases: A Study on the Thienopyridine. JAK2 Selective Mechanism Combined Molecular Dynamics Simulation Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Supporting Information Enhancing Specificity in the Janus Kinases: A Study on the Thienopyridine

More information

NB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5

NB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5 SUPPLEMENTARY TABLES Suppl. Table 1. Protonation states at ph 7.4 and 4.5. Protonation states of titratable residues in GCase at ph 7.4 and 4.5. Histidine: HID, H at δ-nitrogen; HIE, H at ε-nitrogen; HIP,

More information

Carbazole Derivatives Binding to c-kit G-quadruplex DNA

Carbazole Derivatives Binding to c-kit G-quadruplex DNA Supplementary Materials Carbazole Derivatives Binding to c-kit G-quadruplex DNA Agata Głuszyńska 1, *, Bernard Juskowiak 1, Martyna Kuta-Siejkowska 2, Marcin Hoffmann 2 and Shozeb Haider 3 1 Laboratory

More information

Nature Structural and Molecular Biology: doi: /nsmb.2938

Nature Structural and Molecular Biology: doi: /nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat proteins. (a) Water-mediate hydrogen-bond network is frequently visible in the convex region of LRR crystal structures. Examples

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature1737 Supplementary Table 1 variant Description FSEC - 2B12 a FSEC - 6A1 a K d (leucine) c Leucine uptake e K (wild-type like) K (Y18F) K (TS) K (TSY) K288A mutant, lipid facing side chain

More information

Supplementary information for cloud computing approaches for prediction of ligand binding poses and pathways

Supplementary information for cloud computing approaches for prediction of ligand binding poses and pathways Supplementary information for cloud computing approaches for prediction of ligand binding poses and pathways Morgan Lawrenz 1, Diwakar Shukla 1,2 & Vijay S. Pande 1,2 1 Department of Chemistry, Stanford

More information

Electro-Mechanical Conductance Modulation of a Nanopore Using a Removable Gate

Electro-Mechanical Conductance Modulation of a Nanopore Using a Removable Gate Electro-Mechanical Conductance Modulation of a Nanopore Using a Removable Gate Shidi Zhao a, Laura Restrepo-Pérez b, Misha Soskine c, Giovanni Maglia c, Chirlmin Joo b, Cees Dekker b and Aleksei Aksimentiev

More information

A dynamic interaction process between KaiA and KaiC is critical to

A dynamic interaction process between KaiA and KaiC is critical to A dynamic interaction process between KaiA and KaiC is critical to the cyanobacterial circadian oscillator Pei Dong 1,2, Ying Fan 2, Jianqiang Sun 3, Mengting Lv 2, Ming Yi 4, Xiao Tan 1,2, Sen Liu 1,2,*

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3

More information

Supporting Information. Accurate prediction of the structure and vibrational spectra of ionic

Supporting Information. Accurate prediction of the structure and vibrational spectra of ionic Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2018 Supporting Information Accurate prediction of the structure and vibrational spectra

More information

FW 1 CDR 1 FW 2 CDR 2

FW 1 CDR 1 FW 2 CDR 2 Supplementary Figure 1 Supplementary Figure 1: Interface of the E9:Fas structure. The two interfaces formed by V H and V L of E9 with Fas are shown in stereo. The Fas receptor is represented as a surface

More information

Structural Insights from Molecular Dynamics. Simulations of Tryptophan 7-Halogenase and

Structural Insights from Molecular Dynamics. Simulations of Tryptophan 7-Halogenase and Supporting Information Structural Insights from Molecular Dynamics Simulations of Tryptophan 7-Halogenase and Tryptophan 5-halogenase Jon Ainsley 1, Adrian J. Mulholland 2, Gary W. Black 1, Olivier Sparagano

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase

More information

L718Q mutant EGFR escapes covalent inhibition by stabilizing. a non-reactive conformation of the lung cancer drug. osimertinib

L718Q mutant EGFR escapes covalent inhibition by stabilizing. a non-reactive conformation of the lung cancer drug. osimertinib Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information (ESI) for L718Q mutant EGFR escapes covalent inhibition

More information

Structural basis of PROTAC cooperative recognition for selective protein degradation

Structural basis of PROTAC cooperative recognition for selective protein degradation SUPPLEMENTARY INFORMATION Structural basis of PROTAC cooperative recognition for selective protein degradation Morgan S. Gadd 1, Andrea Testa 1, Xavier Lucas 1, Kwok-Ho Chan, Wenzhang Chen, Douglas J.

More information

HOMOLOGY MODELING. The sequence alignment and template structure are then used to produce a structural model of the target.

HOMOLOGY MODELING. The sequence alignment and template structure are then used to produce a structural model of the target. HOMOLOGY MODELING Homology modeling, also known as comparative modeling of protein refers to constructing an atomic-resolution model of the "target" protein from its amino acid sequence and an experimental

More information

A conserved P-loop anchor limits the structural dynamics that mediate. nucleotide dissociation in EF-Tu.

A conserved P-loop anchor limits the structural dynamics that mediate. nucleotide dissociation in EF-Tu. Supplemental Material for A conserved P-loop anchor limits the structural dynamics that mediate nucleotide dissociation in EF-Tu. Evan Mercier 1,2, Dylan Girodat 1, and Hans-Joachim Wieden 1 * 1 Alberta

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the

More information

β 2 -microglobulin fibrillation?

β 2 -microglobulin fibrillation? Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2014 Can small hydrophobic gold nanoparticles inhibit β 2 -microglobulin fibrillation? G. Brancolini,,

More information

Supporting Information

Supporting Information Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,

More information

Intrinsic Dynamics of Restriction Endonuclease EcoO109I Studied by Molecular Dynamics Simulations and X-Ray Scattering Data Analysis

Intrinsic Dynamics of Restriction Endonuclease EcoO109I Studied by Molecular Dynamics Simulations and X-Ray Scattering Data Analysis 2808 Biophysical Journal Volume 96 April 2009 2808 2822 Intrinsic Dynamics of Restriction Endonuclease EcoO109I Studied by Molecular Dynamics Simulations and X-Ray Scattering Data Analysis Tomotaka Oroguchi,

More information

Ensemble refinement of protein crystal structures in PHENIX. Tom Burnley Piet Gros

Ensemble refinement of protein crystal structures in PHENIX. Tom Burnley Piet Gros Ensemble refinement of protein crystal structures in PHENIX Tom Burnley Piet Gros Incomplete modelling of disorder contributes to R factor gap Only ~5% of residues in the PDB are modelled with more than

More information

Relative binding enthalpies from molecular dynamics simulations. using a direct method

Relative binding enthalpies from molecular dynamics simulations. using a direct method Relative binding enthalpies from molecular dynamics simulations using a direct method Amitava Roy, 1 Duy P. Hua, 1 Joshua M. Ward, 1 and Carol Beth Post* Department of Medicinal Chemistry, Markey Center

More information

SUPPLEMENTARY MATERIAL. Supplementary material and methods:

SUPPLEMENTARY MATERIAL. Supplementary material and methods: Electronic Supplementary Material (ESI) for Catalysis Science & Technology. This journal is The Royal Society of Chemistry 2015 SUPPLEMENTARY MATERIAL Supplementary material and methods: - Computational

More information

Analysis of MD trajectories in GROMACS David van der Spoel

Analysis of MD trajectories in GROMACS David van der Spoel Analysis of MD trajectories in GROMACS David van der Spoel What does MD produce? Energy terms E(t) Coordinates x(t) Velocities v(t) Forces f(t) Managing your files trjcat - merging trajectories concatenating

More information

Insights on Antibiotic Translocation : Molecular Dynamics Simulations

Insights on Antibiotic Translocation : Molecular Dynamics Simulations I Insights on Antibiotic Translocation : Molecular Dynamics Simulations Amit Kumar, Eric Hajjar,Enrico Spiga, Francesa Collu, Paolo Ruggerone & Matteo Ceccarelli Marseille : 11 04 2008 Outline METHODS

More information

Supplementary Materials for

Supplementary Materials for www.advances.sciencemag.org/cgi/content/full/1/7/e1500263/dc1 Supplementary Materials for Newton s cradle proton relay with amide imidic acid tautomerization in inverting cellulase visualized by neutron

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/309/5742/1868/dc1 Supporting Online Material for Toward High-Resolution de Novo Structure Prediction for Small Proteins Philip Bradley, Kira M. S. Misura, David Baker*

More information

Unfolding CspB by means of biased molecular dynamics

Unfolding CspB by means of biased molecular dynamics Chapter 4 Unfolding CspB by means of biased molecular dynamics 4.1 Introduction Understanding the mechanism of protein folding has been a major challenge for the last twenty years, as pointed out in the

More information

ψ j φ j+1 Motif position

ψ j φ j+1 Motif position 1.0 % Occupancy 0.8 0.6 0.4 0.2 0.0 ψ i-1 φ i ψ j φ j+1 ψ k-1 Motif position φ Supplementary Figure 1 Residue profiles for the positions in the β-sheet motif. Residue types as percentages for the six positions

More information

Energetics and Dynamics of the Non-Natural Fluorescent 4AP:DAP Base pair

Energetics and Dynamics of the Non-Natural Fluorescent 4AP:DAP Base pair Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2018 Energetics and Dynamics of the Non-Natural Fluorescent 4AP:DAP Base pair Mohit

More information

A: Up regulated proteins B: Down regulated proteins. Susceptible Resistant Susceptible Resistant Resistant Susceptible

A: Up regulated proteins B: Down regulated proteins. Susceptible Resistant Susceptible Resistant Resistant Susceptible Supplementary Materials: Identification of Biomarkers for Resistance to Fusarium oxysporum f. sp. cubense Infection and in Silico Studies in Musa paradisiaca Cultivar Puttabale through Proteomic Approach

More information

Modeling for 3D structure prediction

Modeling for 3D structure prediction Modeling for 3D structure prediction What is a predicted structure? A structure that is constructed using as the sole source of information data obtained from computer based data-mining. However, mixing

More information

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

More information

Energetics of Ion Permeation in an Open-Activated TRPV1 Channel

Energetics of Ion Permeation in an Open-Activated TRPV1 Channel Biophysical Journal, Volume 111 Supplemental Information Energetics of Ion Permeation in an Open-Activated TRPV1 Channel Christian Jorgensen, Simone Furini, and Carmen Domene Supporting Material Energetics

More information

Supplementary Information

Supplementary Information Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Supplementary Information Dynamics of the thumb-finger regions in GH11 xylanase Bacillus circulans:

More information

Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2

Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2 Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell

More information

Protein Structure Prediction, Engineering & Design CHEM 430

Protein Structure Prediction, Engineering & Design CHEM 430 Protein Structure Prediction, Engineering & Design CHEM 430 Eero Saarinen The free energy surface of a protein Protein Structure Prediction & Design Full Protein Structure from Sequence - High Alignment

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved

More information

Supplementary information for:

Supplementary information for: SUPPLEMETARY IFRMATI Supplementary information for: Structure of a β 1 -adrenergic G protein-coupled receptor Tony Warne, Maria J. Serrano-Vega, Jillian G. Baker#, Rouslan Moukhametzianov, Patricia C.

More information

Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein

Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08

More information

Computational Modeling of Protein Kinase A and Comparison with Nuclear Magnetic Resonance Data

Computational Modeling of Protein Kinase A and Comparison with Nuclear Magnetic Resonance Data Computational Modeling of Protein Kinase A and Comparison with Nuclear Magnetic Resonance Data ABSTRACT Keyword Lei Shi 1 Advisor: Gianluigi Veglia 1,2 Department of Chemistry 1, & Biochemistry, Molecular

More information

THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN

THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina

More information

Supplementary Figure 1. Biochemical and sequence alignment analyses the

Supplementary Figure 1. Biochemical and sequence alignment analyses the Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).

More information

Supplementary Figures. Measuring Similarity Between Dynamic Ensembles of Biomolecules

Supplementary Figures. Measuring Similarity Between Dynamic Ensembles of Biomolecules Supplementary Figures Measuring Similarity Between Dynamic Ensembles of Biomolecules Shan Yang, Loïc Salmon 2, and Hashim M. Al-Hashimi 3*. Department of Chemistry, University of Michigan, Ann Arbor, MI,

More information

The Effect of Linker DNA on the Structure and Interaction of Nucleosome Core Particles

The Effect of Linker DNA on the Structure and Interaction of Nucleosome Core Particles Electronic Supplementary Material (ESI) for Soft Matter. This journal is The Royal Society of Chemistry 2018 SUPPLEMENTARY INFORMATION The Effect of Linker DNA on the Structure and Interaction of Nucleosome

More information

of the Guanine Nucleotide Exchange Factor FARP2

of the Guanine Nucleotide Exchange Factor FARP2 Structure, Volume 21 Supplemental Information Structural Basis for Autoinhibition of the Guanine Nucleotide Exchange Factor FARP2 Xiaojing He, Yi-Chun Kuo, Tyler J. Rosche, and Xuewu Zhang Inventory of

More information

Time-dependence of key H-bond/electrostatic interaction distances in the sirna5-hago2 complexes... Page S14

Time-dependence of key H-bond/electrostatic interaction distances in the sirna5-hago2 complexes... Page S14 Supporting Information Probing the Binding Interactions between Chemically Modified sirnas and Human Argonaute 2 Using Microsecond Molecular Dynamics Simulations S. Harikrishna* and P. I. Pradeepkumar*

More information

Structural characterization of NiV N 0 P in solution and in crystal.

Structural characterization of NiV N 0 P in solution and in crystal. Supplementary Figure 1 Structural characterization of NiV N 0 P in solution and in crystal. (a) SAXS analysis of the N 32-383 0 -P 50 complex. The Guinier plot for complex concentrations of 0.55, 1.1,

More information

Destruction of Amyloid Fibrils by Graphene through Penetration and Extraction of Peptides

Destruction of Amyloid Fibrils by Graphene through Penetration and Extraction of Peptides Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2015 Destruction of Amyloid Fibrils by Graphene through Penetration and Extraction of Peptides Zaixing

More information

Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli

Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits AhpC and AhpF from Escherichia coli Phat Vinh Dip 1,#, Neelagandan Kamariah 2,#, Malathy Sony Subramanian Manimekalai

More information

Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases

Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3

More information

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small

More information

CONFORMATIONAL SEARCH OF PROTEINS AND PROTEIN LOOPS

CONFORMATIONAL SEARCH OF PROTEINS AND PROTEIN LOOPS CONFORMATIONAL SEARCH OF PROTEINS AND PROTEIN LOOPS By Ranjitha Venkataramani Submitted to the Department of Chemistry and the Faculty of the Graduate School of the University of Kansas in partial fulfillment

More information

Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)

Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer

More information

Type II Kinase Inhibitors Show an Unexpected Inhibition Mode against Parkinson s Disease-Linked LRRK2 Mutant G2019S.

Type II Kinase Inhibitors Show an Unexpected Inhibition Mode against Parkinson s Disease-Linked LRRK2 Mutant G2019S. Type II Kinase Inhibitors Show an Unexpected Inhibition Mode against Parkinson s Disease-Linked LRRK2 Mutant G219S. Min Liu@&*, Samantha A. Bender%*, Gregory D Cuny@, Woody Sherman, Marcie Glicksman@ Soumya

More information

SUPPLEMENTARY FIGURES. Figure S1

SUPPLEMENTARY FIGURES. Figure S1 SUPPLEMENTARY FIGURES Figure S1 The substrate for DH domain (2R,3R,4R,6R,7S,8S,9R)-3,7,9-trihydroxy-5-oxo-2,4,6,8 tetramethylundecanoate) was docked as two separate fragments shown in magenta and blue

More information

This document is downloaded from DR-NTU, Nanyang Technological University Library, Singapore.

This document is downloaded from DR-NTU, Nanyang Technological University Library, Singapore. This document is downloaded from DR-NTU, Nanyang Technological University Library, Singapore. Title Author(s) Citation Coarse-Grained Molecular Modeling of the Solution Structure Ensemble of Dengue Virus

More information

Structure Investigation of Fam20C, a Golgi Casein Kinase

Structure Investigation of Fam20C, a Golgi Casein Kinase Structure Investigation of Fam20C, a Golgi Casein Kinase Sharon Grubner National Taiwan University, Dr. Jung-Hsin Lin University of California San Diego, Dr. Rommie Amaro Abstract This research project

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 28 Electronic Supplementary Information ph-dependent Cooperativity and Existence of

More information

Essential dynamics sampling of proteins. Tuorial 6 Neva Bešker

Essential dynamics sampling of proteins. Tuorial 6 Neva Bešker Essential dynamics sampling of proteins Tuorial 6 Neva Bešker Relevant time scale Why we need enhanced sampling? Interconvertion between basins is infrequent at the roomtemperature: kinetics and thermodynamics

More information

Supplementary Information: Table S1. Potential energy and essential dynamics (ED) analysis of the MD simulations of the Bcl-2 complexes under study.

Supplementary Information: Table S1. Potential energy and essential dynamics (ED) analysis of the MD simulations of the Bcl-2 complexes under study. Supplementary Information: Table S1. Potential energy and essential dynamics (ED) analysis of the MD simulations of the Bcl-2 complexes under study. Bcl2 and complex Potential energy (kj/mol) ED 2D projection

More information

Improving De novo Protein Structure Prediction using Contact Maps Information

Improving De novo Protein Structure Prediction using Contact Maps Information CIBCB 2017 IEEE Conference on Computational Intelligence in Bioinformatics and Computational Biology Improving De novo Protein Structure Prediction using Contact Maps Information Karina Baptista dos Santos

More information

An engineered scorpion toxin analogue with improved Kv1.3 selectivity displays reduced conformational flexibility

An engineered scorpion toxin analogue with improved Kv1.3 selectivity displays reduced conformational flexibility An engineered scorpion toxin analogue with improved Kv1.3 selectivity displays reduced conformational flexibility Adam Bartok a,#, Krisztina Fehér b,c,#,, Andrea Bodor d, Kinga Rákosi e, Gábor K. Tóth

More information

What makes a good graphene-binding peptide? Adsorption of amino acids and peptides at aqueous graphene interfaces: Electronic Supplementary

What makes a good graphene-binding peptide? Adsorption of amino acids and peptides at aqueous graphene interfaces: Electronic Supplementary Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 21 What makes a good graphene-binding peptide? Adsorption of amino acids and

More information

Supplemental Data SUPPLEMENTAL FIGURES

Supplemental Data SUPPLEMENTAL FIGURES Supplemental Data CRYSTAL STRUCTURE OF THE MG.ADP-INHIBITED STATE OF THE YEAST F 1 C 10 ATP SYNTHASE Alain Dautant*, Jean Velours and Marie-France Giraud* From Université Bordeaux 2, CNRS; Institut de

More information

Improving Protein Function Prediction with Molecular Dynamics Simulations. Dariya Glazer Russ Altman

Improving Protein Function Prediction with Molecular Dynamics Simulations. Dariya Glazer Russ Altman Improving Protein Function Prediction with Molecular Dynamics Simulations Dariya Glazer Russ Altman Motivation Sometimes the 3D structure doesn t score well for a known function. The experimental structure

More information

Full wwpdb X-ray Structure Validation Report i

Full wwpdb X-ray Structure Validation Report i Full wwpdb X-ray Structure Validation Report i Mar 14, 2018 02:00 pm GMT PDB ID : 3RRQ Title : Crystal structure of the extracellular domain of human PD-1 Authors : Lazar-Molnar, E.; Ramagopal, U.A.; Nathenson,

More information

Lipid Regulated Intramolecular Conformational Dynamics of SNARE-Protein Ykt6

Lipid Regulated Intramolecular Conformational Dynamics of SNARE-Protein Ykt6 Supplementary Information for: Lipid Regulated Intramolecular Conformational Dynamics of SNARE-Protein Ykt6 Yawei Dai 1, 2, Markus Seeger 3, Jingwei Weng 4, Song Song 1, 2, Wenning Wang 4, Yan-Wen 1, 2,

More information

Cks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved

Cks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved Cks1 d CKS1 Supplementary Figure 1 The -Cks1 crystal lattice. (a) Schematic of the - Cks1 crystal lattice. -Cks1 crystallizes in a lattice that contains c 4 copies of the t - Cks1 dimer in the crystallographic

More information

Stabilizing the CH2 domain of an Antibody by Engineering in an Enhanced Aromatic Sequon

Stabilizing the CH2 domain of an Antibody by Engineering in an Enhanced Aromatic Sequon Stabilizing the CH2 domain of an Antibody by Engineering in an Enhanced Aromatic Sequon Wentao Chen,, Leopold Kong, Stephen Connelly, Julia M. Dendle,, Yu Liu,, Ian A. Wilson,#, Evan T. Powers, *, Jeffery

More information

Structurale, Université Grenoble Alpes, CNRS, CEA, Grenoble, France

Structurale, Université Grenoble Alpes, CNRS, CEA, Grenoble, France Supplementary Information to Lysine relay mechanism coordinates intermediate transfer in vitamin B6 biosynthesis Matthew J. Rodrigues 1,2, Volker Windeisen 1,3, Yang Zhang 4, Gabriela Guédez 3, Stefan

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2018 Electronic Supplementary Information Temperature dependence of dynamic, tunnelling

More information

PROTEIN STRUCTURE PREDICTION USING GAS PHASE MOLECULAR DYNAMICS SIMULATION: EOTAXIN-3 CYTOKINE AS A CASE STUDY

PROTEIN STRUCTURE PREDICTION USING GAS PHASE MOLECULAR DYNAMICS SIMULATION: EOTAXIN-3 CYTOKINE AS A CASE STUDY International Conference Mathematical and Computational Biology 2011 International Journal of Modern Physics: Conference Series Vol. 9 (2012) 193 198 World Scientific Publishing Company DOI: 10.1142/S2010194512005259

More information

Supporting Information

Supporting Information Supporting Information The Predicted Ensemble of Low-Energy Conformations of Human Somatostatin Receptor Subtype 5 and the Binding of Antagonists Sijia S. Dong, [a] Ravinder Abrol, [a, b] and William A.

More information

Docking. GBCB 5874: Problem Solving in GBCB

Docking. GBCB 5874: Problem Solving in GBCB Docking Benzamidine Docking to Trypsin Relationship to Drug Design Ligand-based design QSAR Pharmacophore modeling Can be done without 3-D structure of protein Receptor/Structure-based design Molecular

More information

Summary of Experimental Protein Structure Determination. Key Elements

Summary of Experimental Protein Structure Determination. Key Elements Programme 8.00-8.20 Summary of last week s lecture and quiz 8.20-9.00 Structure validation 9.00-9.15 Break 9.15-11.00 Exercise: Structure validation tutorial 11.00-11.10 Break 11.10-11.40 Summary & discussion

More information

Molecular Mechanism for Conformational Dynamics of Ras GTP Elucidated from In-Situ Structural Transition in Crystal

Molecular Mechanism for Conformational Dynamics of Ras GTP Elucidated from In-Situ Structural Transition in Crystal Molecular Mechanism for Conformational Dynamics of Ras GTP Elucidated from In-Situ Structural Transition in Crystal Shigeyuki Matsumoto, Nao Miyano, Seiki Baba, Jingling Liao, Takashi Kawamura, Chiemi

More information

Goals. Structural Analysis of the EGR Family of Transcription Factors: Templates for Predicting Protein DNA Interactions

Goals. Structural Analysis of the EGR Family of Transcription Factors: Templates for Predicting Protein DNA Interactions Structural Analysis of the EGR Family of Transcription Factors: Templates for Predicting Protein DNA Interactions Jamie Duke 1,2 and Carlos Camacho 3 1 Bioengineering and Bioinformatics Summer Institute,

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting

More information

Cationic carbosilane dendrimers and oligonucleotide binding: an energetic affair

Cationic carbosilane dendrimers and oligonucleotide binding: an energetic affair Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2014 Supporting information Cationic carbosilane dendrimers and oligonucleotide binding: an energetic

More information

Probing Molecular Mechanisms Of the Hsp90 Chaperone: Biophysical Modeling Identifies Key Regulators Of Functional Dynamics

Probing Molecular Mechanisms Of the Hsp90 Chaperone: Biophysical Modeling Identifies Key Regulators Of Functional Dynamics Chapman University Chapman University Digital Commons Mathematics, Physics, and Computer Science Faculty Articles and Research Science and Technology Faculty Articles and Research 2012 Probing Molecular

More information

Table S1 Crystallographic data and structure refinement for complexes 1 and 2. Complex H 2 O

Table S1 Crystallographic data and structure refinement for complexes 1 and 2. Complex H 2 O Electronic Supplementary Information: Ternary oxovanadium(iv) complexes of ONO-donor Schiff base and polypyridyl derivatives as protein tyrosine phosphatase inhibitors: synthesis, characterization and

More information