Computational engineering of cellulase Cel9A-68 functional motions through mutations in its linker region. WT 1TF4 (crystal) -90 ERRAT PROVE VERIFY3D
|
|
- Laurel Smith
- 5 years ago
- Views:
Transcription
1 Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 218 Supplementary Material: Computational engineering of cellulase Cel9-68 functional motions through mutations in its linker region M. G. S. Costa, a Y. F. Silva a and P. R. atista* a a. Programa de Computação Científica (PROCC), Fundação Oswaldo Cruz, Rio de Janeiro, razil. pbatista@fiocruz.br Fig. S1. 1TF4 (crystal) G46P General Glycine General Glycine Proline -9 9 Pre-Proline -9 9 Proline -9 9 Pre-Proline Overall quality factor: Overall quality factor: % of buried protein atoms are outliers 3.9 % of buried protein atoms are outliers 97.19% of the residues had an averaged 3D-1D score >= % of the residues had an averaged 3D-1D score >=.2 G46+ Overall quality factor: % of buried protein atoms are outliers 97.64% of the residues had an averaged 3D-1D score >=.2 Overall quality factor: % of buried protein atoms are outliers 97.98% of the residues had an averaged 3D-1D score >=.2 Fig.S1 Validation of the models. The Ramachandran plots and the results returned by, and VERIFY 3D are given for each system considered in this work, including the crystallographic Cel9-68 structure (PD ID: 1TF4).
2 Fig. S2. cum. contribu,on (%) collec,vity G46P G mode # C D RMSF (Å) Δ RMSF (Å) CD residue # linker CM G46P - G Fig.S2 Normal mode analysis of Cel9-68 variants. In, cumulative contribution of the first ten low-frequency normal modes to the overall atomic fluctuations. In, Collectivity of motions described by low frequency modes. In C, absolute fluctuations per residue. In D, relative fluctuations (taking as reference) per mode coloured as indicated in the legend. The Cel9-68 domain definitions are indicated above the plot. Fig. S3. G46+ G46P run 1 run 2 run 3 Fig.S3 Time evolution of backbone RMSD per replica. The simulated systems are identified above each plot and the results obtained for each independent run are coloured as indicated in the legend.
3 Fig. S4. G46P G46+ run 1 run 2 run 3 radius of gyra7on (Å) distance between domains (Å) Time (ns) Fig.S4 Time evolution of the interdomain distances (in ) and the radius of gyration of Cel9-68 (in ), per replica, along the MD simulations. The simulated systems are identified above each plot and the results obtained for each independent run are coloured as indicated in the legend. Fig. S5. Fig.S5 Distribution of RMSD distances for all pairs of conformations obtained in the concatenated trajectories for each simulated system. Coloured as indicated in the legend.
4 Fig. S6. mode 7 mode 8 mode 9 Fig.S6 Results of population analysis based on projections of the conformations sampled during explicit solvent MD onto the three low-frequency normal modes calculated for the system (top) or (bottom). Coloured as indicated in the legend.
5 Captions of supplementary movies Supplementary movie 1: Displacements along normal mode 7 calculated for the Cel9-68 wild type system. Each structural domain was differentially coloured as in Figure 1: catalytic domain (red), linker (cyan) and carbohydrate binding module (green). Supplementary movie 2: Displacements along normal mode 8 calculated for the Cel9-68 wild type system. The protein is coloured as in supplementary movie 1. Supplementary movie 3: Displacements along normal mode 9 calculated for the Cel9-68 wild type system. The protein is coloured as in supplementary movie 1. Supplementary movie 4: Differences between the lowest frequency normal mode calculated for the and systems (related to Figure 3). The Cel9-68 structural domains are indicated in the left part of the video. Different colouring of the CM was applied to highlight the conformational states reached after displacements along each sense of the lowest frequency modes.
Insights into the Biotransformation of 2,4,6- Trinitrotoluene by the Old Yellow Enzyme Family of Flavoproteins. A Computational Study
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2019 Supporting Information for Insights into the Biotransformation of 2,4,6- Trinitrotoluene
More informationSupplementary Information
Supplementary Information Resveratrol Serves as a Protein-Substrate Interaction Stabilizer in Human SIRT1 Activation Xuben Hou,, David Rooklin, Hao Fang *,,, Yingkai Zhang Department of Medicinal Chemistry
More informationSupporting Information
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2016 Supporting Information Lipid molecules can induce an opening of membrane-facing
More informationSupporting Information How does Darunavir prevent HIV-1 protease dimerization?
Supporting Information How does Darunavir prevent HIV- protease dimerization? Danzhi Huang and Amedeo Caflisch a Department of Biochemistry University of Zürich, Winterthurerstrasse 9 CH-7 Zürich, Switzerland
More informationStructural and mechanistic insight into the substrate. binding from the conformational dynamics in apo. and substrate-bound DapE enzyme
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 215 Structural and mechanistic insight into the substrate binding from the conformational
More informationExperimental and Computational Mutagenesis to Investigate the. Positioning of a General Base within an Enzyme Active Site
Experimental and Computational Mutagenesis to Investigate the Positioning of a General Base within an Enzyme Active Site Jason P. Schwans, Philip Hanoian, Benjamin J. Lengerich, Fanny Sunden, Ana Gonzalez
More informationT H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp
S u p p l e m e n ta l m at e r i a l jgp Lee et al., http://www.jgp.org/cgi/content/full/jgp.201411219/dc1 T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y S u p p l e m e n ta l D I S C U S
More informationSupporting information for: Mechanism of lignin inhibition of enzymatic. biomass deconstruction
Supporting information for: Mechanism of lignin inhibition of enzymatic biomass deconstruction Josh V. Vermaas,, Loukas Petridis, Xianghong Qi,, Roland Schulz,, Benjamin Lindner, and Jeremy C. Smith,,
More informationMechanism of water/ion exchange at a protein surface: a weakly bound chloride in Helicobacter pylori apoflavodoxin.
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 25 ELECTRONIC SUPPLEMENTARY INFORMATION Mechanism of water/ion exchange at a protein
More informationIgE binds asymmetrically to its B cell receptor CD23
Supplementary Information IgE binds asymmetrically to its B cell receptor CD23 Balvinder Dhaliwal 1*, Marie O. Y. Pang 2, Anthony H. Keeble 2,3, Louisa K. James 2,4, Hannah J. Gould 2, James M. McDonnell
More informationStructural basis for catalytically restrictive dynamics of a high-energy enzyme state
Supplementary Material Structural basis for catalytically restrictive dynamics of a high-energy enzyme state Michael Kovermann, Jörgen Ådén, Christin Grundström, A. Elisabeth Sauer-Eriksson, Uwe H. Sauer
More informationAssessing the potential of atomistic molecular dynamics simulations to probe reversible. protein-protein recognition and binding
Supporting information for Assessing the potential of atomistic molecular dynamics simulations to probe reversible protein-protein recognition and binding Luciano A. Abriata and Matteo Dal Peraro Laboratory
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),
More informationTable S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
More informationTu 1,*, , Sweden
Supplementary Material Computational studiess of the binding profile of phosphoinositide PtdIns(,4,5)P with the pleckstrin homology domain d of an oomycetee cellulose synthase Guanglin Kuang 1, Vincent
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier
More informationSupporting Information
Supporting Information Critical role of inter-domain interactions on the conformational change and catalytic mechanism of Endoplasmic Reticulum Aminopeptidase 1 Athanasios Stamogiannos 1, Zachary Maben
More informationEnhancing Specificity in the Janus Kinases: A Study on the Thienopyridine. JAK2 Selective Mechanism Combined Molecular Dynamics Simulation
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Supporting Information Enhancing Specificity in the Janus Kinases: A Study on the Thienopyridine
More informationNB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5
SUPPLEMENTARY TABLES Suppl. Table 1. Protonation states at ph 7.4 and 4.5. Protonation states of titratable residues in GCase at ph 7.4 and 4.5. Histidine: HID, H at δ-nitrogen; HIE, H at ε-nitrogen; HIP,
More informationCarbazole Derivatives Binding to c-kit G-quadruplex DNA
Supplementary Materials Carbazole Derivatives Binding to c-kit G-quadruplex DNA Agata Głuszyńska 1, *, Bernard Juskowiak 1, Martyna Kuta-Siejkowska 2, Marcin Hoffmann 2 and Shozeb Haider 3 1 Laboratory
More informationNature Structural and Molecular Biology: doi: /nsmb.2938
Supplementary Figure 1 Characterization of designed leucine-rich-repeat proteins. (a) Water-mediate hydrogen-bond network is frequently visible in the convex region of LRR crystal structures. Examples
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1737 Supplementary Table 1 variant Description FSEC - 2B12 a FSEC - 6A1 a K d (leucine) c Leucine uptake e K (wild-type like) K (Y18F) K (TS) K (TSY) K288A mutant, lipid facing side chain
More informationSupplementary information for cloud computing approaches for prediction of ligand binding poses and pathways
Supplementary information for cloud computing approaches for prediction of ligand binding poses and pathways Morgan Lawrenz 1, Diwakar Shukla 1,2 & Vijay S. Pande 1,2 1 Department of Chemistry, Stanford
More informationElectro-Mechanical Conductance Modulation of a Nanopore Using a Removable Gate
Electro-Mechanical Conductance Modulation of a Nanopore Using a Removable Gate Shidi Zhao a, Laura Restrepo-Pérez b, Misha Soskine c, Giovanni Maglia c, Chirlmin Joo b, Cees Dekker b and Aleksei Aksimentiev
More informationA dynamic interaction process between KaiA and KaiC is critical to
A dynamic interaction process between KaiA and KaiC is critical to the cyanobacterial circadian oscillator Pei Dong 1,2, Ying Fan 2, Jianqiang Sun 3, Mengting Lv 2, Ming Yi 4, Xiao Tan 1,2, Sen Liu 1,2,*
More informationSUPPLEMENTARY INFORMATION
Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3
More informationSupporting Information. Accurate prediction of the structure and vibrational spectra of ionic
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2018 Supporting Information Accurate prediction of the structure and vibrational spectra
More informationFW 1 CDR 1 FW 2 CDR 2
Supplementary Figure 1 Supplementary Figure 1: Interface of the E9:Fas structure. The two interfaces formed by V H and V L of E9 with Fas are shown in stereo. The Fas receptor is represented as a surface
More informationStructural Insights from Molecular Dynamics. Simulations of Tryptophan 7-Halogenase and
Supporting Information Structural Insights from Molecular Dynamics Simulations of Tryptophan 7-Halogenase and Tryptophan 5-halogenase Jon Ainsley 1, Adrian J. Mulholland 2, Gary W. Black 1, Olivier Sparagano
More informationSUPPLEMENTARY INFORMATION
Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase
More informationL718Q mutant EGFR escapes covalent inhibition by stabilizing. a non-reactive conformation of the lung cancer drug. osimertinib
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information (ESI) for L718Q mutant EGFR escapes covalent inhibition
More informationStructural basis of PROTAC cooperative recognition for selective protein degradation
SUPPLEMENTARY INFORMATION Structural basis of PROTAC cooperative recognition for selective protein degradation Morgan S. Gadd 1, Andrea Testa 1, Xavier Lucas 1, Kwok-Ho Chan, Wenzhang Chen, Douglas J.
More informationHOMOLOGY MODELING. The sequence alignment and template structure are then used to produce a structural model of the target.
HOMOLOGY MODELING Homology modeling, also known as comparative modeling of protein refers to constructing an atomic-resolution model of the "target" protein from its amino acid sequence and an experimental
More informationA conserved P-loop anchor limits the structural dynamics that mediate. nucleotide dissociation in EF-Tu.
Supplemental Material for A conserved P-loop anchor limits the structural dynamics that mediate nucleotide dissociation in EF-Tu. Evan Mercier 1,2, Dylan Girodat 1, and Hans-Joachim Wieden 1 * 1 Alberta
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the
More informationβ 2 -microglobulin fibrillation?
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2014 Can small hydrophobic gold nanoparticles inhibit β 2 -microglobulin fibrillation? G. Brancolini,,
More informationSupporting Information
Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,
More informationIntrinsic Dynamics of Restriction Endonuclease EcoO109I Studied by Molecular Dynamics Simulations and X-Ray Scattering Data Analysis
2808 Biophysical Journal Volume 96 April 2009 2808 2822 Intrinsic Dynamics of Restriction Endonuclease EcoO109I Studied by Molecular Dynamics Simulations and X-Ray Scattering Data Analysis Tomotaka Oroguchi,
More informationEnsemble refinement of protein crystal structures in PHENIX. Tom Burnley Piet Gros
Ensemble refinement of protein crystal structures in PHENIX Tom Burnley Piet Gros Incomplete modelling of disorder contributes to R factor gap Only ~5% of residues in the PDB are modelled with more than
More informationRelative binding enthalpies from molecular dynamics simulations. using a direct method
Relative binding enthalpies from molecular dynamics simulations using a direct method Amitava Roy, 1 Duy P. Hua, 1 Joshua M. Ward, 1 and Carol Beth Post* Department of Medicinal Chemistry, Markey Center
More informationSUPPLEMENTARY MATERIAL. Supplementary material and methods:
Electronic Supplementary Material (ESI) for Catalysis Science & Technology. This journal is The Royal Society of Chemistry 2015 SUPPLEMENTARY MATERIAL Supplementary material and methods: - Computational
More informationAnalysis of MD trajectories in GROMACS David van der Spoel
Analysis of MD trajectories in GROMACS David van der Spoel What does MD produce? Energy terms E(t) Coordinates x(t) Velocities v(t) Forces f(t) Managing your files trjcat - merging trajectories concatenating
More informationInsights on Antibiotic Translocation : Molecular Dynamics Simulations
I Insights on Antibiotic Translocation : Molecular Dynamics Simulations Amit Kumar, Eric Hajjar,Enrico Spiga, Francesa Collu, Paolo Ruggerone & Matteo Ceccarelli Marseille : 11 04 2008 Outline METHODS
More informationSupplementary Materials for
www.advances.sciencemag.org/cgi/content/full/1/7/e1500263/dc1 Supplementary Materials for Newton s cradle proton relay with amide imidic acid tautomerization in inverting cellulase visualized by neutron
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/309/5742/1868/dc1 Supporting Online Material for Toward High-Resolution de Novo Structure Prediction for Small Proteins Philip Bradley, Kira M. S. Misura, David Baker*
More informationUnfolding CspB by means of biased molecular dynamics
Chapter 4 Unfolding CspB by means of biased molecular dynamics 4.1 Introduction Understanding the mechanism of protein folding has been a major challenge for the last twenty years, as pointed out in the
More informationψ j φ j+1 Motif position
1.0 % Occupancy 0.8 0.6 0.4 0.2 0.0 ψ i-1 φ i ψ j φ j+1 ψ k-1 Motif position φ Supplementary Figure 1 Residue profiles for the positions in the β-sheet motif. Residue types as percentages for the six positions
More informationEnergetics and Dynamics of the Non-Natural Fluorescent 4AP:DAP Base pair
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2018 Energetics and Dynamics of the Non-Natural Fluorescent 4AP:DAP Base pair Mohit
More informationA: Up regulated proteins B: Down regulated proteins. Susceptible Resistant Susceptible Resistant Resistant Susceptible
Supplementary Materials: Identification of Biomarkers for Resistance to Fusarium oxysporum f. sp. cubense Infection and in Silico Studies in Musa paradisiaca Cultivar Puttabale through Proteomic Approach
More informationModeling for 3D structure prediction
Modeling for 3D structure prediction What is a predicted structure? A structure that is constructed using as the sole source of information data obtained from computer based data-mining. However, mixing
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationEnergetics of Ion Permeation in an Open-Activated TRPV1 Channel
Biophysical Journal, Volume 111 Supplemental Information Energetics of Ion Permeation in an Open-Activated TRPV1 Channel Christian Jorgensen, Simone Furini, and Carmen Domene Supporting Material Energetics
More informationSupplementary Information
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Supplementary Information Dynamics of the thumb-finger regions in GH11 xylanase Bacillus circulans:
More informationTable 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2
Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell
More informationProtein Structure Prediction, Engineering & Design CHEM 430
Protein Structure Prediction, Engineering & Design CHEM 430 Eero Saarinen The free energy surface of a protein Protein Structure Prediction & Design Full Protein Structure from Sequence - High Alignment
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
More informationSupplementary information for:
SUPPLEMETARY IFRMATI Supplementary information for: Structure of a β 1 -adrenergic G protein-coupled receptor Tony Warne, Maria J. Serrano-Vega, Jillian G. Baker#, Rouslan Moukhametzianov, Patricia C.
More informationNitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein
Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08
More informationComputational Modeling of Protein Kinase A and Comparison with Nuclear Magnetic Resonance Data
Computational Modeling of Protein Kinase A and Comparison with Nuclear Magnetic Resonance Data ABSTRACT Keyword Lei Shi 1 Advisor: Gianluigi Veglia 1,2 Department of Chemistry 1, & Biochemistry, Molecular
More informationTHE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina
More informationSupplementary Figure 1. Biochemical and sequence alignment analyses the
Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).
More informationSupplementary Figures. Measuring Similarity Between Dynamic Ensembles of Biomolecules
Supplementary Figures Measuring Similarity Between Dynamic Ensembles of Biomolecules Shan Yang, Loïc Salmon 2, and Hashim M. Al-Hashimi 3*. Department of Chemistry, University of Michigan, Ann Arbor, MI,
More informationThe Effect of Linker DNA on the Structure and Interaction of Nucleosome Core Particles
Electronic Supplementary Material (ESI) for Soft Matter. This journal is The Royal Society of Chemistry 2018 SUPPLEMENTARY INFORMATION The Effect of Linker DNA on the Structure and Interaction of Nucleosome
More informationof the Guanine Nucleotide Exchange Factor FARP2
Structure, Volume 21 Supplemental Information Structural Basis for Autoinhibition of the Guanine Nucleotide Exchange Factor FARP2 Xiaojing He, Yi-Chun Kuo, Tyler J. Rosche, and Xuewu Zhang Inventory of
More informationTime-dependence of key H-bond/electrostatic interaction distances in the sirna5-hago2 complexes... Page S14
Supporting Information Probing the Binding Interactions between Chemically Modified sirnas and Human Argonaute 2 Using Microsecond Molecular Dynamics Simulations S. Harikrishna* and P. I. Pradeepkumar*
More informationStructural characterization of NiV N 0 P in solution and in crystal.
Supplementary Figure 1 Structural characterization of NiV N 0 P in solution and in crystal. (a) SAXS analysis of the N 32-383 0 -P 50 complex. The Guinier plot for complex concentrations of 0.55, 1.1,
More informationDestruction of Amyloid Fibrils by Graphene through Penetration and Extraction of Peptides
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2015 Destruction of Amyloid Fibrils by Graphene through Penetration and Extraction of Peptides Zaixing
More informationStructure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits AhpC and AhpF from Escherichia coli Phat Vinh Dip 1,#, Neelagandan Kamariah 2,#, Malathy Sony Subramanian Manimekalai
More informationSupplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases
Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3
More informationProtein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.
Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small
More informationCONFORMATIONAL SEARCH OF PROTEINS AND PROTEIN LOOPS
CONFORMATIONAL SEARCH OF PROTEINS AND PROTEIN LOOPS By Ranjitha Venkataramani Submitted to the Department of Chemistry and the Faculty of the Graduate School of the University of Kansas in partial fulfillment
More informationSupplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer
More informationType II Kinase Inhibitors Show an Unexpected Inhibition Mode against Parkinson s Disease-Linked LRRK2 Mutant G2019S.
Type II Kinase Inhibitors Show an Unexpected Inhibition Mode against Parkinson s Disease-Linked LRRK2 Mutant G219S. Min Liu@&*, Samantha A. Bender%*, Gregory D Cuny@, Woody Sherman, Marcie Glicksman@ Soumya
More informationSUPPLEMENTARY FIGURES. Figure S1
SUPPLEMENTARY FIGURES Figure S1 The substrate for DH domain (2R,3R,4R,6R,7S,8S,9R)-3,7,9-trihydroxy-5-oxo-2,4,6,8 tetramethylundecanoate) was docked as two separate fragments shown in magenta and blue
More informationThis document is downloaded from DR-NTU, Nanyang Technological University Library, Singapore.
This document is downloaded from DR-NTU, Nanyang Technological University Library, Singapore. Title Author(s) Citation Coarse-Grained Molecular Modeling of the Solution Structure Ensemble of Dengue Virus
More informationStructure Investigation of Fam20C, a Golgi Casein Kinase
Structure Investigation of Fam20C, a Golgi Casein Kinase Sharon Grubner National Taiwan University, Dr. Jung-Hsin Lin University of California San Diego, Dr. Rommie Amaro Abstract This research project
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 28 Electronic Supplementary Information ph-dependent Cooperativity and Existence of
More informationEssential dynamics sampling of proteins. Tuorial 6 Neva Bešker
Essential dynamics sampling of proteins Tuorial 6 Neva Bešker Relevant time scale Why we need enhanced sampling? Interconvertion between basins is infrequent at the roomtemperature: kinetics and thermodynamics
More informationSupplementary Information: Table S1. Potential energy and essential dynamics (ED) analysis of the MD simulations of the Bcl-2 complexes under study.
Supplementary Information: Table S1. Potential energy and essential dynamics (ED) analysis of the MD simulations of the Bcl-2 complexes under study. Bcl2 and complex Potential energy (kj/mol) ED 2D projection
More informationImproving De novo Protein Structure Prediction using Contact Maps Information
CIBCB 2017 IEEE Conference on Computational Intelligence in Bioinformatics and Computational Biology Improving De novo Protein Structure Prediction using Contact Maps Information Karina Baptista dos Santos
More informationAn engineered scorpion toxin analogue with improved Kv1.3 selectivity displays reduced conformational flexibility
An engineered scorpion toxin analogue with improved Kv1.3 selectivity displays reduced conformational flexibility Adam Bartok a,#, Krisztina Fehér b,c,#,, Andrea Bodor d, Kinga Rákosi e, Gábor K. Tóth
More informationWhat makes a good graphene-binding peptide? Adsorption of amino acids and peptides at aqueous graphene interfaces: Electronic Supplementary
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 21 What makes a good graphene-binding peptide? Adsorption of amino acids and
More informationSupplemental Data SUPPLEMENTAL FIGURES
Supplemental Data CRYSTAL STRUCTURE OF THE MG.ADP-INHIBITED STATE OF THE YEAST F 1 C 10 ATP SYNTHASE Alain Dautant*, Jean Velours and Marie-France Giraud* From Université Bordeaux 2, CNRS; Institut de
More informationImproving Protein Function Prediction with Molecular Dynamics Simulations. Dariya Glazer Russ Altman
Improving Protein Function Prediction with Molecular Dynamics Simulations Dariya Glazer Russ Altman Motivation Sometimes the 3D structure doesn t score well for a known function. The experimental structure
More informationFull wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 14, 2018 02:00 pm GMT PDB ID : 3RRQ Title : Crystal structure of the extracellular domain of human PD-1 Authors : Lazar-Molnar, E.; Ramagopal, U.A.; Nathenson,
More informationLipid Regulated Intramolecular Conformational Dynamics of SNARE-Protein Ykt6
Supplementary Information for: Lipid Regulated Intramolecular Conformational Dynamics of SNARE-Protein Ykt6 Yawei Dai 1, 2, Markus Seeger 3, Jingwei Weng 4, Song Song 1, 2, Wenning Wang 4, Yan-Wen 1, 2,
More informationCks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved
Cks1 d CKS1 Supplementary Figure 1 The -Cks1 crystal lattice. (a) Schematic of the - Cks1 crystal lattice. -Cks1 crystallizes in a lattice that contains c 4 copies of the t - Cks1 dimer in the crystallographic
More informationStabilizing the CH2 domain of an Antibody by Engineering in an Enhanced Aromatic Sequon
Stabilizing the CH2 domain of an Antibody by Engineering in an Enhanced Aromatic Sequon Wentao Chen,, Leopold Kong, Stephen Connelly, Julia M. Dendle,, Yu Liu,, Ian A. Wilson,#, Evan T. Powers, *, Jeffery
More informationStructurale, Université Grenoble Alpes, CNRS, CEA, Grenoble, France
Supplementary Information to Lysine relay mechanism coordinates intermediate transfer in vitamin B6 biosynthesis Matthew J. Rodrigues 1,2, Volker Windeisen 1,3, Yang Zhang 4, Gabriela Guédez 3, Stefan
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2018 Electronic Supplementary Information Temperature dependence of dynamic, tunnelling
More informationPROTEIN STRUCTURE PREDICTION USING GAS PHASE MOLECULAR DYNAMICS SIMULATION: EOTAXIN-3 CYTOKINE AS A CASE STUDY
International Conference Mathematical and Computational Biology 2011 International Journal of Modern Physics: Conference Series Vol. 9 (2012) 193 198 World Scientific Publishing Company DOI: 10.1142/S2010194512005259
More informationSupporting Information
Supporting Information The Predicted Ensemble of Low-Energy Conformations of Human Somatostatin Receptor Subtype 5 and the Binding of Antagonists Sijia S. Dong, [a] Ravinder Abrol, [a, b] and William A.
More informationDocking. GBCB 5874: Problem Solving in GBCB
Docking Benzamidine Docking to Trypsin Relationship to Drug Design Ligand-based design QSAR Pharmacophore modeling Can be done without 3-D structure of protein Receptor/Structure-based design Molecular
More informationSummary of Experimental Protein Structure Determination. Key Elements
Programme 8.00-8.20 Summary of last week s lecture and quiz 8.20-9.00 Structure validation 9.00-9.15 Break 9.15-11.00 Exercise: Structure validation tutorial 11.00-11.10 Break 11.10-11.40 Summary & discussion
More informationMolecular Mechanism for Conformational Dynamics of Ras GTP Elucidated from In-Situ Structural Transition in Crystal
Molecular Mechanism for Conformational Dynamics of Ras GTP Elucidated from In-Situ Structural Transition in Crystal Shigeyuki Matsumoto, Nao Miyano, Seiki Baba, Jingling Liao, Takashi Kawamura, Chiemi
More informationGoals. Structural Analysis of the EGR Family of Transcription Factors: Templates for Predicting Protein DNA Interactions
Structural Analysis of the EGR Family of Transcription Factors: Templates for Predicting Protein DNA Interactions Jamie Duke 1,2 and Carlos Camacho 3 1 Bioengineering and Bioinformatics Summer Institute,
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting
More informationCationic carbosilane dendrimers and oligonucleotide binding: an energetic affair
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2014 Supporting information Cationic carbosilane dendrimers and oligonucleotide binding: an energetic
More informationProbing Molecular Mechanisms Of the Hsp90 Chaperone: Biophysical Modeling Identifies Key Regulators Of Functional Dynamics
Chapman University Chapman University Digital Commons Mathematics, Physics, and Computer Science Faculty Articles and Research Science and Technology Faculty Articles and Research 2012 Probing Molecular
More informationTable S1 Crystallographic data and structure refinement for complexes 1 and 2. Complex H 2 O
Electronic Supplementary Information: Ternary oxovanadium(iv) complexes of ONO-donor Schiff base and polypyridyl derivatives as protein tyrosine phosphatase inhibitors: synthesis, characterization and
More information