SUPPLEMENTARY MATERIAL. Supplementary material and methods:

Size: px
Start display at page:

Download "SUPPLEMENTARY MATERIAL. Supplementary material and methods:"

Transcription

1 Electronic Supplementary Material (ESI) for Catalysis Science & Technology. This journal is The Royal Society of Chemistry 2015 SUPPLEMENTARY MATERIAL Supplementary material and methods: - Computational details: Molecular Dynamics (MD) simulation was performed for the system CA32F1 to investigate the effect of the introduction of the large side chain of Arg162. After appropriate preparation of the system as explained in the main manuscript an orthorhombic water box with a minimum distance of 10 Å was introduced. The system was then neutralized and 150 mm NaCl added. Equilibration using the default protocol was performed followed by 20 ns NPT simulation at 300 K and 1 atm using DESMND software.58 with the PLS force field51. The temperature was regulated with the Nosé-Hoover chain thermostat59, with a relaxation time of 1.0 ps, while the pressure was controlled by the Martyna Tobias Klein barostat60 with isotropic coupling and a relaxation time of 2.0 ps. The RESPA integrator61 was employed with bonded, near, and far time steps of 2.0, 2.0, and 6.0 fs, respectively. A 9 Å cutoff is used for non-bonded interactions together with the smooth particle mesh Ewald method.62 To minimize the effects of manually introduced mutation V162AR (given the significant change in side chain size) in the model system of CA32F1 we have performed a 20 ns MD simulation. The simulation, shown to stabilize after about 5 ns (Fig. S6) contains an initial orientation of the R162 side chain, placed with Maestro software, that changes along the simulation. Initially, the CZ atom of the guanidino group is about 8 Å away from the carboxylic group of both D205 and E164, as can be seen in Fig. S7. Throughout the simulation it is seen that the loop in which both R162 and E164 are located is very flexible allowing for a diversity of possible arrangements. Two main conformations are observed: one where the R162 is interaction with E164 (between 4 to 11 ns and 13 until 15 ns) and R162 and D205 are between 6 and 11 Å away, and a second where the three amino acids are interacting from 15ns until the end of the simulation. We have selected the last configuration from the MD simulation to use in PELE calculations and have observed that also in PELE simulations this loop is very flexible and all conformations observed in MD are reproduced.

2 Supplementary Tables Table S1. Primers used for mutagenesis of the six residues of the substrate binding pocket of 3A4 laccase Primer mut f mut r mut f mut r mut f mut r RMLN RMLC 5-3 sequence GCTGCCAAAGTCGGCCCGGCGNNKCCGNNKGCCGATGCTACTCTTATCAAC GTTGATAAGAGTAGCATCGGCMNNCGGMNNCGCCGGGCCGACTTTGGCAGC CTACTGGATCCGTGCCCTTCCCNNKNNKGGGACCAGGAACTTCGACG CGTCGAAGTTCCTGGTCCCMNNMNNGGGAAGGGCACGGATCCAGTAG CTCCCCGCCACCTCCGCCGCCNNKGGCNNKCCGCACCCCTTCCACTTG CAAGTGGAAGGGGTGCGGMNNGCCMNNGGCGGCGGAGGTGGCGGGGAG CCTCTATACTTTAACGTCAAGG GGGAGGGCGTGAATGTAAGC

3 Supplementary Schemes H 3 C H Colorless phase ( A 312 ) H 3 C H CH 3 H LAC + 2 H 3 C CH 3 CH 3 H CH 3 H CH 3 H 3 C CH 3 H H 3 C H CH 3 LAC + 2 H CH 3 CH 3 CH 3 H CH 3 H CH 3 Red products ( A 512 ) H 3 C CH 3 CH 3 H 3 C CH 3 CH 3 H 3 C H CH 3 H CH 3 LAC + 2 Final product (2,6-dimethoxy-pbenzoquinone) H 3 C CH 3 Scheme S1. Reaction pathway for SA oxidation with the main oxidation intermediates as proposed by Lacki and Duvnjak (1998). Solid arrows indicate reaction steps catalyzed by laccase. Dashed arrows indicate non-enzymatic steps.

4 Supplementary Figures A B CH 3 H C H 3 C H CH 3 H 3 C CH 3 H CH 3 H 3 C H H CH 3 CH 3 D E F H 3 C H CH 3 H 3 C H CH 3 H H 3 C H CH 3 CH 3 Figure S1. Chemical structures of SA (A), DAD (B), MS (C), DMP (D), SyA (E) and MSy (F).

5 Residual Activity (%) C1H5 C2F11 C8B12 C11C1 C13E1 C14F12 C18A1 C18C11 C18D11 C30D12 3A4 Clone Figure S2. Thermostability screening assay for selected clones from library C. Initial activity and residual activity after 10 min incubation at 71 C are shown in white and striped bars, respectively. Mean values were obtained from five replicates, error bars represent standard deviations.

6 4 Library A Library CA TAI (SI 512nm) Clone 4 Library B Library CAB TAI (SI 512 nm) Clone Figure S3. Activity landscapes for mutant libraries A vs CA (A) and B vs CAB (B).

7 Figure S4. Hammett (A-C) and Marcus (D-F) plots obtained from competition reactions with different p-substituted phenols for laccase variants 3A4 (A, D), C14F12 (B, E) and CA32F1 (C, F).

8 Figure S5. PELE results for the 3A4 (A,B), C14F12 (C,D) and CA32F1 (E,F) variants conformational search of SAH (A,C,E) and SA - (B,D,F).

9 Figure S6. RMSD vs. time for MD simulation of CA32F1 Figure S7. Plot showing how the distance between R162-E164 and R162-E205 vary along the MD simulation of CA32F1.

10 Figure S8. Representative protein-substrate complexes for A) 3A4, B) C14F12 and C) CA32F1 variant with DAD. Each plot represents the best (green) and worse (yellow) position for electron transfer computed with QM/MM. Figure S9. Representative protein-substrate complexes for A) 3A4 and B) C14F12 and MS. Spin density isosurfaces shown in red and blue.

A conserved P-loop anchor limits the structural dynamics that mediate. nucleotide dissociation in EF-Tu.

A conserved P-loop anchor limits the structural dynamics that mediate. nucleotide dissociation in EF-Tu. Supplemental Material for A conserved P-loop anchor limits the structural dynamics that mediate nucleotide dissociation in EF-Tu. Evan Mercier 1,2, Dylan Girodat 1, and Hans-Joachim Wieden 1 * 1 Alberta

More information

Computational Modeling of Protein Kinase A and Comparison with Nuclear Magnetic Resonance Data

Computational Modeling of Protein Kinase A and Comparison with Nuclear Magnetic Resonance Data Computational Modeling of Protein Kinase A and Comparison with Nuclear Magnetic Resonance Data ABSTRACT Keyword Lei Shi 1 Advisor: Gianluigi Veglia 1,2 Department of Chemistry 1, & Biochemistry, Molecular

More information

Molecular Dynamics Investigation of the ω-current in the Kv1.2 Voltage Sensor Domains

Molecular Dynamics Investigation of the ω-current in the Kv1.2 Voltage Sensor Domains Molecular Dynamics Investigation of the ω-current in the Kv1.2 Voltage Sensor Domains Fatemeh Khalili-Araghi, Emad Tajkhorshid, Benoît Roux, and Klaus Schulten Department of Physics, Department of Biochemistry,

More information

Supporting Information

Supporting Information Projection of atomistic simulation data for the dynamics of entangled polymers onto the tube theory: Calculation of the segment survival probability function and comparison with modern tube models Pavlos

More information

Type II Kinase Inhibitors Show an Unexpected Inhibition Mode against Parkinson s Disease-Linked LRRK2 Mutant G2019S.

Type II Kinase Inhibitors Show an Unexpected Inhibition Mode against Parkinson s Disease-Linked LRRK2 Mutant G2019S. Type II Kinase Inhibitors Show an Unexpected Inhibition Mode against Parkinson s Disease-Linked LRRK2 Mutant G219S. Min Liu@&*, Samantha A. Bender%*, Gregory D Cuny@, Woody Sherman, Marcie Glicksman@ Soumya

More information

Journal of Pharmacology and Experimental Therapy-JPET#172536

Journal of Pharmacology and Experimental Therapy-JPET#172536 A NEW NON-PEPTIDIC INHIBITOR OF THE 14-3-3 DOCKING SITE INDUCES APOPTOTIC CELL DEATH IN CHRONIC MYELOID LEUKEMIA SENSITIVE OR RESISTANT TO IMATINIB Manuela Mancini, Valentina Corradi, Sara Petta, Enza

More information

Tailoring the Properties of Quadruplex Nucleobases for Biological and Nanomaterial Applications

Tailoring the Properties of Quadruplex Nucleobases for Biological and Nanomaterial Applications Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2014 Supporting Information for: Tailoring the Properties of Quadruplex Nucleobases

More information

L718Q mutant EGFR escapes covalent inhibition by stabilizing. a non-reactive conformation of the lung cancer drug. osimertinib

L718Q mutant EGFR escapes covalent inhibition by stabilizing. a non-reactive conformation of the lung cancer drug. osimertinib Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information (ESI) for L718Q mutant EGFR escapes covalent inhibition

More information

Supplementary Figure 3 a. Structural comparison between the two determined structures for the IL 23:MA12 complex. The overall RMSD between the two

Supplementary Figure 3 a. Structural comparison between the two determined structures for the IL 23:MA12 complex. The overall RMSD between the two Supplementary Figure 1. Biopanningg and clone enrichment of Alphabody binders against human IL 23. Positive clones in i phage ELISA with optical density (OD) 3 times higher than background are shown for

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary Information Figure S1: (a) Initial configuration of hydroxyl and epoxy groups used in the MD calculations based on the observations of Cai et al. [Ref 27 in the

More information

Medical Research, Medicinal Chemistry, University of Leuven, Leuven, Belgium.

Medical Research, Medicinal Chemistry, University of Leuven, Leuven, Belgium. Supporting Information Towards peptide vaccines against Zika virus: Immunoinformatics combined with molecular dynamics simulations to predict antigenic epitopes of Zika viral proteins Muhammad Usman Mirza

More information

Environment Research Institute, Shandong University, Jinan , P. R. China. Keywords

Environment Research Institute, Shandong University, Jinan , P. R. China. Keywords Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Supplementary data for Dehydrochlorination mechanism of γ- hexachlorocyclohexane degraded by

More information

Supporting Information

Supporting Information Supporting Information ph-responsive self-assembly of polysaccharide through a rugged energy landscape Brian H. Morrow, Gregory F. Payne, and Jana Shen Department of Pharmaceutical Sciences, School of

More information

Supporting Information Soft Nanoparticles: Nano Ionic Networks of Associated Ionic Polymers

Supporting Information Soft Nanoparticles: Nano Ionic Networks of Associated Ionic Polymers Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2016 Supporting Information Soft Nanoparticles: Nano Ionic Networks of Associated Ionic Polymers Dipak

More information

Structural Insights from Molecular Dynamics. Simulations of Tryptophan 7-Halogenase and

Structural Insights from Molecular Dynamics. Simulations of Tryptophan 7-Halogenase and Supporting Information Structural Insights from Molecular Dynamics Simulations of Tryptophan 7-Halogenase and Tryptophan 5-halogenase Jon Ainsley 1, Adrian J. Mulholland 2, Gary W. Black 1, Olivier Sparagano

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/330/6002/341/dc1 Supporting Online Material for Atomic-Level Characterization of the Structural Dynamics of Proteins David E. Shaw,* Paul Maragakis, Kresten Lindorff-Larsen,

More information

NMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease

NMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease University of Wollongong Research Online Faculty of Science - Papers (Archive) Faculty of Science, Medicine and Health 2009 NMR study of complexes between low molecular mass inhibitors and the West Nile

More information

Microscopic analysis of protein oxidative damage: effect of. carbonylation on structure, dynamics and aggregability of.

Microscopic analysis of protein oxidative damage: effect of. carbonylation on structure, dynamics and aggregability of. Microscopic analysis of protein oxidative damage: effect of carbonylation on structure, dynamics and aggregability of villin headpiece Drazen etrov 1,2,3 and Bojan Zagrovic 1,2,3,* Supplementary Information

More information

C a h p a t p e t r e r 6 E z n y z m y e m s

C a h p a t p e t r e r 6 E z n y z m y e m s Chapter 6 Enzymes 4. Examples of enzymatic reactions acid-base catalysis: give and take protons covalent catalysis: a transient covalent bond is formed between the enzyme and the substrate metal ion catalysis:

More information

Improved Resolution of Tertiary Structure Elasticity in Muscle Protein

Improved Resolution of Tertiary Structure Elasticity in Muscle Protein Improved Resolution of Tertiary Structure Elasticity in Muscle Protein Jen Hsin and Klaus Schulten* Department of Physics and Beckman Institute, University of Illinois at Urbana-Champaign, Urbana, Illinois

More information

Acta Crystallographica Section D

Acta Crystallographica Section D Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural characterization of the virulence factor Nuclease A from Streptococcus agalactiae

More information

A. Reaction Mechanisms and Catalysis (1) proximity effect (2) acid-base catalysts (3) electrostatic (4) functional groups (5) structural flexibility

A. Reaction Mechanisms and Catalysis (1) proximity effect (2) acid-base catalysts (3) electrostatic (4) functional groups (5) structural flexibility (P&S Ch 5; Fer Ch 2, 9; Palm Ch 10,11; Zub Ch 9) A. Reaction Mechanisms and Catalysis (1) proximity effect (2) acid-base catalysts (3) electrostatic (4) functional groups (5) structural flexibility B.

More information

MARTINI simulation details

MARTINI simulation details S1 Appendix MARTINI simulation details MARTINI simulation initialization and equilibration In this section, we describe the initialization of simulations from Main Text section Residue-based coarsegrained

More information

Lecture 15: Enzymes & Kinetics. Mechanisms ROLE OF THE TRANSITION STATE. H-O-H + Cl - H-O δ- H Cl δ- HO - + H-Cl. Margaret A. Daugherty.

Lecture 15: Enzymes & Kinetics. Mechanisms ROLE OF THE TRANSITION STATE. H-O-H + Cl - H-O δ- H Cl δ- HO - + H-Cl. Margaret A. Daugherty. Lecture 15: Enzymes & Kinetics Mechanisms Margaret A. Daugherty Fall 2004 ROLE OF THE TRANSITION STATE Consider the reaction: H-O-H + Cl - H-O δ- H Cl δ- HO - + H-Cl Reactants Transition state Products

More information

Computational engineering of cellulase Cel9A-68 functional motions through mutations in its linker region. WT 1TF4 (crystal) -90 ERRAT PROVE VERIFY3D

Computational engineering of cellulase Cel9A-68 functional motions through mutations in its linker region. WT 1TF4 (crystal) -90 ERRAT PROVE VERIFY3D Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 218 Supplementary Material: Computational engineering of cellulase Cel9-68 functional

More information

Supporting Information

Supporting Information Supporting Information Constant ph molecular dynamics reveals ph-modulated binding of two small-molecule BACE1 inhibitors Christopher R. Ellis 1,, Cheng-Chieh Tsai 1,, Xinjun Hou 2, and Jana Shen 1, 1

More information

Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached

Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached to HpUreI. Urea hydrolysis products 2NH 3 and 1CO 2

More information

FW 1 CDR 1 FW 2 CDR 2

FW 1 CDR 1 FW 2 CDR 2 Supplementary Figure 1 Supplementary Figure 1: Interface of the E9:Fas structure. The two interfaces formed by V H and V L of E9 with Fas are shown in stereo. The Fas receptor is represented as a surface

More information

interactions and reaction mechansims in peroxidases and aldo-keto reductases Carme Rovira ICREA / Parc Científic de Barcelona Barcelona

interactions and reaction mechansims in peroxidases and aldo-keto reductases Carme Rovira ICREA / Parc Científic de Barcelona Barcelona Molecular modeling of enzyme-substrate interactions and reaction mechansims in peroxidases and aldo-keto reductases Carme Rovira ICREA / Parc Científic de Barcelona Barcelona What we do Molecular (atomistic)

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1821 Cloud-based simulations on Google Exacycle reveal ligand-modulation of GPCR activation pathways Kai J. Kohlhoff 1,4 *, Diwakar Shukla 1,2, Morgan Lawrenz 2, Gregory R. Bowman 2,

More information

Supporting Information

Supporting Information S1 Supporting Information Unraveling the Reaction Mechanism of Enzymatic C5-Cytosine Methylation of DNA. A Combined Molecular Dynamics and QM/MM Study of Wild Type and Gln119 Variant Juan Aranda 1, Kirill

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting

More information

Equilibrated atomic models of outward-facing P-glycoprotein and effect of ATP binding on structural dynamics (Supplementary Information)

Equilibrated atomic models of outward-facing P-glycoprotein and effect of ATP binding on structural dynamics (Supplementary Information) Equilibrated atomic models of outward-facing P-glycoprotein and effect of ATP binding on structural dynamics (Supplementary Information) Lurong Pan 1 and Stephen G. Aller 2 * 1,2 Department of Pharmacology

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Green Chemistry. This journal is The Royal Society of Chemistry 2014 Supporting Information A novel enzymatic approach to develop a lignin-based adhesive for

More information

Routine access to millisecond timescale events with accelerated molecular dynamics

Routine access to millisecond timescale events with accelerated molecular dynamics Routine access to millisecond timescale events with accelerated molecular dynamics Levi C.T. Pierce, Romelia Salomon-Ferrer, Cesar Augusto F. de Oliveira #, J. Andrew McCammon #, Ross C. Walker * SUPPORTING

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2018 Electronic Supplementary Information Temperature dependence of dynamic, tunnelling

More information

Langevin Dynamics in Constant Pressure Extended Systems

Langevin Dynamics in Constant Pressure Extended Systems Langevin Dynamics in Constant Pressure Extended Systems D. Quigley and M.I.J. Probert CMMP 2004 1 Talk Outline Molecular dynamics and ensembles. Existing methods for sampling at NPT. Langevin dynamics

More information

Bacterial protease uses distinct thermodynamic signatures for substrate recognition

Bacterial protease uses distinct thermodynamic signatures for substrate recognition Bacterial protease uses distinct thermodynamic signatures for substrate recognition Gustavo Arruda Bezerra, Yuko Ohara-Nemoto, Irina Cornaciu, Sofiya Fedosyuk, Guillaume Hoffmann, Adam Round, José A. Márquez,

More information

Supplementary Information

Supplementary Information Supplementary Information Resveratrol Serves as a Protein-Substrate Interaction Stabilizer in Human SIRT1 Activation Xuben Hou,, David Rooklin, Hao Fang *,,, Yingkai Zhang Department of Medicinal Chemistry

More information

What makes a good graphene-binding peptide? Adsorption of amino acids and peptides at aqueous graphene interfaces: Electronic Supplementary

What makes a good graphene-binding peptide? Adsorption of amino acids and peptides at aqueous graphene interfaces: Electronic Supplementary Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 21 What makes a good graphene-binding peptide? Adsorption of amino acids and

More information

Catalytic Mechanism of the Glycyl Radical Enzyme 4-Hydroxyphenylacetate Decarboxylase from Continuum Electrostatic and QC/MM Calculations

Catalytic Mechanism of the Glycyl Radical Enzyme 4-Hydroxyphenylacetate Decarboxylase from Continuum Electrostatic and QC/MM Calculations Catalytic Mechanism of the Glycyl Radical Enzyme 4-Hydroxyphenylacetate Decarboxylase from Continuum Electrostatic and QC/MM Calculations Supplementary Materials Mikolaj Feliks, 1 Berta M. Martins, 2 G.

More information

NB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5

NB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5 SUPPLEMENTARY TABLES Suppl. Table 1. Protonation states at ph 7.4 and 4.5. Protonation states of titratable residues in GCase at ph 7.4 and 4.5. Histidine: HID, H at δ-nitrogen; HIE, H at ε-nitrogen; HIP,

More information

Supplementary Figure 1. Potential energy, volume, and molecular distribution of the

Supplementary Figure 1. Potential energy, volume, and molecular distribution of the 1 2 3 4 5 6 7 8 Supplementary Figure 1. Potential energy, volume, and molecular distribution of the organic substrates prepared by MD simulation. (a) Change of the density and total potential energy of

More information

Goals. Structural Analysis of the EGR Family of Transcription Factors: Templates for Predicting Protein DNA Interactions

Goals. Structural Analysis of the EGR Family of Transcription Factors: Templates for Predicting Protein DNA Interactions Structural Analysis of the EGR Family of Transcription Factors: Templates for Predicting Protein DNA Interactions Jamie Duke 1,2 and Carlos Camacho 3 1 Bioengineering and Bioinformatics Summer Institute,

More information

Molecular dynamics simulation of Aquaporin-1. 4 nm

Molecular dynamics simulation of Aquaporin-1. 4 nm Molecular dynamics simulation of Aquaporin-1 4 nm Molecular Dynamics Simulations Schrödinger equation i~@ t (r, R) =H (r, R) Born-Oppenheimer approximation H e e(r; R) =E e (R) e(r; R) Nucleic motion described

More information

Molecular Dynamics Simulations. Dr. Noelia Faginas Lago Dipartimento di Chimica,Biologia e Biotecnologie Università di Perugia

Molecular Dynamics Simulations. Dr. Noelia Faginas Lago Dipartimento di Chimica,Biologia e Biotecnologie Università di Perugia Molecular Dynamics Simulations Dr. Noelia Faginas Lago Dipartimento di Chimica,Biologia e Biotecnologie Università di Perugia 1 An Introduction to Molecular Dynamics Simulations Macroscopic properties

More information

Structure Investigation of Fam20C, a Golgi Casein Kinase

Structure Investigation of Fam20C, a Golgi Casein Kinase Structure Investigation of Fam20C, a Golgi Casein Kinase Sharon Grubner National Taiwan University, Dr. Jung-Hsin Lin University of California San Diego, Dr. Rommie Amaro Abstract This research project

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3

More information

Mechanism of water/ion exchange at a protein surface: a weakly bound chloride in Helicobacter pylori apoflavodoxin.

Mechanism of water/ion exchange at a protein surface: a weakly bound chloride in Helicobacter pylori apoflavodoxin. Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 25 ELECTRONIC SUPPLEMENTARY INFORMATION Mechanism of water/ion exchange at a protein

More information

User Guide for LeDock

User Guide for LeDock User Guide for LeDock Hongtao Zhao, PhD Email: htzhao@lephar.com Website: www.lephar.com Copyright 2017 Hongtao Zhao. All rights reserved. Introduction LeDock is flexible small-molecule docking software,

More information

Experimental and Computational Mutagenesis To Investigate the Positioning of a General Base within an Enzyme Active Site

Experimental and Computational Mutagenesis To Investigate the Positioning of a General Base within an Enzyme Active Site This is an open access article published under an ACS AuthorChoice License, which permits copying and redistribution of the article or any adaptations for non-commercial purposes. pubs.acs.org/biochemistry

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information Active Site Structure and Absorption Spectrum of Channelrhodopsin-2

More information

Supplementary Figure 1. Biochemical and sequence alignment analyses the

Supplementary Figure 1. Biochemical and sequence alignment analyses the Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).

More information

MM-PBSA Validation Study. Trent E. Balius Department of Applied Mathematics and Statistics AMS

MM-PBSA Validation Study. Trent E. Balius Department of Applied Mathematics and Statistics AMS MM-PBSA Validation Study Trent. Balius Department of Applied Mathematics and Statistics AMS 535 11-26-2008 Overview MM-PBSA Introduction MD ensembles one snap-shots relaxed structures nrichment Computational

More information

Experimental and Computational Mutagenesis to Investigate the. Positioning of a General Base within an Enzyme Active Site

Experimental and Computational Mutagenesis to Investigate the. Positioning of a General Base within an Enzyme Active Site Experimental and Computational Mutagenesis to Investigate the Positioning of a General Base within an Enzyme Active Site Jason P. Schwans, Philip Hanoian, Benjamin J. Lengerich, Fanny Sunden, Ana Gonzalez

More information

QM/MM study on inhibitor of HIV-1 protease. Graduate School of Science, Kyoto University Masahiko Taguchi, Masahiko Kaneso, Shigehiko Hayashi

QM/MM study on inhibitor of HIV-1 protease. Graduate School of Science, Kyoto University Masahiko Taguchi, Masahiko Kaneso, Shigehiko Hayashi QM/MM study on inhibitor of HIV-1 protease Graduate School of Science, Kyoto University Masahiko Taguchi, Masahiko Kaneso, Shigehiko Hayashi HIV Human Immunodeficiency Virus Origin of AIDS HIV appearing

More information

Determination of Kamlet-Taft parameters for selected solvate ionic liquids.

Determination of Kamlet-Taft parameters for selected solvate ionic liquids. Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2016 Determination of Kamlet-Taft parameters for selected solvate ionic liquids. Daniel

More information

Insights into the Biotransformation of 2,4,6- Trinitrotoluene by the Old Yellow Enzyme Family of Flavoproteins. A Computational Study

Insights into the Biotransformation of 2,4,6- Trinitrotoluene by the Old Yellow Enzyme Family of Flavoproteins. A Computational Study Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2019 Supporting Information for Insights into the Biotransformation of 2,4,6- Trinitrotoluene

More information

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-

More information

17. Biomolecular Interaction

17. Biomolecular Interaction 17. Biomolecular Interaction Methods for characterizing biomolecular interactions Sequence-specific DNA binding ligands Molecular mechanisms of drug action and drug resistance In silico compound design

More information

Design of a Novel Globular Protein Fold with Atomic-Level Accuracy

Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Brian Kuhlman, Gautam Dantas, Gregory C. Ireton, Gabriele Varani, Barry L. Stoddard, David Baker Presented by Kate Stafford 4 May 05 Protein

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/5/243/ra68/dc1 Supplementary Materials for Superbinder SH2 Domains Act as Antagonists of Cell Signaling Tomonori Kaneko, Haiming Huang, Xuan Cao, Xing Li, Chengjun

More information

Mechanical Properties of Tetra-Polyethylene and Tetra-Polyethylene Oxide Diamond Networks via Molecular Dynamics Simulations

Mechanical Properties of Tetra-Polyethylene and Tetra-Polyethylene Oxide Diamond Networks via Molecular Dynamics Simulations Supplemental Information Mechanical Properties of Tetra-Polyethylene and Tetra-Polyethylene Oxide Diamond Networks via Molecular Dynamics Simulations Endian Wang and Fernando A. Escobedo Table S1 Lennard-Jones

More information

Supporting Material for. Microscopic origin of gating current fluctuations in a potassium channel voltage sensor

Supporting Material for. Microscopic origin of gating current fluctuations in a potassium channel voltage sensor Supporting Material for Microscopic origin of gating current fluctuations in a potassium channel voltage sensor J. Alfredo Freites, * Eric V. Schow, * Stephen H. White, and Douglas J. Tobias * * Department

More information

Improving Protein Function Prediction with Molecular Dynamics Simulations. Dariya Glazer Russ Altman

Improving Protein Function Prediction with Molecular Dynamics Simulations. Dariya Glazer Russ Altman Improving Protein Function Prediction with Molecular Dynamics Simulations Dariya Glazer Russ Altman Motivation Sometimes the 3D structure doesn t score well for a known function. The experimental structure

More information

Supplementary Information

Supplementary Information Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Supplementary Information Dynamics of the thumb-finger regions in GH11 xylanase Bacillus circulans:

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the

More information

and strong interlayer quantum confinement

and strong interlayer quantum confinement Supporting Information GeP3: A small indirect band gap 2D crystal with high carrier mobility and strong interlayer quantum confinement Yu Jing 1,3, Yandong Ma 1, Yafei Li 2, *, Thomas Heine 1,3 * 1 Wilhelm-Ostwald-Institute

More information

T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp

T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp S u p p l e m e n ta l m at e r i a l jgp Lee et al., http://www.jgp.org/cgi/content/full/jgp.201411219/dc1 T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y S u p p l e m e n ta l D I S C U S

More information

Applications of Molecular Dynamics

Applications of Molecular Dynamics June 4, 0 Molecular Modeling and Simulation Applications of Molecular Dynamics Agricultural Bioinformatics Research Unit, Graduate School of Agricultural and Life Sciences, The University of Tokyo Tohru

More information

Supplement information

Supplement information Electronic Supplementary Material (ESI) for Physil Chemistry Chemil Physics. This journal is the Owner Societies 216 Supplement information Fullerenol C 6 (OH) 16 prevents amyloid fibrillization of Aβ

More information

Chapter 4. Glutamic Acid in Solution - Correlations

Chapter 4. Glutamic Acid in Solution - Correlations Chapter 4 Glutamic Acid in Solution - Correlations 4. Introduction Glutamic acid crystallises from aqueous solution, therefore the study of these molecules in an aqueous environment is necessary to understand

More information

Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing

Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing 0.1% SDS without boiling. The gel was analyzed by a fluorescent

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,

More information

Diffusion of Water and Diatomic Oxygen in Poly(3-hexylthiophene) Melt: A Molecular Dynamics Simulation Study

Diffusion of Water and Diatomic Oxygen in Poly(3-hexylthiophene) Melt: A Molecular Dynamics Simulation Study Diffusion of Water and Diatomic Oxygen in Poly(3-hexylthiophene) Melt: A Molecular Dynamics Simulation Study Julia Deitz, Yeneneh Yimer, and Mesfin Tsige Department of Polymer Science University of Akron

More information

Supporting Information

Supporting Information Supporting Information Energies and 2 -hydroxyl group orientations of RNA backbone conformations. Benchmark CCSD(T)/CBS database, electronic analysis and assessment of DFT methods and MD simulations Arnošt

More information

Universal Repulsive Contribution to the. Solvent-Induced Interaction Between Sizable, Curved Hydrophobes: Supporting Information

Universal Repulsive Contribution to the. Solvent-Induced Interaction Between Sizable, Curved Hydrophobes: Supporting Information Universal Repulsive Contribution to the Solvent-Induced Interaction Between Sizable, Curved Hydrophobes: Supporting Information B. Shadrack Jabes, Dusan Bratko, and Alenka Luzar Department of Chemistry,

More information

Supplementary information for cloud computing approaches for prediction of ligand binding poses and pathways

Supplementary information for cloud computing approaches for prediction of ligand binding poses and pathways Supplementary information for cloud computing approaches for prediction of ligand binding poses and pathways Morgan Lawrenz 1, Diwakar Shukla 1,2 & Vijay S. Pande 1,2 1 Department of Chemistry, Stanford

More information

Supporting Information for. Hydrogen Bonding Structure at Zwitterionic. Lipid/Water Interface

Supporting Information for. Hydrogen Bonding Structure at Zwitterionic. Lipid/Water Interface Supporting Information for Hydrogen Bonding Structure at Zwitterionic Lipid/Water Interface Tatsuya Ishiyama,, Daichi Terada, and Akihiro Morita,, Department of Applied Chemistry, Graduate School of Science

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods Time-resolved FRET (trfret) to probe for changes in the Box A/A stem upon complex assembly U3 MINI was folded and the decay of Fl fluorescence was measured at 20 ºC (see

More information

BIOCHEMISTRY NOTES - UNIT 2-

BIOCHEMISTRY NOTES - UNIT 2- BIOCHEMISTRY NOTES - UNIT 2- ATOMS - the basic unit of matter. Contains subatomic particles o (+ charge) o (no charge/neutral) o (- charge) Protons and neutrons have about the same mass. Electrons are

More information

Adele D. Laurent, Vladimir A. Mironov, Prem P. Chapagain, Alexander V. Nemukhin, and Anna I. Krylov*, INTRODUCTION

Adele D. Laurent, Vladimir A. Mironov, Prem P. Chapagain, Alexander V. Nemukhin, and Anna I. Krylov*, INTRODUCTION pubs.acs.org/jpcb Exploring Structural and Optical Properties of Fluorescent Proteins by Squeezing: Modeling High-Pressure Effects on the mstrawberry and mcherry Red Fluorescent Proteins Adele D. Laurent,

More information

Supplementary material. From cellulose to kerogen: molecular simulation. of a geological process

Supplementary material. From cellulose to kerogen: molecular simulation. of a geological process Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 Supplementary material From cellulose to kerogen: molecular simulation of a geological

More information

Molecular Dynamics Simulation of a Nanoconfined Water Film

Molecular Dynamics Simulation of a Nanoconfined Water Film Molecular Dynamics Simulation of a Nanoconfined Water Film Kyle Lindquist, Shu-Han Chao May 7, 2013 1 Introduction The behavior of water confined in nano-scale environment is of interest in many applications.

More information

Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases

Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3

More information

Biochemistry. Lecture 8 Enzyme Kinetics

Biochemistry. Lecture 8 Enzyme Kinetics Biochemistry Lecture 8 Enzyme Kinetics Why Enzymes? igher reaction rates Greater reaction specificity Milder reaction conditions Capacity for regulation C - - C N 2 - C N 2 - C - C Chorismate mutase -

More information

Supplementary Information Intrinsic Localized Modes in Proteins

Supplementary Information Intrinsic Localized Modes in Proteins Supplementary Information Intrinsic Localized Modes in Proteins Adrien Nicolaï 1,, Patrice Delarue and Patrick Senet, 1 Department of Physics, Applied Physics and Astronomy, Rensselaer Polytechnic Institute,

More information

Direct detection of antibodies in blood plasma using bioluminescent

Direct detection of antibodies in blood plasma using bioluminescent Supplementary information Direct detection of antibodies in blood plasma using bioluminescent sensor proteins and a smartphone. Remco Arts, Ilona den Hartog, Stefan Zijlema, Vito Thijssen, Stan van der

More information

Supporting Information

Supporting Information Supporting Information Sánchez et al. 10.1073/pnas.1612893114 SI Materials and Methods Growth of Single Crystalline Ice. The single crystal ice boule growth method is based on withdrawing a single crystalline

More information

Why Proteins Fold? (Parts of this presentation are based on work of Ashok Kolaskar) CS490B: Introduction to Bioinformatics Mar.

Why Proteins Fold? (Parts of this presentation are based on work of Ashok Kolaskar) CS490B: Introduction to Bioinformatics Mar. Why Proteins Fold? (Parts of this presentation are based on work of Ashok Kolaskar) CS490B: Introduction to Bioinformatics Mar. 25, 2002 Molecular Dynamics: Introduction At physiological conditions, the

More information

β 2 -microglobulin fibrillation?

β 2 -microglobulin fibrillation? Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2014 Can small hydrophobic gold nanoparticles inhibit β 2 -microglobulin fibrillation? G. Brancolini,,

More information

Supporting Information for. Models for the Metal Transfer Complex of the N-terminal Region of CusB and. CusF

Supporting Information for. Models for the Metal Transfer Complex of the N-terminal Region of CusB and. CusF Supporting Information for Models for the Metal Transfer Complex of the N-terminal Region of CusB and CusF Melek N. Ucisik, Dhruva K. Chakravorty, and Kenneth M. Merz Jr. * Department of Chemistry and

More information

BUDE. A General Purpose Molecular Docking Program Using OpenCL. Richard B Sessions

BUDE. A General Purpose Molecular Docking Program Using OpenCL. Richard B Sessions BUDE A General Purpose Molecular Docking Program Using OpenCL Richard B Sessions 1 The molecular docking problem receptor ligand Proteins typically O(1000) atoms Ligands typically O(100) atoms predicted

More information

Molecular dynamics simulations of active site mutants of rat liver arginase

Molecular dynamics simulations of active site mutants of rat liver arginase EJB Electronic Journal of Biotechnology ISSN: 0717-3458 Vol.4 No.3, Issue of December 15, 2001 2001 by Universidad Católica de Valparaíso -- Chile Received August 10, 2001 / Accepted November 7, 2001 RESEARCH

More information

Supplementary information for:

Supplementary information for: SUPPLEMETARY IFRMATI Supplementary information for: Structure of a β 1 -adrenergic G protein-coupled receptor Tony Warne, Maria J. Serrano-Vega, Jillian G. Baker#, Rouslan Moukhametzianov, Patricia C.

More information

Developing Monovalent Ion Parameters for the Optimal Point Charge (OPC) Water Model. John Dood Hope College

Developing Monovalent Ion Parameters for the Optimal Point Charge (OPC) Water Model. John Dood Hope College Developing Monovalent Ion Parameters for the Optimal Point Charge (OPC) Water Model John Dood Hope College What are MD simulations? Model and predict the structure and dynamics of large macromolecules.

More information

Electronic Supplementary Information Effective lead optimization targeted for displacing bridging water molecule

Electronic Supplementary Information Effective lead optimization targeted for displacing bridging water molecule Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2018 Electronic Supplementary Information Effective lead optimization targeted for displacing

More information

Supplementary Information for Atomistic Simulation of Spinodal Phase Separation Preceding Polymer Crystallization

Supplementary Information for Atomistic Simulation of Spinodal Phase Separation Preceding Polymer Crystallization Supplementary Information for Atomistic Simulation of Spinodal Phase Separation Preceding Polymer Crystallization Richard H. Gee * Naida Lacevic and Laurence E. Fried University of California Lawrence

More information

Supplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization

Supplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization Supplementary Information Structural basis for precursor protein-directed ribosomal peptide macrocyclization Kunhua Li 1,3, Heather L. Condurso 1,3, Gengnan Li 1, Yousong Ding 2 and Steven D. Bruner 1*

More information