Direct detection of antibodies in blood plasma using bioluminescent

Transcription

1 Supplementary information Direct detection of antibodies in blood plasma using bioluminescent sensor proteins and a smartphone. Remco Arts, Ilona den Hartog, Stefan Zijlema, Vito Thijssen, Stan van der Beelen, Maarten Merkx* Laboratory of Chemical Biology and Institute for Complex Molecular Systems (ICMS), Department of Biomedical Engineering, Eindhoven University of Technology, P.O. Box 513, 5600 MB Eindhoven, The Netherlands. *Corresponding author: m.merkx@tue.nl S1

2 Table of contents Cloning procedures S3 Figure S1: Titration curves for HIV1-LUMABS-LZ2 and HIV1-LUMABS-2 and 3 S4 Figure S2: Determination of limit of detection S5 Figure S3: Titration curves for alanine mutants of HIV-LUMABS-1 S6 Antibody detection using smartphone application S7 Figure S4: Antibody detection using Android application S8 Figure S5: Detection of HIV antibodies in blood plasma using Android application S9 Table S1: Overview of sensor affinities of leucine zipper and SH3-peptide based sensors S10 Table S2: Overview of antibody affinities of alanine mutations of HIV-LUMABS-1 S11 Amino acid and DNA sequence of leucine zipper-based sensors S12 Amino acid and DNA sequence of HIV-LUMABS-1 S14 S2

3 Cloning procedures A pet28a vector containing DNA encoding mneongreen and NanoLuc, separated by a 75- amino acid linker consisting of GGS repeats and a TEV cleavage site was ordered from GenScript. Using circular polymerase extension cloning (CPEC), the flexible GGS linker was replaced by the semi-flexible linker containing two HIV1-p17 epitopes. To introduce the leucine zipper helper domains, four primers were ordered from Eurofins (Leipzig, Germany) that encoded for the respective leucine zipper domains and were designed to bind to the N- terminus (N-FW and N-RV) and C-terminus (C-FW and C-RV) of the protein DNA. After amplification in two distinct PCR reactions using primers N-FW and C-RV to amplify the sensor protein domain and N-RV and C-FW to amplify the vector, both with leucine zipper DNA appended, the PCR products were joined in a CPEC reaction. Sequencing revealed a frameshift in one of the leucine zipper domains, which was resolved using site directed mutagenesis with the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies). The same kit was used to make mutations in the C-terminal leucine zipper domain. For the SH3-proline rich peptide helper domains, a pet28a plasmid encoding SH3- IPSKPLPPLPV was ordered from GenScript. DNA encoding mneongreen-hivlinker- NanoLuc was cloned into this construct using CPEC. Mutations in the proline-rich peptide were made using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit, as were the mutations in the epitope to introduce alanines instead of native residues. Epitope exchange was achieved using a CPEC strategy. Primers were designed in such a way that the previous epitope was eliminated during PCR amplification. Insert and vector were amplified in separate PCR reactions, with epitope-encoding DNA sequences appended to the DNA binding domain of the primers. In a subsequent CPEC reaction, the amplification products were joined, yielding a sensor with new epitopes. All cloning and mutagenesis results were confirmed by DNA sequencing (StarSEQ GmbH). S3

4 Figure S1: Responses of (A) HIV LUMABS LZ2 ( K d,apparent = 95 ± 32 pm) and (B) HIV LUMABS 2 (blue, K d,apparent = 78 ± 15pM) and 3 (black, K d,apparent = 71 ± 14 pm) to increasing concentrations of anti HIV1 p17 antibody. Sensor signal was recorded using 5 pm sensor in a buffer composed of 50 mm phosphate, 100 mm NaCl and 1 mg/ml bovine serum albumin at ph = 7.4. S4

5 Figure S2: Determination of limit of detection of HIV LUMABS 1. Emission ratio was recorded using 10 pm HIV LUMABS 1 sensor in a buffer composed of 50 mm phosphate, 100 mm NaCl and 1 mg/ml bovine serum albumin at ph = 7.4. Antibody and sensor were pre incubated for 4 hours, followed by addition of 500x diluted NanoGlo luciferase assay substrate. (n = 3). S5

6 Figure S3: Comparison of HIV LUMABS 1 mutants where indicated residues have been replaced by alanines. Measurements were performed at a sensor concentration of 5 pm, in a buffer composed of 50 mm phosphate, 100 mm NaCl and 1 mg/ml BSA at ph = 7. S6

7 Antibody detection using smartphone and Android application We developed a software application (provided as supporting information: ColorAnalyzer_V7_new.apk) that enables recording and interpretation of the emitted sensor signal for Android-based smartphones (tested for Android 5.0 and 5.1.1). The application was created using the MIT App Inventor 2 and has been compiled in the nb146j release. On the application home screen, the user is asked to either take a picture or open a picture from the phones storage. If the phone camera is used to take a picture, this image will be converted to JPEG (.jpg) format by the smartphone and then saved into a TinyDB database in the app. If an image is selected from the phones storage (supported file formats jpg, png, bmp and nonanimated gif), this file is copied to the TinyDB database. In addition, the home screen can be used to adjust the green over blue threshold ratio, using a slider which updates the threshold and rounds it to two decimals. This ratio is used to determine whether antibody is present (R calculated < R threshold ) or absent (R calculated R threshold ). When progressing to the analysis screen, the image is imported from the TinyDB onto a canvas that matches the dimensions of the imported image. This canvas makes it possible to extract pixel information. The amount of pixels used for analysis can be adjusted using the slider on the bottom of the screen, and is adjusted to the nearest odd number (i.e. 1x1, 3x3, 5x5, etc.). After a tap of the user within the image, the app will take all the RGB values of the selected pixels and calculates the green and blue fractions as percentages of 255 (the maximum RGB value). The app then divides the average pixel values to obtain the green/blue ratio and displays all three values, rounded to two decimals. Immediately, a white overlay will be placed on top of the background of the canvas to mark the analyzed pixels. Finally, the app will compare the obtained green/blue ratio with the threshold and report back by stating if the antibody is present or not. When the user has finished the analysis, the image can be saved to the phone or the cloud or shared via other media. To avoid losing analysis data, built-in dialog windows prevent the user from quitting the application. S7

8 Figure S4: Antibody detection using mobile phone application. The image analysed in this example was taken using a Nokia Lumia 920 mobile phone, using 1 nm HIV LUMABS 1 directly in 50 μl blood plasma, in the absence and presence of 2 nm anti HIV p17 antibody. A) Home screen B) Analysis screen analyzing a well in which antibody is not present using an analysis size of 7x7 pixels. C) Analysis of a well in which 2 nm antibody is present. D, E) The application offers to save the recorded image to the phone or remote data storage, and enables straightforward sharing of results. F) Built in dialog screens prevent the user from exiting the application accidentally. S8

9 Emission Ratio (green/blue) pm HIV-LUMABS pm antibody Figure S5: Detection of HIV antibodies in blood plasma using Android application. Measurements were performed in a white 384 wells plate, in a blood plasma volume of 50 μl using 200 pm HIV LUMABS 1 and 1 μl NanoGlo Luciferase assay substrate. Using a Sony Xperia Z3 Compact, a photograph was taken of 6 wells, 3 of which contained 500 pm anti HIV p17 antibody (30 minutes incubation). This photograph was analyzed using the Android application described above (using a 3x3 pixels analysis size), yielding a statistically significant difference in emission ratio (p = ) between the absence and presence of antibody. S9

10 Supplementary table 1: Overview of anti-hiv1-p17 affinities for various sensor variants at ph = 7.4 Sensor name Helper domain K d,apparent (pm) a HIV-LUMABS-LZ1 Leucine zipper 115 ± 41 HIV-LUMABS-LZ2 Leucine zipper (E27K) 95 ± 32 HIV-LUMABS-1 SH3-IRSKPLPPLPVTG 83 ± 10 HIV-LUMABS-2 SH3-IRSKPLPLTPNTG 78 ± 15 HIV-LUMABS-3 SH3-IPSKPLPPLPVTG 71 ± 14 HIV-LUMABS-4 SH3-IVNKPLAPLPVTG n/a a. K d,apparent s were determined by fitting titration curves to Equation 1, and represented as K d,apparent ± standard error. Titrations were performed at a sensor concentration of 10 pm, in a buffer composed of 50 mm phosphate, 100 mm NaCl and 1 mg/ml bovine serum albumin. S10

11 Supplementary table 2: Overview of anti-hiv1-p17 affinities for various sensor mutants at ph = 7. Sensor name Epitope K d,apparent (pm) a HIV-LUMABS-1 ELDRWEKIRLR 51 ± 6 HIV-LUMABS-1 (short epitope) WEKIRLR No response HIV-LUMABS-1(Ala1) ALDRWEKIRLR 39 ± 5 HIV-LUMABS-1(Ala2) EADRWEKIRLR 69 ± 4 HIV-LUMABS-1(Ala3) ELARWEKIRLR 610 ± 140 HIV-LUMABS-1(Ala4) ELDAWEKIRLR 56 ± 7 HIV-LUMABS-1(Ala5) ELDRAEKIRLR 50 ± 8 a. K d,apparent s were determined by fitting titration curves to Equation 1, and represented as K d,apparent ± standard error. Titrations were performed at a sensor concentration of 10 pm, in a buffer composed of 50 mm phosphate, 100 mm NaCl and 1 mg/ml bovine serum albumin. S11

12 Amino acid and DNA sequence of leucine zipper-based sensor LZ1. Leucine zipper domains mneongreen Epitopes NanoLuc atgggcagcagccatcatcatcatcatcacagcagcggcgccctgaagaaggagctgcag M G S S H H H H H H S S G A L K K E L Q gccaacaagaaggagctggcccagctgaagtgggagctgcaggccctgaagaaggagctg A N K K E L A Q L K W E L Q A L K K E L gcccagctggtgccgcgcggtggctctggtggctctggcagccatatggtaagtaaaggt A Q L V P R G G S G G S G S H M V S K G gaagaagacaatatggcttctctgcctgccacacatgagcttcatatttttgggagcata E E D N M A S L P A T H E L H I F G S I aacggagtggatttcgacatggtaggtcagggtacggggaaccctaacgatggatatgag N G V D F D M V G Q G T G N P N D G Y E Gagttgaatcttaaaagca caaagggtgatctgcagttctcgccctggatcctggtgccg E L N L K S T K G D L Q F S P W I L V P catataggttatggtttccatcagtatcttccatacccggatggcatgagcccttttcag H I G Y G F H Q Y L P Y P D G M S P F Q gccgcaatggtagatggctcaggatatcaagtgcatcggaccatgcagtttgaagatggg A A M V D G S G Y Q V H R T M Q F E D G gcgtctttgacggtaaattacaggtacacctatgagggtagccatataaagggagaagcg A S L T V N Y R Y T Y E G S H I K G E A caggtgaagggaactggattcccagcggatggcccagtcatgacaaacagcctcaccgct Q V K G T G F P A D G P V M T N S L T A gctgattggtgccgatccaagaaaacgtatccaaacgataaaactatcatttctactttt A D W C R S K K T Y P N D K T I I S T F aagtggtcctatacaacaggaaacgggaaacgctatcgttcaacggcccgcacgacctac K W S Y T T G N G K R Y R S T A R T T Y acgtttgcaaagccaatggctgcgaattatctgaaaaaccagccgatgtatgtgttccgt T F A K P M A A N Y L K N Q P M Y V F R aaaaccgaactgaaacattctaaaacggagctcaatttcaaggaatggcagaaggcattt K T E L K H S K T E L N F K E W Q K A F acggatgtcatgggaatggacgaactgtataagtcgggcggagagctagatcgctgggaa T D V M G M D E L Y K S G G E L D R W E aaaatacgccttagaccggggggttcgggtggttcaggcggctcaggaggctccgggggt K I R L R P G G S G G S G G S G G S G G tccggagggagcggtgctgaagccgcagccaaggaagcagcagctaaagaggccgctgcg S G G S G A E A A A K E A A A K E A A A aaggaagctgccgcaaaggaggcggcggcgaaagaggcggcagcaaaagccggatctggt K E A A A K E A A A K E A A A K A G S G ggcagtggtggctccggcgggtcaggtggcagcgggggatcaggagctgaggcagccgcc G S G G S G G S G G S G G S G A E A A A aaagaggctgcggccaaggaggccgccgctaaagaagccgcggcaaaagaggcagcggca K E A A A K E A A A K E A A A K E A A A aaggaagcggctgcgaaagccggaagtggtgggtcgggcggctccggtggctctggcggc K E A A A K A G S G G S G G S G G S G G agtggcggtagtggcggggaattagataggtgggaaaagatccggttacgcccgggaggt S G G S G G E L D R W E K I R L R P G G ggcagcatggtatttactcttgaagattttgtcggtgattggcgccagaccgccggctat G S M V F T L E D F V G D W R Q T A G Y aacctggaccaagtgcttgaacagggcggggttagcagcctgtttcaaaacctgggggtg N L D Q V L E Q G G V S S L F Q N L G V agtgtcacgccaattcagcgcatcgttctgtcgggagagaatggtctgaaaatcgatatc S V T P I Q R I V L S G E N G L K I D I cacgtcattatcccgtacgaaggtctttctggtgatcagatggggcagatagaaaaaata H V I I P Y E G L S G D Q M G Q I E K I S12

13 ttcaaagtggtgtacccagtagacgatcatcacttcaaggttatactgcactatggcacc F K V V Y P V D D H H F K V I L H Y G T ctcgttatcgatggcgttactccgaatatgatcgattactttgggcgtccttatgaaggt L V I D G V T P N M I D Y F G R P Y E G attgcggtgttcgacggtaaaaaaattacggttaccgggacgctctggaatggtaataaa I A V F D G K K I T V T G T L W N G N K atcattgatgagcgcttgataaacccagatggcagccttctgttcagagttacgataaac I I D E R L I N P D G S L L F R V T I N ggggttacgggttggcgactgtgcgaaagaatattagcttctagcggaggaagtggagga G V T G W R L C E R I L A S S G G S G G agtggtgaacaattaaaaaagaagttacaggccctggaaaaaaaattagcccagttagag S G E Q L K K K L Q A L E K K L A Q L E tggaagaaccaggccttagaaaaagaattagcacaactggttccacgcggtagccactgg W K N Q A L E K E L A Q L V P R G S H W tcccatccgcagttcgagaaataa S H P Q F E K - In LZ2 the most c-terminal glutamate residue in the c-terminal zipper domain was replaced by a lysine residue codon (gaa -> aaa) S13

14 Amino acid and DNA sequence of HIV-LUMABS-1 SH3 domain mneongreen Epitopes NanoLuc Proline-rich peptide atgggcagcagccatcatcatcatcatcacagcagcggcctggtgccgcgcggcagccat M G S S H H H H H H S S G L V P R G S H atggctagcgacgacaactttatatacaaggcgaaggcgctctatccctatgatgcagat M A S D D N F I Y K A K A L Y P Y D A D gatgatgacgcatacgaaatctcattcgaacaaaatgaaatccttcaggtatcagacatt D D D A Y E I S F E Q N E I L Q V S D I gaggggcggtggtggaaagcccgccgcgccaatggagagacaggcatcatcccgtcgaat E G R W W K A R R A N G E T G I I P S N tatgttcagttgattgacggtcctgaggaaatgcatcggggcggctcgggaggctcaggc Y V Q L I D G P E E M H R G G S G G S G agccatatggtaagtaaaggtgaagaagacaatatggcttctctgcctgccacacatgag S H M V S K G E E D N M A S L P A T H E cttcatatttttgggagcataaacggagtggatttcgacatggtaggtcagggtacgggg L H I F G S I N G V D F D M V G Q G T G aaccctaacgatggatatgaggagttgaatcttaaaagcacaaagggtgatctgcagttc N P N D G Y E E L N L K S T K G D L Q F tcgccctggatcctggtgccgcatataggttatggtttccatcagtatcttccatacccg S P W I L V P H I G Y G F H Q Y L P Y P gatggcatgagcccttttcaggccgcaatggtagatggctcaggatatcaagtgcatcgg D G M S P F Q A A M V D G S G Y Q V H R accatgcagtttgaagatggggcgtctttgacggtaaattacaggtacacctatgagggt T M Q F E D G A S L T V N Y R Y T Y E G agccatataaagggagaagcgcaggtgaagggaactggattcccagcggatggcccagtc S H I K G E A Q V K G T G F P A D G P V atgacaaacagcctcaccgctgctgattggtgccgatccaagaaaacgtatccaaacgat M T N S L T A A D W C R S K K T Y P N D aaaactatcatttctacttttaagtggtcctatacaacaggaaacgggaaacgctatcgt K T I I S T F K W S Y T T G N G K R Y R tcaacggcccgcacgacctacacgtttgcaaagccaatggctgcgaattatctgaaaaac S T A R T T Y T F A K P M A A N Y L K N cagccgatgtatgtgttccgtaaaaccgaactgaaacattctaaaacggagctcaatttc Q P M Y V F R K T E L K H S K T E L N F aaggaatggcagaaggcatttacggatgtcatgggaatggacgaactgtataagtcgggc K E W Q K A F T D V M G M D E L Y K S G ggagagctagatcgctgggaaaaaatacgccttagaccggggggttcgggtggttcaggc G E L D R W E K I R L R P G G S G G S G ggctcaggaggctccgggggttccggagggagcggtgctgaagccgcagccaaggaagca G S G G S G G S G G S G A E A A A K E A gcagctaaagaggccgctgcgaaggaagctgccgcaaaggaggcggcggcgaaagaggcg A A K E A A A K E A A A K E A A A K E A gcagcaaaagccggatctggtggcagtggtggctccggcgggtcaggtggcagcggggga A A K A G S G G S G G S G G S G G S G G tcaggagctgaggcagccgccaaagaggctgcggccaaggaggccgccgctaaagaagcc S G A E A A A K E A A A K E A A A K E A gcggcaaaagaggcagcggcaaaggaagcggctgcgaaagccggaagtggtgggtcgggc A A K E A A A K E A A A K A G S G G S G ggctccggtggctctggcggcagtggcggtagtggcggggaattagataggtgggaaaag G S G G S G G S G G S G G E L D R W E K atccggttacgcccgggaggcagcatggtatttactcttgaagattttgtcggtgattgg I R L R P G G S M V F T L E D F V G D W S14

15 cgccagaccgccggctataacctggaccaagtgcttgaacagggcggggttagcagcctg R Q T A G Y N L D Q V L E Q G G V S S L tttcaaaacctgggggtgagtgtcacgccaattcagcgcatcgttctgtcgggagagaat F Q N L G V S V T P I Q R I V L S G E N ggtctgaaaatcgatatccacgtcattatcccgtacgaaggtctttctggtgatcagatg G L K I D I H V I I P Y E G L S G D Q M gggcagatagaaaaaatattcaaagtggtgtacccagtagacgatcatcacttcaaggtt G Q I E K I F K V V Y P V D D H H F K V atactgcactatggcaccctcgttatcgatggcgttactccgaatatgatcgattacttt I L H Y G T L V I D G V T P N M I D Y F gggcgtccttatgaaggtattgcggtgttcgacggtaaaaaaattacggttaccgggacg G R P Y E G I A V F D G K K I T V T G T ctctggaatggtaataaaatcattgatgagcgcttgataaacccagatggcagccttctg L W N G N K I I D E R L I N P D G S L L ttcagagttacgataaacggggttacgggttggcgactgtgcgaaagaatattagcttct F R V T I N G V T G W R L C E R I L A S agcggtggaggatctattcgttcaaagccgctgccacccctacccgtgaccgggtaa S G G G S I R S K P L P P L P V T G - The HIV epitope sequence was replaced by the following sequences in the HA-tag sensor and DEN1 sensor. HA-tag N-terminal tatccgtacgatgtgccggattacgcg Y P Y D V P D Y A C-terminal tacccatatgacgtcccagactatgcc Y P Y D V P D Y A DEN1 N-terminal gagcataaatactcatggaagtca E H K Y S W K S C-terminal gaacacaagtatagctggaaaagc E H K Y S W K S S15