Insights on Antibiotic Translocation : Molecular Dynamics Simulations
|
|
- Peregrine Walker
- 6 years ago
- Views:
Transcription
1 I Insights on Antibiotic Translocation : Molecular Dynamics Simulations Amit Kumar, Eric Hajjar,Enrico Spiga, Francesa Collu, Paolo Ruggerone & Matteo Ceccarelli Marseille :
2 Outline METHODS 1. Model to assess translocation : What can we compare with experiments? 2. Interrelation between Experiments and Simulations Metadynamics : Different reaction co ordinates, free energy quantification Validations for simulation runs ( RMSF, RMSD ) Results : Successful stories in light with experimental findings : 1. Carbenicilllin diffusion through WT and D113N_E117Q mutants OmpF 2. Ampicillin with Mutants R132A and D113N 3. Floroquinilones : Comparison between Moxifloxacin and Enrofloxacin 4. Cephalosporins : Comparison between Cefpirome and Cefetamet (preminilary results)
3 Modeling Translocation From Blockage SINGLE MOLECULE EXPERIMENTS : Interruption in ion flow associated with blockage of antibiotic BLM experiment : The Rate constant k, can be obtained by noise analysis in frequency spectra. Free energy model : Every 2 blockage corresponds to 1 translocation. Nestorovich et al. PNAS vol. 99, 15,
4 Interrelation between experimental and simulation data Transition Rate Theory : Energy 7 kb T = 1 ns 14 kb T = 1 μ s 21 kb T = 1 ms A G B Reaction Co ordinate K.E.Cooper et al, J. Membrane Biol (1988)
5 Metadynamics Metadynamics : Accelerates the process to be observable within the reach of Standard MD Simulations. Provides Coarse garined description for the process in phase space defined by a set of reaction ccordinates. Main problem: how to choose the reaction coordinates of a given process? Laio and Parrinello, 99, PNAS 2002
6 Reaction Coordinates Z coordinate : The axis of diffusion is defined as center of mass (com )of the antibiotic with respect to com of system along z. Angle : Defined as Orientation of molecule's dipole with respect to com of system along z. H bond : Defined as number of H bond between the antibiotic and the protein. 0 degree 180 degree
7 Free Energy Surface Evaluation Z coordinate 1. Free Energy construction in the phase space of the chosen Reaction co ordinates. 2. Each Color Corresponds to 1 Kcal/mol. 9 Kcal /mol. Angle 3. High Intensity of the color correspond to strong interactions.
8 Validation of Simulation runs Root Mean square Fluctuations and Converted B factors L2 L1 L3 L4 L5 L6 L7 L8
9 Validation for Simulation Runs (ii) Root Mean Square Deviations
10 Area Calculation along OmpF X Ray Structure : 2OMF (PDB ID ) Z axis Solvent accessible area was calculated using in house built program :Hope for the X Ray structure of OmpF. Good agreement with the well known program Hole1. ( Between Z ( 6:6)Š) Useful to calculate the fluctuation of area (with / without) presence of antibiotic with an effort to correlate with BLM experiments. Area (Ų) O.S.Smart et al, Biophysical Journal (1993)
11 I) The case of Carbenicillin Carbenicillin (CRB) has charge of 2. The diffusion of CRB through ompf is difficult due to the repulsion between the carboxy group and the residues 113 and 117 near the constriction region. On Screening the repulsion : By Mutation of the residues D113 N113 and E117 Q117 can we expect the translocation process for CRB? To answer our question : OmpF Investigated : Wild Type (WT) 2. D113N_E117Q : Double Mutant (DM) 1.
12 Free Energy Surface Evaluation Angle Carbenicillin with Wild Type (WT) mutant no translocation. Carbenicillin with D113N_E117Q mutant translocation
13 Movies For WT and D113N_E117Q OmpF
14 Why No translocation through WT OmpF Mini 1 Z axis The strong minimum at Z = ( 7.8 to 9.8 )Å ang = ( 70 to 90 ) deg Angle The antibiotic makes strong H bonds with residues R42, and switches its H bonded interaction between K80, R168
15 Observation along the trajectory for WT 1. For most part of the total trajectory ( ~20ns) the antibiotic stays in Mini 1. Favorable Interaction of oxygens with K80, 167, 168. Move towards constriction region : Snapshot for a configuration where CRB arrives near constriction region parallel to axis of diffusion, phenyl C Repulsion effect and low entropy due to unfavorable environment. Distance group down. (min z= 3.8Å) Figure C on the right depicts distance between D113 COO (black) and E117 COO (red) Time (20ns)
16 Translocation for CRB with DM Z axis Angle
17 Observation along trajectory of translocation Inventory Interaction map for Minima's near Constriction region : Mini 2 and Mini 3 Mini 2 Mini 3 In the two minima's the oxygens of the antibiotic makes H bonded interactions with the stacked arginines ( Switching between R132, R82, R42, K16 ) and in particular we observe the oxygens making interactions with N113 and Q117.
18 Area Calculation for the Minima's for DM Z axis (Å) Area (Ų) The Mini 2 and Mini 3 which lie near/on the constriction region in presence of antibiotic the area is as low as ~2Ų in the constriction region, closure of pore.
19 Comparing WT with DM Mini 1 which lies very much above the constriction region, the WT and DM have nearly similar interaction. ( mutations has not much effect ). For WT CRB does not arrive near the constriction region, due to repulsion and supported low entropy for CRB created by the residues D113, E117. For DM near constriction region : No repulsion effect + Higher Entropy = Translocation. Interactions with N113 and Q117 essential for translocation.
20 Comparing with experiments for CRB BLM experiments : our partners ( Bremen ) 1. WT > No Blockage > No Translocation. 2. DM > No Blockage > No Translocation. Simulation Results : 1. WT > No Translocation 2. DM > Translocation. Area calculation : in presence of antibiotic area ~2Ų, the pore is blocked perhaps for a timescale not resolved by experiments (~10µs).
21 The effects of Ompf mutants on ampicillin diffusion BASIC RESIDUE MUTATION : R132A change in charge + size ACIDIC RESIDUE MUTATION : D113N change in charge View of Constriction Zone
22 Free Energy Surface Z coordinate Mini Mini Angle
23 SER125 OH Interaction map for mini's near constriction region
24 Observation along trajectory of translocation For Mutation of R132A movement of ampicillin towards A132 finds more space H bonded interaction with residues localized in neighbour hood of A132. The orientation is parallel to axis of diffusion. ( phenyl group down) On Mutation D113N H bonded interactions with stacked arginines ( ) and E117. Orientation perpendicular. Phenyl group slides along the L3 loop Phenyl group top AREA CALCULATIONS area available along Z axis, for the minima of R132a, D113n. Z axis (Å) figure on right represents the sas Area (~ 9 Ų) Area ~ (0 Ų) Area (Ų) for Z= 2 (constriction region) along the simulation time. Area (Ų) figure on right represents the area sliced Simulation time
25 Comparison with Experiments BLM experiments (Bremen) 1. D113N Slight Increase in background noise. 2. R132A No Blockage No translocation Simulation Results 1. D113N Translocation ~ Area ~ 0Ų 2. R132A Translocation Area ~9Ų Liposome swelling assay experiments (Bremen and Porto) : Swelling rate for mutants R132A and D113N more compared to wild type, confirms translocation of ampicillin for the mutants.
26 3) Flouroquinolones Floroquinolones are more bulky and hydrophobic compared to the family of penicillin s. Moxifloxacin Enrofloxacin Moxifloxacin and Enrofloxacin are zwitterionic and charged zero.
27 Free Energy Represenatation MOXIFLOXACIN ENROFLOXACIN 3 Translocation with coo group up. Translocation with coo group down.
28 Comparison with BLM experiments Area calculation for the constriction region all along the trajectory of translocation. Moxifloxacin Enrofloxacin Complete closure and conformational change of the pore during the translocation
29 Comparison with fret experiments 1 E (t ) = R 6 (t ) 1+ 6 R0 (t ) Where R06 is the foster radius (E = 0.5 % ) ; and R6 is the distance between the dipole of Trp and Moxifloxacin. E(t) measures the energy transfer between the trp and the antibiotic.
30 Comparison with Fret experiments Moxifloxacin Tryptophane ETrp61=0.957 ETrp214=0.378 High value for Etrp 61 implies difffusion of Further details see poster on Floroquinolones moxi through OmpF
31 Conclusions and Prespectives for Floroquinolones From Simulations : translocation of Moxifloxacin and Enrofloxacin. Thanks to the flouresence property in Floroquinolones, which allow us to compared diretly with the FRET experiments. We observe a high efficiency of energy transfer between Trp 61 and moxifloxacin. Good agreement with experiments. Complete closure of pore and conformational change is the pore (expansion) to accomadate the bulky antibiotic. (agreement with BLM experiments) We extend the methodology from Moxi to Enro and observe similar interactions between the antibiotic and OmpF during the translocation process. (need overlap integral for Enro (from our partners in Porto to calculate the E(t) )
32 4) Cephalosporins CEFPIROME ( CFR) CEFETAMET ( CFT) Charge 0 Charge ( 1)
33 Free Energy Representation CFT WT CFR WT I Z Coordinate V11 ANGLE
34 Preminilary results for CFT Above the constriction region H bond interactions with the stacked arginines, similar conformation for Mini2, Mini3 and Mini4. H contacts with Met 38 Movie : translocation of Cefetamet (CFT)
35 Work In progress CEPHALOSPORINS Cefpirome WT D113A Completed (Eric s Completed (Eric s talk) Cefepime In progress Cefetamet (chagre 1) Preliminary results Ceftizoxime talk) D121A Analysis to completed In progess In progress (translocation) In progress
36 Acknowledgement 1. Thanks to our Network partners : Experimental data 2. Attilio Vargiu : Valuable help Parameterisation of Antibiotics Computing Facility as CASPUR (Rome), CINECA,CYBERSAR (Cagliari ). Financial support
Eric Hajjar, Amit Kumar, Enrico Spiga, Francesca Collu, Atilio Vargiu, Paolo Ruggerone and Matteo Ceccarelli
University of Cagliari, Dept of Physics CNR-SLACS: Sardinian LAboratory for Computational Materials Science Eric Hajjar, Amit Kumar, Enrico Spiga, Francesca Collu, Atilio Vargiu, Paolo Ruggerone and Matteo
More informationBacterial Outer Membrane Porins as Electrostatic Nanosieves: Exploring Transport Rules of Small Polar Molecules
Bacterial Outer Membrane Porins as Electrostatic Nanosieves: Exploring Transport Rules of Small Polar Molecules Harsha Bajaj, Silvia Acosta Gutiérrez, Igor Bodrenko, Giuliano Malloci, Mariano Andrea Scorciapino,
More informationSupplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached
Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached to HpUreI. Urea hydrolysis products 2NH 3 and 1CO 2
More informationComputational engineering of cellulase Cel9A-68 functional motions through mutations in its linker region. WT 1TF4 (crystal) -90 ERRAT PROVE VERIFY3D
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 218 Supplementary Material: Computational engineering of cellulase Cel9-68 functional
More informationStructural and mechanistic insight into the substrate. binding from the conformational dynamics in apo. and substrate-bound DapE enzyme
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 215 Structural and mechanistic insight into the substrate binding from the conformational
More informationSupplementary information for cloud computing approaches for prediction of ligand binding poses and pathways
Supplementary information for cloud computing approaches for prediction of ligand binding poses and pathways Morgan Lawrenz 1, Diwakar Shukla 1,2 & Vijay S. Pande 1,2 1 Department of Chemistry, Stanford
More informationProteins polymer molecules, folded in complex structures. Konstantin Popov Department of Biochemistry and Biophysics
Proteins polymer molecules, folded in complex structures Konstantin Popov Department of Biochemistry and Biophysics Outline General aspects of polymer theory Size and persistent length of ideal linear
More informationProtein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.
Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small
More informationAnatoly B. Kolomeisky Department of Chemistry Center for Theoretical Biological Physics How to Understand Molecular Transport through Channels: The
Anatoly B. Kolomeisy Department of Chemistry Center for Theoretical Biological Physics How to Understand Molecular Transport through Channels: The Role of Interactions Transport Through Channels Oil pumping
More informationStructural Insights from Molecular Dynamics. Simulations of Tryptophan 7-Halogenase and
Supporting Information Structural Insights from Molecular Dynamics Simulations of Tryptophan 7-Halogenase and Tryptophan 5-halogenase Jon Ainsley 1, Adrian J. Mulholland 2, Gary W. Black 1, Olivier Sparagano
More informationT H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp
S u p p l e m e n ta l m at e r i a l jgp Lee et al., http://www.jgp.org/cgi/content/full/jgp.201411219/dc1 T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y S u p p l e m e n ta l D I S C U S
More informationBiophysics 490M Project
Biophysics 490M Project Dan Han Department of Biochemistry Structure Exploration of aa 3 -type Cytochrome c Oxidase from Rhodobacter sphaeroides I. Introduction: All organisms need energy to live. They
More informationOther Cells. Hormones. Viruses. Toxins. Cell. Bacteria
Other Cells Hormones Viruses Toxins Cell Bacteria ΔH < 0 reaction is exothermic, tells us nothing about the spontaneity of the reaction Δ H > 0 reaction is endothermic, tells us nothing about the spontaneity
More informationExperimental and Computational Mutagenesis to Investigate the. Positioning of a General Base within an Enzyme Active Site
Experimental and Computational Mutagenesis to Investigate the Positioning of a General Base within an Enzyme Active Site Jason P. Schwans, Philip Hanoian, Benjamin J. Lengerich, Fanny Sunden, Ana Gonzalez
More informationVoltage Dependence of Conformational Dynamics and Subconducting
Biophysical Journal, Volume 111 Supplemental Information Voltage Dependence of Conformational Dynamics and Subconducting States of VDAC-1 Rodolfo Briones, Conrad Weichbrodt, Licia Paltrinieri, Ingo Mey,
More informationMid-Term Review Meeting
Mid-Term Review Meeting Marseille, France 09-11 April 2008 SCIENTIFIC PROGRAM Wednesday April 09 18 00 Official opening of the meeting by Project Officer Dr. Florent Bernard 18 15 19 15 Lecture by invited
More informationProteins are not rigid structures: Protein dynamics, conformational variability, and thermodynamic stability
Proteins are not rigid structures: Protein dynamics, conformational variability, and thermodynamic stability Dr. Andrew Lee UNC School of Pharmacy (Div. Chemical Biology and Medicinal Chemistry) UNC Med
More informationBiology Chemistry & Physics of Biomolecules. Examination #1. Proteins Module. September 29, Answer Key
Biology 5357 Chemistry & Physics of Biomolecules Examination #1 Proteins Module September 29, 2017 Answer Key Question 1 (A) (5 points) Structure (b) is more common, as it contains the shorter connection
More informationSupporting Information How does Darunavir prevent HIV-1 protease dimerization?
Supporting Information How does Darunavir prevent HIV- protease dimerization? Danzhi Huang and Amedeo Caflisch a Department of Biochemistry University of Zürich, Winterthurerstrasse 9 CH-7 Zürich, Switzerland
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature17991 Supplementary Discussion Structural comparison with E. coli EmrE The DMT superfamily includes a wide variety of transporters with 4-10 TM segments 1. Since the subfamilies of the
More informationFree energy, electrostatics, and the hydrophobic effect
Protein Physics 2016 Lecture 3, January 26 Free energy, electrostatics, and the hydrophobic effect Magnus Andersson magnus.andersson@scilifelab.se Theoretical & Computational Biophysics Recap Protein structure
More informationSupporting Information for. Models for the Metal Transfer Complex of the N-terminal Region of CusB and. CusF
Supporting Information for Models for the Metal Transfer Complex of the N-terminal Region of CusB and CusF Melek N. Ucisik, Dhruva K. Chakravorty, and Kenneth M. Merz Jr. * Department of Chemistry and
More informationSupporting Information
Supporting Information The Predicted Ensemble of Low-Energy Conformations of Human Somatostatin Receptor Subtype 5 and the Binding of Antagonists Sijia S. Dong, [a] Ravinder Abrol, [a, b] and William A.
More informationSolutions and Non-Covalent Binding Forces
Chapter 3 Solutions and Non-Covalent Binding Forces 3.1 Solvent and solution properties Molecules stick together using the following forces: dipole-dipole, dipole-induced dipole, hydrogen bond, van der
More informationEnhancing Specificity in the Janus Kinases: A Study on the Thienopyridine. JAK2 Selective Mechanism Combined Molecular Dynamics Simulation
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Supporting Information Enhancing Specificity in the Janus Kinases: A Study on the Thienopyridine
More informationUnfolding CspB by means of biased molecular dynamics
Chapter 4 Unfolding CspB by means of biased molecular dynamics 4.1 Introduction Understanding the mechanism of protein folding has been a major challenge for the last twenty years, as pointed out in the
More informationAnalysis of the simulation
Analysis of the simulation Marcus Elstner and Tomáš Kubař January 7, 2014 Thermodynamic properties time averages of thermodynamic quantites correspond to ensemble averages (ergodic theorem) some quantities
More informationMolecular Basis of K + Conduction and Selectivity
The Structure of the Potassium Channel: Molecular Basis of K + Conduction and Selectivity -Doyle, DA, et al. The structure of the potassium channel: molecular basis of K + conduction and selectivity. Science
More informationSUPPLEMENTARY INFORMATION
Figure S1. Secondary structure of CAP (in the camp 2 -bound state) 10. α-helices are shown as cylinders and β- strands as arrows. Labeling of secondary structure is indicated. CDB, DBD and the hinge are
More informationSupplementary Information Intrinsic Localized Modes in Proteins
Supplementary Information Intrinsic Localized Modes in Proteins Adrien Nicolaï 1,, Patrice Delarue and Patrick Senet, 1 Department of Physics, Applied Physics and Astronomy, Rensselaer Polytechnic Institute,
More informationSupplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).
Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted
More informationComputing free energy: Thermodynamic perturbation and beyond
Computing free energy: Thermodynamic perturbation and beyond Extending the scale Length (m) 1 10 3 Potential Energy Surface: {Ri} 10 6 (3N+1) dimensional 10 9 E Thermodynamics: p, T, V, N continuum ls
More informationSupplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases
Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3
More informationSupporting Material for. Microscopic origin of gating current fluctuations in a potassium channel voltage sensor
Supporting Material for Microscopic origin of gating current fluctuations in a potassium channel voltage sensor J. Alfredo Freites, * Eric V. Schow, * Stephen H. White, and Douglas J. Tobias * * Department
More informationSupplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine
Supplementary figure 1. Comparison of unbound and as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine GM-CSF (slate) with bound GM-CSF in the GIF:GM-CSF complex (GIF: green,
More informationProtein Folding Prof. Eugene Shakhnovich
Protein Folding Eugene Shakhnovich Department of Chemistry and Chemical Biology Harvard University 1 Proteins are folded on various scales As of now we know hundreds of thousands of sequences (Swissprot)
More informationMolecular Dynamics Investigation of the ω-current in the Kv1.2 Voltage Sensor Domains
Molecular Dynamics Investigation of the ω-current in the Kv1.2 Voltage Sensor Domains Fatemeh Khalili-Araghi, Emad Tajkhorshid, Benoît Roux, and Klaus Schulten Department of Physics, Department of Biochemistry,
More informationCD Basis Set of Spectra that is used is that derived from comparing the spectra of globular proteins whose secondary structures are known from X-ray
CD Basis Set of Spectra that is used is that derived from comparing the spectra of globular proteins whose secondary structures are known from X-ray crystallography An example of the use of CD Modeling
More informationTu 1,*, , Sweden
Supplementary Material Computational studiess of the binding profile of phosphoinositide PtdIns(,4,5)P with the pleckstrin homology domain d of an oomycetee cellulose synthase Guanglin Kuang 1, Vincent
More informationNB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5
SUPPLEMENTARY TABLES Suppl. Table 1. Protonation states at ph 7.4 and 4.5. Protonation states of titratable residues in GCase at ph 7.4 and 4.5. Histidine: HID, H at δ-nitrogen; HIE, H at ε-nitrogen; HIP,
More informationInsights into Protein Protein Binding by Binding Free Energy Calculation and Free Energy Decomposition for the Ras Raf and Ras RalGDS Complexes
doi:10.1016/s0022-2836(03)00610-7 J. Mol. Biol. (2003) 330, 891 913 Insights into Protein Protein Binding by Binding Free Energy Calculation and Free Energy Decomposition for the Ras Raf and Ras RalGDS
More informationComparing crystal structure of M.HhaI with and without DNA1, 2 (PDBID:1hmy and PDBID:2hmy),
Supporting Information 1. Constructing the starting structure Comparing crystal structure of M.HhaI with and without DNA1, 2 (PDBID:1hmy and PDBID:2hmy), we find that: the RMSD of overall structure and
More informationEssential dynamics sampling of proteins. Tuorial 6 Neva Bešker
Essential dynamics sampling of proteins Tuorial 6 Neva Bešker Relevant time scale Why we need enhanced sampling? Interconvertion between basins is infrequent at the roomtemperature: kinetics and thermodynamics
More informationMolecular Dynamics Simulations of the Mammalian Glutamate Transporter EAAT3
Molecular Dynamics Simulations of the Mammalian Glutamate Transporter EAAT3 Germano Heinzelmann, Serdar Kuyucak* School of Physics, University of Sydney, NSW, Australia Abstract Excitatory amino acid transporters
More informationSupplementary Information
Supplementary Information Resveratrol Serves as a Protein-Substrate Interaction Stabilizer in Human SIRT1 Activation Xuben Hou,, David Rooklin, Hao Fang *,,, Yingkai Zhang Department of Medicinal Chemistry
More informationStructure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27
Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase
More informationComparison between Bacteriorhodopsin and Halorhodopsin. Halorhodopsin (HR) and Bacteriorhodopsin (BR) belong to a subfamily of
Comparison between Bacteriorhodopsin and Halorhodopsin Halorhodopsin (HR) and Bacteriorhodopsin (BR) belong to a subfamily of heptahelical membrane proteins, the archaeal rhodopsins. They are found in
More informationChapter 6 Cyclic urea - a new central unit in bent-core compounds
82 Chapter 6 Cyclic urea - a new central unit in bent-core compounds A new class of five-ring bent-core molecules with a cyclic urea group as a central unit was synthesized [94]. A significant difference
More informationPresenter: She Zhang
Presenter: She Zhang Introduction Dr. David Baker Introduction Why design proteins de novo? It is not clear how non-covalent interactions favor one specific native structure over many other non-native
More informationStructure Investigation of Fam20C, a Golgi Casein Kinase
Structure Investigation of Fam20C, a Golgi Casein Kinase Sharon Grubner National Taiwan University, Dr. Jung-Hsin Lin University of California San Diego, Dr. Rommie Amaro Abstract This research project
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information Active Site Structure and Absorption Spectrum of Channelrhodopsin-2
More informationβ1 Structure Prediction and Validation
13 Chapter 2 β1 Structure Prediction and Validation 2.1 Overview Over several years, GPCR prediction methods in the Goddard lab have evolved to keep pace with the changing field of GPCR structure. Despite
More informationWhy Proteins Fold. How Proteins Fold? e - ΔG/kT. Protein Folding, Nonbonding Forces, and Free Energy
Why Proteins Fold Proteins are the action superheroes of the body. As enzymes, they make reactions go a million times faster. As versatile transport vehicles, they carry oxygen and antibodies to fight
More informationL718Q mutant EGFR escapes covalent inhibition by stabilizing. a non-reactive conformation of the lung cancer drug. osimertinib
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information (ESI) for L718Q mutant EGFR escapes covalent inhibition
More informationInsights into the Biotransformation of 2,4,6- Trinitrotoluene by the Old Yellow Enzyme Family of Flavoproteins. A Computational Study
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2019 Supporting Information for Insights into the Biotransformation of 2,4,6- Trinitrotoluene
More informationCooperativity and Specificity of Cys 2 His 2 Zinc Finger Protein-DNA Interactions: A Molecular Dynamics Simulation Study
7662 J. Phys. Chem. B 2010, 114, 7662 7671 Cooperativity and Specificity of Cys 2 His 2 Zinc Finger Protein-DNA Interactions: A Molecular Dynamics Simulation Study Juyong Lee, Jin-Soo Kim, and Chaok Seok*
More informationChapter 4. Glutamic Acid in Solution - Correlations
Chapter 4 Glutamic Acid in Solution - Correlations 4. Introduction Glutamic acid crystallises from aqueous solution, therefore the study of these molecules in an aqueous environment is necessary to understand
More informationLipid Regulated Intramolecular Conformational Dynamics of SNARE-Protein Ykt6
Supplementary Information for: Lipid Regulated Intramolecular Conformational Dynamics of SNARE-Protein Ykt6 Yawei Dai 1, 2, Markus Seeger 3, Jingwei Weng 4, Song Song 1, 2, Wenning Wang 4, Yan-Wen 1, 2,
More informationChemical properties that affect binding of enzyme-inhibiting drugs to enzymes
Introduction Chemical properties that affect binding of enzyme-inhibiting drugs to enzymes The production of new drugs requires time for development and testing, and can result in large prohibitive costs
More informationStructural study of fluorescence-quenching tryptophan residues in γ-crystallin. Technical Report, April 2007
Structural study of fluorescence-quenching tryptophan residues in γ-crystallin Technical Report, April 2007 Grigore D. Pintilie 1, J. A. King 2 1 Electrical Engineering and Computer Science, Massachusetts
More informationSupporting Information
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2016 Supporting Information Lipid molecules can induce an opening of membrane-facing
More informationDimer Dissociation of a Photoreceptor Protein from QM/MM and MD Simulations
Dimer Dissociation of a Photoreceptor Protein from QM/MM and MD Simulations IMA University of Minnesota Minneapolis, MN, July 20, 2015 Haisheng Ren Advisor: Prof. Jiali Gao Department of Chemistry, University
More informationTheory and Applications of Residual Dipolar Couplings in Biomolecular NMR
Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Residual Dipolar Couplings (RDC s) Relatively new technique ~ 1996 Nico Tjandra, Ad Bax- NIH, Jim Prestegard, UGA Combination of
More informationSGE is excited to launch a new HPLC product line under the ProteCol brand.
The Role of Pore Size in Reversed Phase HPLC SGE is excited to launch a new HPLC product line under the ProteCol brand. Fundamental to the new ProteCol line of columns is the continued focus on inert column
More informationElectro-Mechanical Conductance Modulation of a Nanopore Using a Removable Gate
Electro-Mechanical Conductance Modulation of a Nanopore Using a Removable Gate Shidi Zhao a, Laura Restrepo-Pérez b, Misha Soskine c, Giovanni Maglia c, Chirlmin Joo b, Cees Dekker b and Aleksei Aksimentiev
More informationTracking Protein Allostery in Evolution
Tracking Protein Allostery in Evolution Glycogen phosphorylase frees sugars to provide energy GP orthologs diverged 600,000,000 years can respond to transcription controls, metabolite concentrations and
More informationMD Simulation in Pose Refinement and Scoring Using AMBER Workflows
MD Simulation in Pose Refinement and Scoring Using AMBER Workflows Yuan Hu (On behalf of Merck D3R Team) D3R Grand Challenge 2 Webinar Department of Chemistry, Modeling & Informatics Merck Research Laboratories,
More informationCurrent address: Department of Chemistry, Hong Kong Baptist University, Kowloon Tong, Hong Kong,
Hydrolysis of Cisplatin - A Metadynamics Study Supporting Information Justin Kai-Chi Lau a and Bernd Ensing* b Department of Chemistry and Applied Bioscience, ETH Zurich, USI Campus, Computational Science,
More informationMolecular mechanism of selective transport across the Nuclear Pore Complex
Molecular mechanism of selective transport across the Nuclear Pore Complex David Winogradoff and Aleksei Aksimentiev Physics Department, University of Illinois at Urbana-Champaign May 16, 2017 The Nuclear
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Chemical structure of LPS and LPS biogenesis in Gram-negative bacteria. a. Chemical structure of LPS. LPS molecule consists of Lipid A, core oligosaccharide and O-antigen. The polar
More informationMARTINI simulation details
S1 Appendix MARTINI simulation details MARTINI simulation initialization and equilibration In this section, we describe the initialization of simulations from Main Text section Residue-based coarsegrained
More informationChemical properties that affect binding of enzyme-inhibiting drugs to enzymes
Chemical properties that affect binding of enzyme-inhibiting drugs to enzymes Introduction The production of new drugs requires time for development and testing, and can result in large prohibitive costs
More informationSolutions to Assignment #4 Getting Started with HyperChem
Solutions to Assignment #4 Getting Started with HyperChem 1. This first exercise is meant to familiarize you with the different methods for visualizing molecules available in HyperChem. (a) Create a molecule
More informationTable 1. Kinetic data obtained from SPR analysis of domain 11 mutants interacting with IGF-II. Kinetic parameters K D 1.
Kinetics and Thermodynamics of the Insulin-like Growth Factor II (IGF-II) Interaction with IGF-II/Mannose 6-phosphate Receptor and the function of CD and AB Loop Solvent-exposed Residues. Research Team:
More informationSupporting Information
Supporting Information Decoding Allosteric Networks in Biocatalysts: Rational Approach to Therapies and Biotechnologies Johannes T. Cramer 1,2, Jana I. Führing 1, Petra Baruch 2, Christian Brütting 3,
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting
More informationStructural Perspectives on Drug Resistance
Structural Perspectives on Drug Resistance Irene Weber Departments of Biology and Chemistry Molecular Basis of Disease Program Georgia State University Atlanta, GA, USA What have we learned from 20 years
More informationBCMP 201 Protein biochemistry
BCMP 201 Protein biochemistry BCMP 201 Protein biochemistry with emphasis on the interrelated roles of protein structure, catalytic activity, and macromolecular interactions in biological processes. The
More informationBiotechnology of Proteins. The Source of Stability in Proteins (III) Fall 2015
Biotechnology of Proteins The Source of Stability in Proteins (III) Fall 2015 Conformational Entropy of Unfolding It is The factor that makes the greatest contribution to stabilization of the unfolded
More informationFocus on PNA Flexibility and RNA Binding using Molecular Dynamics and Metadynamics
SUPPLEMENTARY INFORMATION Focus on PNA Flexibility and RNA Binding using Molecular Dynamics and Metadynamics Massimiliano Donato Verona 1, Vincenzo Verdolino 2,3,*, Ferruccio Palazzesi 2,3, and Roberto
More informationWhat makes a good graphene-binding peptide? Adsorption of amino acids and peptides at aqueous graphene interfaces: Electronic Supplementary
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 21 What makes a good graphene-binding peptide? Adsorption of amino acids and
More informationInterpreting and evaluating biological NMR in the literature. Worksheet 1
Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively
More informationSUPPLEMENTARY INFORMATION. doi: /nature07461
Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of
More informationAlpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University
Alpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University Department of Chemical Engineering Program of Applied and
More informationUniversity of Bremen and Jacobs University Bremen, June 15 26, A: Simulation of biological systems and their functionalization
Program of the International WE Heraeus Summer School ``Quantum and Classical Simulation of Biological Systems and their Interaction with Technical Materials University of Bremen and Jacobs University
More informationPROTEIN STRUCTURE AMINO ACIDS H R. Zwitterion (dipolar ion) CO 2 H. PEPTIDES Formal reactions showing formation of peptide bond by dehydration:
PTEI STUTUE ydrolysis of proteins with aqueous acid or base yields a mixture of free amino acids. Each type of protein yields a characteristic mixture of the ~ 20 amino acids. AMI AIDS Zwitterion (dipolar
More informationStructural basis for catalytically restrictive dynamics of a high-energy enzyme state
Supplementary Material Structural basis for catalytically restrictive dynamics of a high-energy enzyme state Michael Kovermann, Jörgen Ådén, Christin Grundström, A. Elisabeth Sauer-Eriksson, Uwe H. Sauer
More informationAffinity and Specificity of Protein U1A-RNA Complex Formation Based on an Additive Component Free Energy Model
doi:10.1016/j.jmb.2007.06.003 J. Mol. Biol. (2007) 371, 1405 1419 Affinity and Specificity of Protein U1A-RNA Complex Formation Based on an Additive Component Free Energy Model Bethany L. Kormos 1, Yulia
More informationHow is molecular dynamics being used in life sciences? Davide Branduardi
How is molecular dynamics being used in life sciences? Davide Branduardi davide.branduardi@schrodinger.com Exploring molecular processes with MD Drug discovery and design Protein-protein interactions Protein-DNA
More informationDISCRETE TUTORIAL. Agustí Emperador. Institute for Research in Biomedicine, Barcelona APPLICATION OF DISCRETE TO FLEXIBLE PROTEIN-PROTEIN DOCKING:
DISCRETE TUTORIAL Agustí Emperador Institute for Research in Biomedicine, Barcelona APPLICATION OF DISCRETE TO FLEXIBLE PROTEIN-PROTEIN DOCKING: STRUCTURAL REFINEMENT OF DOCKING CONFORMATIONS Emperador
More informationHands-on Course in Computational Structural Biology and Molecular Simulation BIOP590C/MCB590C. Course Details
Hands-on Course in Computational Structural Biology and Molecular Simulation BIOP590C/MCB590C Emad Tajkhorshid Center for Computational Biology and Biophysics Email: emad@life.uiuc.edu or tajkhors@uiuc.edu
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen Transverse Relaxation Ensemble
More information6 Hydrophobic interactions
The Physics and Chemistry of Water 6 Hydrophobic interactions A non-polar molecule in water disrupts the H- bond structure by forcing some water molecules to give up their hydrogen bonds. As a result,
More informationLecture 34 Protein Unfolding Thermodynamics
Physical Principles in Biology Biology 3550 Fall 2018 Lecture 34 Protein Unfolding Thermodynamics Wednesday, 21 November c David P. Goldenberg University of Utah goldenberg@biology.utah.edu Clicker Question
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
More informationDensity Functional Theory: from theory to Applications
Density Functional Theory: from theory to Applications Uni Mainz May 27, 2012 Large barrier-activated processes time-dependent bias potential extended Lagrangian formalism Basic idea: during the MD dynamics
More informationActa Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural characterization of the virulence factor Nuclease A from Streptococcus agalactiae
More informationBiochemistry,530:,, Introduc5on,to,Structural,Biology, Autumn,Quarter,2015,
Biochemistry,530:,, Introduc5on,to,Structural,Biology, Autumn,Quarter,2015, Course,Informa5on, BIOC%530% GraduateAlevel,discussion,of,the,structure,,func5on,,and,chemistry,of,proteins,and, nucleic,acids,,control,of,enzyma5c,reac5ons.,please,see,the,course,syllabus,and,
More informationManipulating and Probing Enzymatic Conformational Fluctuations and Enzyme-Substrate Interactions by Single-Molecule FRET- Magnetic Tweezers Microscopy
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2014 Supporting Information (SI) Manipulating and Probing Enzymatic Conformational Fluctuations
More information