Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
|
|
- Jonas Snow
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1 Chemical structure of LPS and LPS biogenesis in Gram-negative bacteria. a. Chemical structure of LPS. LPS molecule consists of Lipid A, core oligosaccharide and O-antigen. The polar part of Lipid A is negatively-changed due to the presence of two phosphate groups. b. Ra-LPS molecule is approximately 32Å in height and 28 Å 12 Å in the other two dimensions. The dimensions of an Ra-LPS is based on the crystal structure of TLR4/MD-2/Ra-LPS complex (PDB ID: 3FXI). c. LPS biogenesis in Gram-negative bacteria. After flipped to the IM outer leaflet by MsbA, LPS is extracted from IM, transported cross the periplasm and finally inserted in the OM by the LptABCDEFG transenvelope complex. LptB 2FG is a quaternary ABC transporter.
2 Supplementary Figure 2 The electron density maps of LptB 2FG. a. Stereo views (cross-eyed) of the 2F o-f c electron density map for the complete LptB2FG complex structure at 3.46Å. b. The 2F o-f c electron density maps of representative regions of the TMDs of LptFG (TM1-LptF and TM1-LptG) are shown. Selenomethionine residues (in red) and bulky residues are used as makers for guiding model building. c-d. Validation of side-chain register of the nucleotide-free LptB 2FG transporter. Anomalous electron density maps define selenomethionine (contour level: 3.0σ) in (c) and Pt sites (contour level: 4.5σ) in (d). In (c), anomalous density was observed for 28 out of 32 selenomethionines of the complete LptB 2FG complex.
3 Supplementary Figure 3 Domain organization of the LptB 2FG complex. a. Domain organization of the LptB 2FG complex. The two ATPase domains (LptB) in cytoplasm are colored in cyan and green. The TMD domains of LptF and LptG, each containing six transmembrane helices, are colored in violet and yellow, respectively. The two periplasmic β-jellyroll domains of LptF and LptG that stem from TM3 and TM4 of LptF(G) are colored in grey. The two coupling helices of LptF and LptG connecting TM2 and TM3 of LptF(G) in cytoplasm are highlighted in blue. b. Overlay of the TMD of LptF with that of LptG. LptF and LptG are colored in violet and yellow, respectively.
4 Supplementary Figure 4 Sequence alignment of LptF homologs and residues selected for functional analysis in the structure. a. Sequence alignment of LptF homologs from five representative Gram-negative bacterial strains. b. Conserved hydrophobic and positive residues of LptF lining the V -shaped cavity selected for mutational studies. Conservation of LptF residues in different Gramnegative homologs is shown in ENDscript. Secondary structures are numbered within the respective domains. Conserved residues lining the inner surface of the V -shaped cavity were selected for mutational analyses are highlighted. The labeled residue types and numbers in both alignments correspond to those in E. coli.
5 Supplementary Figure 5 Sequence alignment of LptG homologs and residues selected for functional analysis in the structure. a. Sequence alignment of LptG homologs from five representative Gram-negative bacterial strains. b. Conserved hydrophobic and positive residues of LptG lining the V -shaped cavity selected for mutational studies. Conservation of LptG residues in different Gramnegative homologs is shown in ENDscript. Secondary structures are numbered within the respective domains. Conserved residues lining the inner surface of the V -shaped cavity were selected for mutational analyses are highlighted. The labeled residue types and numbers in both alignments correspond to those in E. coli.
6 Supplementary Figure 6 Mutagenesis study of the conserved residues that line the inner surface of the V -shaped cavity in the TMDs of LptF and LptG. The growth phenotypes of the lptfg-depleted E. coli strain NR1113 transformed with various hydrophobic-to-hydrophilic LptG_Ec mutants (a) and LptF_Ec mutants (b) on LB agar plates containing 0.1% L-arabinose and 50 μg ml 1 kanamycin. The growth phenotypes of the lptfg-depleted E. coli strain NR1113 transformed with positive-to-negative mutations in the absence of L-aribinose (c), mutant protein expression levels (d) and the growth phenotypes in the presence of 0.1% L-arabinose (e). Mutational analyses of residues from the coupling helices of LptF_Ec and LptG_Ec on LB agar plates containing 0.1% L-arabinose and 50 μg ml 1 kanamycin (f). All labeled residue types and numbers correspond to those of LptF_Ec and LptG_Ec. In the presence of 0.1% L-arabinose, the
7 lptfg-depleted E. coli strain NR1113 transformed with WT, vector control and various mutants all grew well similar to that of WT. In the absence of L-arabinose, the lptfg-depleted E. coli strain NR1113 transformed with pqlink-kan vector and plasmids encoding wild-type (WT) LptFG were used as negative control and positive control, respectively. All the complementation assays were repeated at least three times and a representative result is shown.
8 Supplementary Figure 7 Three representative ABC exporters in their inward-facing or outward-facing conformational states. The nucleotide-free LptB 2FG transporter (a), the heterodimeric TM287-TM288 exporter in the apo state (PDB code: 4Q4H) (b) and the heterodimeric nucleotide-free human sterol ABCG5-ABCG8 exporter (PDB code: 5DO7) (c) in inward-facing conformational state; the homodimeric AMP-PNP-bound Sav1866 exporter (PDB code: 2ONJ) (d) in outward-facing conformational state.
Transmembrane Domains (TMDs) of ABC transporters
Transmembrane Domains (TMDs) of ABC transporters Most ABC transporters contain heterodimeric TMDs (e.g. HisMQ, MalFG) TMDs show only limited sequence homology (high diversity) High degree of conservation
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting
More informationSUPPLEMENTARY INFORMATION
Data collection Supplementary Table 1 Statistics of data collection, phasing and refinement Native Se-MAD Space group P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 50.4, 94.2, 115.4 49.8, 94.2,
More informationIdentification of Residues in the Lipopolysaccharide ABC Transporter That Coordinate ATPase Activity with Extractor Function
RESEARCH ARTICLE crossmark Identification of Residues in the Lipopolysaccharide ABC Transporter That Coordinate ATPase Activity with Extractor Function Brent W. Simpson, a Tristan W. Owens, b Matthew J.
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the
More informationSupplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2
More informationSUPPLEMENTARY INFORMATION
www.nature.com/nature 1 Figure S1 Sequence alignment. a Structure based alignment of the plgic of E. chrysanthemi (ELIC), the acetylcholine binding protein from the snail Lymnea stagnalis (AchBP, PDB code
More informationSupplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached
Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached to HpUreI. Urea hydrolysis products 2NH 3 and 1CO 2
More informationSupplemental Data SUPPLEMENTAL FIGURES
Supplemental Data CRYSTAL STRUCTURE OF THE MG.ADP-INHIBITED STATE OF THE YEAST F 1 C 10 ATP SYNTHASE Alain Dautant*, Jean Velours and Marie-France Giraud* From Université Bordeaux 2, CNRS; Institut de
More informationSupplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a
Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a series of tmfret-pairs comprised of single cysteine mutants
More informationImpact of the crystallization condition on importin-β conformation
Supporting information Volume 72 (2016) Supporting information for article: Impact of the crystallization condition on importin-β conformation Marcel J. Tauchert, Clément Hémonnot, Piotr Neumann, Sarah
More informationTransporters and Membrane Motors Nov 15, 2007
BtuB OM vitamin B12 transporter F O F 1 ATP synthase Human multiple drug resistance transporter P-glycoprotein Transporters and Membrane Motors Nov 15, 2007 Transport and membrane motors Concentrations
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10955 Supplementary Figures Supplementary Figure 1. Electron-density maps and crystallographic dimer structures of the motor domain. (a f) Stereo views of the final electron-density maps
More informationSupplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).
Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1: Data collection, phasing and refinement statistics ChbC/Ta 6 Br 12 Native ChbC Data collection Space group P4 3 2 1 2 P4 3 2 1 2 Cell dimensions a, c (Å) 132.75, 453.57 132.81, 452.95
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.
More informationPlasmid Relevant features Source. W18N_D20N and TrXE-W18N_D20N-anti
Table S1. E. coli plasmids Plasmid Relevant features Source pdg680 T. reesei XynII AA 2-190 with C-terminal His 6 tag optimized for E. coli expression in pjexpress401 Wan et al. (in press) psbn44d psbn44h
More informationPeriplasmic folding factors in Gram-negative bacteria
Periplasmic folding factors in Gram-negative bacteria Tom Ewing 3367274 Master s thesis Molecular and Cellular Life Sciences Utrecht University Examiner: Prof. Dr. Jan Tommassen Second Reviewer: Dr. Hans
More informationStructure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex
Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin
More informationSupporting Information
Supporting Information Sana et al. 10.1073/pnas.1608858113 Fig. S1. Representation of the SPI-6 type VI secretion system. (A) Representation of the SPI-6 genetic locus starting at STM0266 and ending at
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group
More informationExpanded View Figures
The EMBO Journal Structure of a Dm peptide bound to the OT module Tobias Raisch et al Expanded View Figures A Hs Dm 262 297 685 8 HEAT HEAT MIF4G 9BD 1SHD 761 91 193 169 1152 1317 16 1376 1467 HEAT HEAT
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature17991 Supplementary Discussion Structural comparison with E. coli EmrE The DMT superfamily includes a wide variety of transporters with 4-10 TM segments 1. Since the subfamilies of the
More informationDecoupling catalytic activity from biological function of the ATPase that powers lipopolysaccharide transport
Decoupling catalytic activity from biological function of the ATPase that powers lipopolysaccharide transport The Harvard community has made this article openly available. Please share how this access
More informationStructural characterization of NiV N 0 P in solution and in crystal.
Supplementary Figure 1 Structural characterization of NiV N 0 P in solution and in crystal. (a) SAXS analysis of the N 32-383 0 -P 50 complex. The Guinier plot for complex concentrations of 0.55, 1.1,
More informationSUPPLEMENTARY INFORMATION. doi: /nature07461
Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1737 Supplementary Table 1 variant Description FSEC - 2B12 a FSEC - 6A1 a K d (leucine) c Leucine uptake e K (wild-type like) K (Y18F) K (TS) K (TSY) K288A mutant, lipid facing side chain
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11744 Supplementary Table 1. Crystallographic data collection and refinement statistics. Wild-type Se-Met-BcsA-B SmCl 3 -soaked EMTS-soaked Data collection Space
More informationSupplementary information
Supplementary information The structural basis of modularity in ECF-type ABC transporters Guus B. Erkens 1,2, Ronnie P-A. Berntsson 1,2, Faizah Fulyani 1,2, Maria Majsnerowska 1,2, Andreja Vujičić-Žagar
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/5/243/ra68/dc1 Supplementary Materials for Superbinder SH2 Domains Act as Antagonists of Cell Signaling Tomonori Kaneko, Haiming Huang, Xuan Cao, Xing Li, Chengjun
More informationBiophysics 490M Project
Biophysics 490M Project Dan Han Department of Biochemistry Structure Exploration of aa 3 -type Cytochrome c Oxidase from Rhodobacter sphaeroides I. Introduction: All organisms need energy to live. They
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),
More informationNitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein
Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08
More informationMembrane proteins Porins: FadL. Oriol Solà, Dimitri Ivancic, Daniel Folch, Marc Olivella
Membrane proteins Porins: FadL Oriol Solà, Dimitri Ivancic, Daniel Folch, Marc Olivella INDEX 1. INTRODUCTION TO MEMBRANE PROTEINS 2. FADL: OUTER MEMBRANE TRANSPORT PROTEIN 3. MAIN FEATURES OF FADL STRUCTURE
More informationSupplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases
Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3
More informationStructural basis for antibacterial peptide self-immunity by the bacterial ABC transporter McjD
Article Structural basis for antibacterial peptide self-immunity by the bacterial ABC transporter McjD Kiran Bountra 1,2,, Gregor Hagelueken 3,, Hassanul G Choudhury 1,2,, Valentina Corradi 4, Kamel El
More informationIntroduction to Comparative Protein Modeling. Chapter 4 Part I
Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature
More informationof the Guanine Nucleotide Exchange Factor FARP2
Structure, Volume 21 Supplemental Information Structural Basis for Autoinhibition of the Guanine Nucleotide Exchange Factor FARP2 Xiaojing He, Yi-Chun Kuo, Tyler J. Rosche, and Xuewu Zhang Inventory of
More informationSUPPLEMENTARY INFORMATION
Fig. 1 Influences of crystal lattice contacts on Pol η structures. a. The dominant lattice contact between two hpol η molecules (silver and gold) in the type 1 crystals. b. A close-up view of the hydrophobic
More informationP. syringae and E. coli
CHAPTER 6 A comparison of the recd mutant phenotypes of P. syringae and E. coli 6.1 INTRODUCTION The RecBCD complex is essential for recombination mediated repair of double strand breaks (DSBs) of DNA
More informationABC transporters use the energy of ATP binding and hydrolysis
Crystal structure and mechanistic basis of a functional homolog of the antigen transporter TAP Anne Nöll a,1, Christoph Thomas a,1, Valentina Herbring a,1, Tina Zollmann a, Katja Barth a,b, Ahmad Reza
More informationSUPPLEMENTARY INFORMATION
Figure S1. Secondary structure of CAP (in the camp 2 -bound state) 10. α-helices are shown as cylinders and β- strands as arrows. Labeling of secondary structure is indicated. CDB, DBD and the hinge are
More informationStructure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps
Cell Reports Supplemental Information Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps Chih-Chia Su, Jani Reddy Bolla, Nitin Kumar, Abhijith Radhakrishnan,
More informationEquilibrated atomic models of outward-facing P-glycoprotein and effect of ATP binding on structural dynamics (Supplementary Information)
Equilibrated atomic models of outward-facing P-glycoprotein and effect of ATP binding on structural dynamics (Supplementary Information) Lurong Pan 1 and Stephen G. Aller 2 * 1,2 Department of Pharmacology
More informationAntimicrobial peptides
Název: Školitel: Antimicrobial peptides Zbyněk Heger Datum: 2. 8. 2013 Reg.č.projektu: CZ.1.07/2.4.00/31.0023 Název projektu: Partnerská síť centra excelentního bionanotechnologického výzkumu 2 Content
More informationSupplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization
Supplementary Information Structural basis for precursor protein-directed ribosomal peptide macrocyclization Kunhua Li 1,3, Heather L. Condurso 1,3, Gengnan Li 1, Yousong Ding 2 and Steven D. Bruner 1*
More informationTHE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina
More informationBiochemistry. Biochemistry 9/20/ Bio-Energetics. 4.2) Transport of ions and small molecules across cell membranes
9/20/15 Biochemistry Biochemistry 4. Bio-Energetics 4.2) Transport of ions and small molecules across cell membranes Aquaporin, the water channel, consists of four identical transmembrane polypeptides
More informationBiochemistry. Biochemistry 7/11/ Bio-Energetics. 4.2) Transport of ions and small molecules across cell membranes
Biochemistry Biochemistry 4. Bio-Energetics 4.2) Transport of ions and small molecules across cell membranes Aquaporin, the water channel, consists of four identical transmembrane polypeptides Key Energy
More informationSupplementary Figure S1. MscS orientation in spheroplasts and liposomes (a) Current-voltage relationship for wild-type MscS expressed in E.
a b c Supplementary Figure S1. MscS orientation in spheroplasts and liposomes (a) Current-voltage relationship for wild-type MscS expressed in E. coli giant spheroplasts (MJF465) and reconstituted into
More informationCks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved
Cks1 d CKS1 Supplementary Figure 1 The -Cks1 crystal lattice. (a) Schematic of the - Cks1 crystal lattice. -Cks1 crystallizes in a lattice that contains c 4 copies of the t - Cks1 dimer in the crystallographic
More informationm1 m2 m3 m4 m5 m6 m7 m8 wt m m m m m m m m8 - + wt +
otherwise, you couldn't grow them!) You perform pairwise infections with each of your mutant bacteriophage strains and get the following results: (+) = pair of phages lysed host cells, (-) = pair of phages
More informationReview. Membrane proteins. Membrane transport
Quiz 1 For problem set 11 Q1, you need the equation for the average lateral distance transversed (s) of a molecule in the membrane with respect to the diffusion constant (D) and time (t). s = (4 D t) 1/2
More informationMicrobial Genetics, Mutation and Repair. 2. State the function of Rec A proteins in homologous genetic recombination.
Answer the following questions 1. Define genetic recombination. Microbial Genetics, Mutation and Repair 2. State the function of Rec A proteins in homologous genetic recombination. 3. List 3 types of bacterial
More informationTable 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2
Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell
More informationSUPPLEMENTARY INFORMATION
Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3
More informationSupplementary Figure 1 Structure of the Orai channel. (a) The hexameric Drosophila Orai channel structure derived from crystallography 1 comprises
Supplementary Figure 1 Structure of the Orai channel. (a) The hexameric Drosophila Orai channel structure derived from crystallography 1 comprises six Orai subunits, each with identical amino acid sequences
More informationRNA Polymerase I Contains a TFIIF-Related DNA-Binding Subcomplex
Molecular Cell, Volume 39 Supplemental Information RNA Polymerase I Contains a TFIIFRelated DNABinding Subcomplex Sebastian R. Geiger, Kristina Lorenzen, Amelie Schreieck, Patrizia Hanecker, Dirk Kostrewa,
More informationNB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5
SUPPLEMENTARY TABLES Suppl. Table 1. Protonation states at ph 7.4 and 4.5. Protonation states of titratable residues in GCase at ph 7.4 and 4.5. Histidine: HID, H at δ-nitrogen; HIE, H at ε-nitrogen; HIP,
More informationSUPPLEMENTARY INFORMATION
Supplementary Table S1 Kinetic Analyses of the AMSH-LP mutants AMSH-LP K M (μm) k cat x 10-3 (s -1 ) WT 71.8 ± 6.3 860 ± 65.4 T353A 76.8 ± 11.7 46.3 ± 3.7 F355A 58.9 ± 10.4 5.33 ± 0.30 proximal S358A 75.1
More informationIt s really this simple.
Background Light harvesting complexes exist to facilitate and maximize the absorption capacity of the reaction centers (RC) as well as PSI and PSII Purple bacteria utilize these functions by having an
More informationCryo-EM data collection, refinement and validation statistics
1 Table S1 Cryo-EM data collection, refinement and validation statistics Data collection and processing CPSF-160 WDR33 (EMDB-7114) (PDB 6BM0) CPSF-160 WDR33 (EMDB-7113) (PDB 6BLY) CPSF-160 WDR33 CPSF-30
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Cryo-EM structure and model of the C. thermophilum 90S preribosome. a, Gold standard FSC curve showing the average resolution of the 90S preribosome masked and unmasked (left). FSC
More informationStructural insights into bacterial flagellar hooks similarities and specificities
Supplementary information Structural insights into bacterial flagellar hooks similarities and specificities Young-Ho Yoon, Clive S. Barker, Paula V. Bulieris, Hideyuki Matsunami, Fadel A. Samatey* Affiliation:
More informationSUPPLEMENTARY INFORMATION
Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.
More informationSUPPLEMENTARY INFORMATION
Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase
More informationSI Text S1 Solution Scattering Data Collection and Analysis. SI references
SI Text S1 Solution Scattering Data Collection and Analysis. The X-ray photon energy was set to 8 kev. The PILATUS hybrid pixel array detector (RIGAKU) was positioned at a distance of 606 mm from the sample.
More informationSupplementary Information: Table S1. Potential energy and essential dynamics (ED) analysis of the MD simulations of the Bcl-2 complexes under study.
Supplementary Information: Table S1. Potential energy and essential dynamics (ED) analysis of the MD simulations of the Bcl-2 complexes under study. Bcl2 and complex Potential energy (kj/mol) ED 2D projection
More informationSupporting Information
Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)
More informationTable S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1: The HpUreI crystal used for collection of native diffraction data. The crystal belongs to spacegroup P4 2 2 1 2 and has an approximate maximal dimension of 0.25 mm. Supplementary
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationStructure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27
Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase
More informationT H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp
S u p p l e m e n ta l m at e r i a l jgp Lee et al., http://www.jgp.org/cgi/content/full/jgp.201411219/dc1 T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y S u p p l e m e n ta l D I S C U S
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1)
MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) 1) Which of the following statements about the atom A) It has 12 neutrons in its nucleus. B) It
More informationActa Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural characterization of the virulence factor Nuclease A from Streptococcus agalactiae
More informationSensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Figure 2.1
Exam Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Figure 2.1 1) Which compound in Figure 2.1 is an ester? 1) A) a b c d e Answer: D 2) A scientist
More informationStructure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits AhpC and AhpF from Escherichia coli Phat Vinh Dip 1,#, Neelagandan Kamariah 2,#, Malathy Sony Subramanian Manimekalai
More informationBuilding a Homology Model of the Transmembrane Domain of the Human Glycine α-1 Receptor
Building a Homology Model of the Transmembrane Domain of the Human Glycine α-1 Receptor Presented by Stephanie Lee Research Mentor: Dr. Rob Coalson Glycine Alpha 1 Receptor (GlyRa1) Member of the superfamily
More informationSupplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine
Supplementary figure 1. Comparison of unbound and as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine GM-CSF (slate) with bound GM-CSF in the GIF:GM-CSF complex (GIF: green,
More informationRho1 binding site PtdIns(4,5)P2 binding site Both sites
localization Mutation site DMSO LatB WT F77A I115A I131A K134A Rho1 binding site PtdIns(4,5)P2 binding site Both sites E186A E199A N201A R84A-E186A-E199A L131A-K136A-E186A L131A-E186A-E199A K136A-E186A-E199A
More informationNature Structural & Molecular Biology doi: /nsmb Supplementary Figure 1. CRBN binding assay with thalidomide enantiomers.
Supplementary Figure 1 CRBN binding assay with thalidomide enantiomers. (a) Competitive elution assay using thalidomide-immobilized beads coupled with racemic thalidomide. Beads were washed three times
More informationSUPPLEMENTARY INFORMATION
SUPPLMTARY IFORMATIO a doi:10.108/nature10402 b 100 nm 100 nm c SAXS Model d ulers assigned to reference- Back-projected free class averages class averages Refinement against single particles Reconstructed
More informationStructure and mechanism of an intramembrane liponucleotide synthetase central for phospholipid biosynthesis
Structure and mechanism of an intramembrane liponucleotide synthetase central for phospholipid biosynthesis Xiuying Liu 1,3, Yan Yin 1,2,3, Jinjun Wu 1 and Zhenfeng Liu 1 1 National Laboratory of Biomacromolecules,
More informationMechanistic insight into inhibition of two-component system signaling
Supporting Information Mechanistic insight into inhibition of two-component system signaling Samson Francis, a Kaelyn E. Wilke, a Douglas E. Brown a and Erin E. Carlson a,b* a Department of Chemistry,
More informationThesis By. Neena Sujata Kadaba. In Partial Fulfillment of the Requirements for the. degree of. Doctor of Philosophy CALIFORNIA INSTITUTE OF TECHNOLOGY
STRUCTURAL STUDIES OF THE E.COLI METHIONINE ABC TRANSPORTER AND ITS COGNATE BINDING PROTEIN Thesis By Neena Sujata Kadaba In Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy
More informationThe sodium-dependent D-glucose transport protein of Helicobacter pylori. Supplementary information
The sodium-dependent D-glucose transport protein of Helicobacter pylori Georgios Psakis 1, 2, 3, Massoud Saidijam 1, 4, Keigo Shibayama 1,5, Julia Polaczek 2, Kim E. Bettaney 1, Jocelyn Baldwin 1, Stephen
More informationScale in the biological world
Scale in the biological world 2 A cell seen by TEM 3 4 From living cells to atoms 5 Compartmentalisation in the cell: internal membranes and the cytosol 6 The Origin of mitochondria: The endosymbion hypothesis
More informationStructure of the SPRY domain of human DDX1 helicase, a putative interaction platform within a DEAD-box protein
Supporting information Volume 71 (2015) Supporting information for article: Structure of the SPRY domain of human DDX1 helicase, a putative interaction platform within a DEAD-box protein Julian Kellner
More informationSupplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer
More informationMONTGOMERY COUNTY COMMUNITY COLLEGE BIO 140 CHAPTER 4. Functional Anatomy of Prokaryotic and Eukaryotic Cells
MONTGOMERY COUNTY COMMUNITY COLLEGE BIO 140 CHAPTER 4 Functional Anatomy of Prokaryotic and Eukaryotic Cells I. PROKARYOTES A. Structure Of The Cell: Chemical Composition And Function 1. Cell Wall a. composition
More informationSupporting online material
Supporting online material Materials and Methods Target proteins All predicted ORFs in the E. coli genome (1) were downloaded from the Colibri data base (2) (http://genolist.pasteur.fr/colibri/). 737 proteins
More informationpglo/amp R Bacterial Transformation Lab
pglo/amp R Bacterial Transformation Lab Name: Date: Purpose: To gain an understanding of the techniques of culturing E. coli bacteria and transforming E. coli bacteria using genetic engineering. Introduction:
More informationSupporting Information
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2016 Supporting Information Lipid molecules can induce an opening of membrane-facing
More informationMsbA ATP-binding cassette (ABC) transporter of E. coli: Structure and possible flippase mechanism
Indian Journal of Biochemistry & Biophysics Vol. 48, February 2011, pp. 7-13 Minireview MsbA ATP-binding cassette (ABC) transporter of E. coli: Structure and possible flippase mechanism Gautam Kaul * and
More information