Plasmid Relevant features Source. W18N_D20N and TrXE-W18N_D20N-anti
|
|
|
- Crystal Lee
- 5 years ago
- Views:
Transcription
1 Table S1. E. coli plasmids Plasmid Relevant features Source pdg680 T. reesei XynII AA with C-terminal His 6 tag optimized for E. coli expression in pjexpress401 Wan et al. (in press) psbn44d psbn44h psbn44v psbv46l psbw18n/d20n psba175l psba175s psba175v pdg680 modified with s TrXE-N44D and TrXE-N44D-anti pdg680 modified with s TrXE-N44H and TrXE-N44H-anti pdg680 modified with s TrXE-N44V and TrXE-N44V-anti pdg680 modified with s TrXE-V46L and TrXE-V46L-anti pdg680 modified with s TrXE- W18N_D20N and TrXE-W18N_D20N-anti pdg680 modified with s TrXE-A175L and TrXE-A175L-anti pdg680 modified with s TrXE-A175S and TrXE-A175S-anti pdg680 modified with s TrXE-A175V and TrXE-A175V-anti Wan et al. (in press) Wan et al. (in press) This study This study This study This study This study This study
2 Table S2. Oligonucleotide s used for site-directed mutagenesis Primer name Sequence Function TrXE- W18N_D20N TrXE- W18N_D20N-anti ACGGCTACTTCTACTCCTACAATAATAACGGTCACGGTGGTGTCACC GGTGACACCACCGTGACCGTTATTATTGTAGGAGTAGAAGTAGCCGT W18N & D20N sense W18N & D20N antisense TrXE-N44D ATTGGTCTAACAGCGGCGACTTTGTGGGTGGTAAG N44D sense TrXE-N44D-anti CTTACCACCCACAAAGTCGCCGCTGTTAGACCAAT N44D antisense TrXE-N44H ATTGGTCTAACAGCGGCCACTTTGTGGGTGGTAAG N44H sense TrXE-N44H-anti CTTACCACCCACAAAGTGGCCGCTGTTAGACCAAT N44H antisense TrXE-N44V AATTGGTCTAACAGCGGCGTCTTTGTGGGTGGTAAGGG N44V sense TrXE-N44V-anti CCCTTACCACCCACAAAGACGCCGCTGTTAGACCAATT N44V antisense TrXE-V46L TGGTCTAACAGCGGCAACTTTTTGGGTGGTAAGG V46L sense TrXE-V46L-anti CCTTACCACCCAAAAAGTTGCCGCTGTTAGACCA V46L antisense TrXE-A175L TrXE-A175L-anti GTACTATGGATTACCAGATTGTGCTAGTTGAAGGTTATTTCTCTAGC GG CCGCTAGAGAAATAACCTTCAACTAGCACAATCTGGTAATCCATAGT AC A175L sense A175L antisense TrXE-A175S TACTATGGATTACCAGATTGTGAGCGTTGAAGGTTATTTCTCTAGC A175S sense TrXE-A175S-anti GCTAGAGAAATAACCTTCAACGCTCACAATCTGGTAATCCATAGTA A175S antisense TrXE-A175V CTATGGATTACCAGATTGTGGTCGTTGAAGGTTATTTCTCTAG A175V sense TrXE-A175V-anti CTAGAGAAATAACCTTCAACGACCACAATCTGGTAATCCATAG A175V antisense ptf CTCGAAAATAATAAAGGGAAAATCAG 5 sequencing ptr TGGTAGTGTGGGGACTC 3 sequencing 5TrXynIIN GGAGATAAAACATATGACGATC 5 XynII 3TrXynIIN CCGCGGATCCTTAGCTCACGGTAATGCTTGCGC 3 XynII
3 Table S3. Data collection and refinement statistics. Crystals E177Q-X6 N44H-X3 apo-n44h XynII-TrisX2- apo-e177q X3 Data Collection space group P P P P2 1 P unit cell dimensions(å) a=38.5 b=45.5 c=111.4 a=42.4 b=59.6 c=62.1 a=48.3 b=59.0 c=69.7 a=41.88 b=38.43 c=56.32 a=48.2 b=59.2 c=69.7 α=β=γ=90º α=β=γ=90º α=β=γ=90º β=105.9º α=β=γ=90º molecules per asu wavelength (Å) resolution (Å) ( ) ( ) ( ) ( ) ( ) unique reflections (2967) (1141) (3947) (1087) (2066) redundancy 6.5 (6.9) a 3.8 (3.6) a 4.3(3.7) a 3.8 (2.1) a 3.7 (3.4) a Completeness (%) 90.8 (84.2) a 98.5(99.7) a 99.8 (98.6) a 93.6 (52.2) a 99.6 (97.5) a b R sym (0.622) a 0.099(0.521) a 0.051(0.629) a (0.211) a (0.408) a <I/σ(I)> 27.6 (3.4) a 13.8(2.7) a 26.7(1.9) a 14.9 (3.3) a 15.2 (2.8) a Refinement R work /R free (%) c 11.1 (12.7) a 14.9 (17.9) a 11.9 (12.9) a 15.5 (21.9) a 17.1 (18.6) a RMSD bond 0.012Å/1.485º 0.006Å/1.179º 0.007Å/1.315º 0.008Å/1.150º 0.006Å/1.160º length/angle No. of atoms Protein water xylooligomer glycerol citrate iodide calcium Mean B value (Å 2 ) main chain/ side chain 7.7/ / / / /10.2 water/xylose 25.4/ / /- 28.5/ /- Ramachandran Statistics (%) most favorable allowed disallowed PDB ID 4HK8 4HK9 4HKL 4HKW 4HKO a Numbers in parenthesies represent values in the highest resolution shell. b Rsym=Σ( Ii < I> )/Σ(Ii), where Ii is the measured intensities and <I> is the mean intensity of all measured observations equivalent to reflection Ii. c Rwork=Σ Fobs Fcalc /Σ Fobs, where Fobs are the observed diffraction amplitude, Fcalc is the corresponding calculated structure factor amplitude. Rfree is defined by Rwork, but involved 5% of the measured reflections not used in refinement and set aside for cross-validation purpose.
4 Figure S1. Mercator plot of the xylose unit -1 conformation in Q177N-X6 Michaelis complex showing the departure from 4 C 1 conformation towards O E conformation.
5 2.5 r.m.s.d. of Cα atoms (Å ) Thumb region ( ) E177Q-X6 vs. E177Q apo N44H-X3 vs. N44H apo WT-TrisX2-X3 vs. WT apo E177Q apo vs. WT apo N44H apo vs. WT apo Residues Figure S2. The root mean square deviation (RMSD) of the main-chain atoms between different structures studied.
6 Figure S3. (a) Specific xylan hydrolytic activity of WT and variant XynII proteins at the indicated ph values are shown relative to maximum activities at acidic ph.
7 Figure S3. (b) Rates of p-nitrophenylxylobioside (PNPX2) hydrolytic activity were measured in continuous assays at the indicated ph values using WT and variant XynII proteins.
8 Figure S4. Structural comparison between ligand-free E177Q (green) and E177Q-X6 (red) complexes. The most significantly different region is highlighted in a dashed circle.
9 Figure S5. Structural comparison between ligand-free N44H (gray) and N44H-X3 (blue) complexes. The most significantly different region is highlighted in a dashed circle.
10 Figure S6. Structural comparison between ligand-free WT (orange) and WT-TrisX2-X3 (magenta) complexes. The most significantly different region is highlighted in a dashed circle.
11 Figure S7. Superposition of sugar units of X6 and TrisX2-X3. Ligands are colored by atom type, X6 with cyan carbon atoms and Tris-X2-X3 with yellow carbon atoms.
12 Figure S8. F O F C difference electron density map (contoured at the 3σ level) shows that the reversed orientation of X6 is not correct. The positive density is green, while the negative density is red. The distance between C5 of the -2 xylose and ND2 atom of N71 would be only 2.8 Å in the incorrect oligosaccharide orientation; such an interaction would be repulsive and should not occur, as shown by the X.
SUPPLEMENTARY INFORMATION
Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3
SI Text S1 Solution Scattering Data Collection and Analysis. SI references
SI Text S1 Solution Scattering Data Collection and Analysis. The X-ray photon energy was set to 8 kev. The PILATUS hybrid pixel array detector (RIGAKU) was positioned at a distance of 606 mm from the sample.
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the
SUPPLEMENTARY INFORMATION
Supplementary Table S1 Kinetic Analyses of the AMSH-LP mutants AMSH-LP K M (μm) k cat x 10-3 (s -1 ) WT 71.8 ± 6.3 860 ± 65.4 T353A 76.8 ± 11.7 46.3 ± 3.7 F355A 58.9 ± 10.4 5.33 ± 0.30 proximal S358A 75.1
SUPPLEMENTARY INFORMATION. doi: /nature07461
Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of
SUPPLEMENTARY INFORMATION
Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,
Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein
Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group
SUPPLEMENTARY INFORMATION
Fig. 1 Influences of crystal lattice contacts on Pol η structures. a. The dominant lattice contact between two hpol η molecules (silver and gold) in the type 1 crystals. b. A close-up view of the hydrophobic
Stabilizing the CH2 domain of an Antibody by Engineering in an Enhanced Aromatic Sequon
Stabilizing the CH2 domain of an Antibody by Engineering in an Enhanced Aromatic Sequon Wentao Chen,, Leopold Kong, Stephen Connelly, Julia M. Dendle,, Yu Liu,, Ian A. Wilson,#, Evan T. Powers, *, Jeffery
SUPPLEMENTARY INFORMATION
www.nature.com/nature 1 Figure S1 Sequence alignment. a Structure based alignment of the plgic of E. chrysanthemi (ELIC), the acetylcholine binding protein from the snail Lymnea stagnalis (AchBP, PDB code
Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2
Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell
SUPPLEMENTARY INFORMATION
Supplementary Table 1: Amplitudes of three current levels. Level 0 (pa) Level 1 (pa) Level 2 (pa) TrkA- TrkH WT 200 K 0.01 ± 0.01 9.5 ± 0.01 18.7 ± 0.03 200 Na * 0.001 ± 0.01 3.9 ± 0.01 12.5 ± 0.03 200
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Chemical structure of LPS and LPS biogenesis in Gram-negative bacteria. a. Chemical structure of LPS. LPS molecule consists of Lipid A, core oligosaccharide and O-antigen. The polar
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10458 Active Site Remodeling in the Bifunctional Fructose-1,6- bisphosphate aldolase/phosphatase Juan Du, Rafael F. Say, Wei Lü, Georg Fuchs & Oliver Einsle SUPPLEMENTARY FIGURES Figure
Expanded View Figures
The EMBO Journal Structure of a Dm peptide bound to the OT module Tobias Raisch et al Expanded View Figures A Hs Dm 262 297 685 8 HEAT HEAT MIF4G 9BD 1SHD 761 91 193 169 1152 1317 16 1376 1467 HEAT HEAT
SUPPLEMENTARY INFORMATION
Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase
Structural Mechanism for the Fidelity Modulation of DNA Polymerase λ. 128 Academia Road Sec. 2, Nankang, Taipei, 115, Taiwan
SUPPORTING INFORMATION Structural Mechanism for the Fidelity Modulation of DNA Polymerase λ Mu-Sen Liu, 1,3 Hsin-Yue Tsai, 1,# Xiao-Xia Liu, 1,# Meng-Chiao Ho, 1,3 Wen-Jin Wu, 1,* and Ming-Daw Tsai 1,2,3,*
SUPPLEMENTARY INFORMATION. Structural basis of laminin binding to the LARGE glycans on dystroglycan
SUPPLEMENTARY INFORMATION Structural asis of laminin inding to the LARGE glycans on dystroglycan David C. Briggs 1, Takako Yoshida-Moriguchi 2, Tianqing Zheng 2, David Venzke 2, Mary Anderson 2, Andrea
Supplemental Information. Molecular Basis of Spectral Diversity. in Near-Infrared Phytochrome-Based. Fluorescent Proteins
Chemistry & Biology, Volume 22 Supplemental Information Molecular Basis of Spectral Diversity in Near-Infrared Phytochrome-Based Fluorescent Proteins Daria M. Shcherbakova, Mikhail Baloban, Sergei Pletnev,
FW 1 CDR 1 FW 2 CDR 2
Supplementary Figure 1 Supplementary Figure 1: Interface of the E9:Fas structure. The two interfaces formed by V H and V L of E9 with Fas are shown in stereo. The Fas receptor is represented as a surface
IgE binds asymmetrically to its B cell receptor CD23
Supplementary Information IgE binds asymmetrically to its B cell receptor CD23 Balvinder Dhaliwal 1*, Marie O. Y. Pang 2, Anthony H. Keeble 2,3, Louisa K. James 2,4, Hannah J. Gould 2, James M. McDonnell
Experimental and Computational Mutagenesis to Investigate the. Positioning of a General Base within an Enzyme Active Site
Experimental and Computational Mutagenesis to Investigate the Positioning of a General Base within an Enzyme Active Site Jason P. Schwans, Philip Hanoian, Benjamin J. Lengerich, Fanny Sunden, Ana Gonzalez
Supplementary Figure 1. Biochemical and sequence alignment analyses the
Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).
Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases
Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3
Supplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization
Supplementary Information Structural basis for precursor protein-directed ribosomal peptide macrocyclization Kunhua Li 1,3, Heather L. Condurso 1,3, Gengnan Li 1, Yousong Ding 2 and Steven D. Bruner 1*
New Delhi Metallo-β-Lactamase: Structural Insights into β- Lactam Recognition and Inhibition
Supporting Information New Delhi Metallo-β-Lactamase: Structural Insights into β- Lactam Recognition and Inhibition Dustin T. King, Liam J. Worrall, Robert Gruninger, Natalie C.J. Strynadka* AUTHOR ADDRESS:
Acta Crystallographica Section F
Supporting information Acta Crystallographica Section F Volume 70 (2014) Supporting information for article: Chemical conversion of cisplatin and carboplatin with histidine in a model protein crystallised
Supporting Information. UV-induced ligand exchange in MHC class I protein crystals
Supporting Information for the article entitled UV-induced ligand exchange in MHC class I protein crystals by Patrick H.N. Celie 1, Mireille Toebes 2, Boris Rodenko 3, Huib Ovaa 3, Anastassis Perrakis
Supplemental Information
Supplemental Information Combinatorial Readout of Unmodified H3R2 and Acetylated H3K14 by the Tandem PHD Finger of MOZ Reveals a Regulatory Mechanism for HOXA9 Transcription Yu Qiu 1, Lei Liu 1, Chen Zhao
Supporting Information
Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)
of the Guanine Nucleotide Exchange Factor FARP2
Structure, Volume 21 Supplemental Information Structural Basis for Autoinhibition of the Guanine Nucleotide Exchange Factor FARP2 Xiaojing He, Yi-Chun Kuo, Tyler J. Rosche, and Xuewu Zhang Inventory of
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.
SUPPLEMENTARY INFORMATION
Supplementary Table 1: Data collection, phasing and refinement statistics ChbC/Ta 6 Br 12 Native ChbC Data collection Space group P4 3 2 1 2 P4 3 2 1 2 Cell dimensions a, c (Å) 132.75, 453.57 132.81, 452.95
SUPPLEMENTARY INFORMATION
Dph2 SeMet (iron-free) # Dph2 (iron-free) Dph2-[4Fe-4S] Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 58.26, 82.08, 160.42 58.74, 81.87, 160.01 55.70, 80.53,
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
ENZYME MECHANISMS, PROTEASES, STRUCTURAL BIOLOGY
Supplementary Information SUBJECT AREAS: ENZYME MECHANISMS, PROTEASES, STRUCTURAL BIOLOGY Correspondence and requests for materials should be addressed to N.T. (ntanaka@pharm.showa-u.ac.jp) or W.O. (owataru@vos.nagaokaut.ac.jp)
Acta Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural characterization of the virulence factor Nuclease A from Streptococcus agalactiae
Supplementary Information
Supplementary Information The direct role of selenocysteine in [NiFeSe] hydrogenase maturation and catalysis Marta C. Marques a, Cristina Tapia b, Oscar Gutiérrez-Sanz b, Ana Raquel Ramos a, Kimberly L.
Automated identification of functional dynamic contact networks from X-ray crystallography
1 Automated identification of functional dynamic contact networks from X-ray crystallography Henry van den Bedem, Gira Bhabha, Kun Yang, Peter E. Wright and James S. Fraser Supplementary Figure 1 Supplementary
Supplementary Figure 1. Proposed mechanism for AusE, PrhA, and these mutants. (a) 5 is desaturated
S1 Supplementary Figure 1. Proposed mechanism for AusE, PrhA, and these mutants. (a) 5 is desaturated to form 6 through hydrogen atom abstraction at C-2 followed by the second hydrogen atom abstraction
Electronic Supplementary Information (ESI) for Chem. Commun. Unveiling the three- dimensional structure of the green pigment of nitrite- cured meat
Electronic Supplementary Information (ESI) for Chem. Commun. Unveiling the three- dimensional structure of the green pigment of nitrite- cured meat Jun Yi* and George B. Richter- Addo* Department of Chemistry
Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps
Cell Reports Supplemental Information Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps Chih-Chia Su, Jani Reddy Bolla, Nitin Kumar, Abhijith Radhakrishnan,
Summary of Experimental Protein Structure Determination. Key Elements
Programme 8.00-8.20 Summary of last week s lecture and quiz 8.20-9.00 Structure validation 9.00-9.15 Break 9.15-11.00 Exercise: Structure validation tutorial 11.00-11.10 Break 11.10-11.40 Summary & discussion
Structure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex
Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin
Department of Biochemistry, University of Zürich, Winterthurerstrasse 190, CH-8057 Zürich, Switzerland
Supporting information Twenty crystal structures of bromodomain and PHD finger containing protein 1 (BRPF1)/ligand complexes reveal conserved binding motifs and rare interactions Jian Zhu and Amedeo Caflisch*
Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,
Cryo-EM data collection, refinement and validation statistics
1 Table S1 Cryo-EM data collection, refinement and validation statistics Data collection and processing CPSF-160 WDR33 (EMDB-7114) (PDB 6BM0) CPSF-160 WDR33 (EMDB-7113) (PDB 6BLY) CPSF-160 WDR33 CPSF-30
The structure of a nucleolytic ribozyme that employs a catalytic metal ion. Yijin Liu, Timothy J. Wilson and David M.J. Lilley
SUPPLEMENTARY INFORMATION The structure of a nucleolytic ribozyme that employs a catalytic metal ion Yijin Liu, Timothy J. Wilson and David M.J. Lilley Cancer Research UK Nucleic Acid Structure Research
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10955 Supplementary Figures Supplementary Figure 1. Electron-density maps and crystallographic dimer structures of the motor domain. (a f) Stereo views of the final electron-density maps
Rational Design of Thermodynamic and Kinetic Binding Profiles by. Optimizing Surface Water Networks Coating Protein Bound Ligands
SUPPORTING INFORMATION Rational Design of Thermodynamic and Kinetic Binding Profiles by Optimizing Surface Water Networks Coating Protein Bound Ligands Stefan G. Krimmer,, Jonathan Cramer,, Michael Betz,
Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27
Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase
Supplementary Figures
1 Supplementary Figures Supplementary Figure 1 Type I FGFR1 inhibitors (a) Chemical structures of a pyrazolylaminopyrimidine inhibitor (henceforth referred to as PAPI; PDB-code of the FGFR1-PAPI complex:
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier
Nature Structural and Molecular Biology: doi: /nsmb.2938
Supplementary Figure 1 Characterization of designed leucine-rich-repeat proteins. (a) Water-mediate hydrogen-bond network is frequently visible in the convex region of LRR crystal structures. Examples
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Jan 14, 2019 11:10 AM EST PDB ID : 6GYW Title : Crystal structure of DacA from Staphylococcus aureus Authors : Tosi, T.; Freemont, P.S.; Grundling, A. Deposited
Acta Cryst. (2017). D73, doi: /s
Acta Cryst. (2017). D73, doi:10.1107/s2059798317010932 Supporting information Volume 73 (2017) Supporting information for article: Designing better diffracting crystals of biotin carboxyl carrier protein
Nature Structural & Molecular Biology doi: /nsmb Supplementary Figure 1. CRBN binding assay with thalidomide enantiomers.
Supplementary Figure 1 CRBN binding assay with thalidomide enantiomers. (a) Competitive elution assay using thalidomide-immobilized beads coupled with racemic thalidomide. Beads were washed three times
Engineering a de novo transport tunnel
SUPPORTING INFORMATION Engineering a de novo transport tunnel Jan Brezovsky,, Petra Babkova,, Oksana Degtjarik, Andrea Fortova, Artur Gora,, Iuliia Iermak, Pavlina Rezacova, Pavel Dvorak, Ivana Kuta Smatanova,
Supporting Information
Supporting Information Decoding Allosteric Networks in Biocatalysts: Rational Approach to Therapies and Biotechnologies Johannes T. Cramer 1,2, Jana I. Führing 1, Petra Baruch 2, Christian Brütting 3,
Diphthamide biosynthesis requires a radical iron-sulfur enzyme. Pennsylvania State University, University Park, Pennsylvania 16802, USA
Diphthamide biosynthesis requires a radical iron-sulfur enzyme Yang Zhang, 1,4 Xuling Zhu, 1,4 Andrew T. Torelli, 1 Michael Lee, 2 Boris Dzikovski, 1 Rachel Koralewski, 1 Eileen Wang, 1 Jack Freed, 1 Carsten
X-ray Crystallography I. James Fraser Macromolecluar Interactions BP204
X-ray Crystallography I James Fraser Macromolecluar Interactions BP204 Key take-aways 1. X-ray crystallography results from an ensemble of Billions and Billions of molecules in the crystal 2. Models in
Structural insights into Aspergillus fumigatus lectin specificity - AFL binding sites are functionally non-equivalent
Acta Cryst. (2015). D71, doi:10.1107/s1399004714026595 Supporting information Volume 71 (2015) Supporting information for article: Structural insights into Aspergillus fumigatus lectin specificity - AFL
Ensemble refinement of protein crystal structures in PHENIX. Tom Burnley Piet Gros
Ensemble refinement of protein crystal structures in PHENIX Tom Burnley Piet Gros Incomplete modelling of disorder contributes to R factor gap Only ~5% of residues in the PDB are modelled with more than
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 8, 2018 06:13 pm GMT PDB ID : 5G5C Title : Structure of the Pyrococcus furiosus Esterase Pf2001 with space group C2221 Authors : Varejao, N.; Reverter,
Supporting Information
Supporting Information Oxaliplatin binding to human copper chaperone Atox1 and protein dimerization Benny D. Belviso, 1 Angela Galliani, 2 Alessia Lasorsa, 2 Valentina Mirabelli, 1,3 Rocco Caliandro, 1
Structural basis of PROTAC cooperative recognition for selective protein degradation
SUPPLEMENTARY INFORMATION Structural basis of PROTAC cooperative recognition for selective protein degradation Morgan S. Gadd 1, Andrea Testa 1, Xavier Lucas 1, Kwok-Ho Chan, Wenzhang Chen, Douglas J.
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 10, 2018 01:44 am GMT PDB ID : 1MWP Title : N-TERMINAL DOMAIN OF THE AMYLOID PRECURSOR PROTEIN Authors : Rossjohn, J.; Cappai, R.; Feil, S.C.; Henry,
The structure of a nucleolytic ribozyme that employs a catalytic metal ion Liu, Yijin; Wilson, Timothy; Lilley, David
University of Dundee The structure of a nucleolytic ribozyme that employs a catalytic metal ion Liu, Yijin; Wilson, Timothy; Lilley, David Published in: Nature Chemical Biology DOI: 10.1038/nchembio.2333
Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
Supporting Information
Supporting Information Structural Basis of the Antiproliferative Activity of Largazole, a Depsipeptide Inhibitor of the Histone Deacetylases Kathryn E. Cole 1, Daniel P. Dowling 1,2, Matthew A. Boone 3,
Supplementary Materials for
www.advances.sciencemag.org/cgi/content/full/1/7/e1500263/dc1 Supplementary Materials for Newton s cradle proton relay with amide imidic acid tautomerization in inverting cellulase visualized by neutron
for Molecular Biology and Neuroscience and Institute of Medical Microbiology, Rikshospitalet-Radiumhospitalet
SUPPLEMENTARY INFORMATION TO Structural basis for enzymatic excision of N -methyladenine and N 3 -methylcytosine from DNA Ingar Leiros,5, Marivi P. Nabong 2,3,5, Kristin Grøsvik 3, Jeanette Ringvoll 2,
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Jan 28, 2019 11:10 AM EST PDB ID : 6A5H Title : The structure of [4+2] and [6+4] cyclase in the biosynthetic pathway of unidentified natural product Authors
Supporting Information. Synthesis of Aspartame by Thermolysin : An X-ray Structural Study
Supporting Information Synthesis of Aspartame by Thermolysin : An X-ray Structural Study Gabriel Birrane, Balaji Bhyravbhatla, and Manuel A. Navia METHODS Crystallization. Thermolysin (TLN) from Calbiochem
Supplemental Data SUPPLEMENTAL FIGURES
Supplemental Data CRYSTAL STRUCTURE OF THE MG.ADP-INHIBITED STATE OF THE YEAST F 1 C 10 ATP SYNTHASE Alain Dautant*, Jean Velours and Marie-France Giraud* From Université Bordeaux 2, CNRS; Institut de
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 8, 2018 10:24 pm GMT PDB ID : 1A30 Title : HIV-1 PROTEASE COMPLEXED WITH A TRIPEPTIDE INHIBITOR Authors : Louis, J.M.; Dyda, F.; Nashed, N.T.; Kimmel,
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 14, 2018 02:00 pm GMT PDB ID : 3RRQ Title : Crystal structure of the extracellular domain of human PD-1 Authors : Lazar-Molnar, E.; Ramagopal, U.A.; Nathenson,
Supplementary materials. Crystal structure of the carboxyltransferase domain. of acetyl coenzyme A carboxylase. Department of Biological Sciences
Supplementary materials Crystal structure of the carboxyltransferase domain of acetyl coenzyme A carboxylase Hailong Zhang, Zhiru Yang, 1 Yang Shen, 1 Liang Tong Department of Biological Sciences Columbia
Structural basis for catalytically restrictive dynamics of a high-energy enzyme state
Supplementary Material Structural basis for catalytically restrictive dynamics of a high-energy enzyme state Michael Kovermann, Jörgen Ådén, Christin Grundström, A. Elisabeth Sauer-Eriksson, Uwe H. Sauer
Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
Impact of the crystallization condition on importin-β conformation
Supporting information Volume 72 (2016) Supporting information for article: Impact of the crystallization condition on importin-β conformation Marcel J. Tauchert, Clément Hémonnot, Piotr Neumann, Sarah
SUPPLEMENTARY INFORMATION
Data collection Supplementary Table 1 Statistics of data collection, phasing and refinement Native Se-MAD Space group P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 50.4, 94.2, 115.4 49.8, 94.2,
Ultra-high resolution structures in validation
Ultra-high resolution structures in validation (and not only...) Mariusz Jaskolski Department of Crystallography,, A. Mickiewicz University Center for Biocrystallographic Research, Polish Academy of Sciences,
Supporting Information
Supporting Information Fera et al. 10.1073/pnas.1409954111 SI Methods Compliance. All work related to human subjects complied with protocols approved by the Duke University Health System Institutional
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits AhpC and AhpF from Escherichia coli Phat Vinh Dip 1,#, Neelagandan Kamariah 2,#, Malathy Sony Subramanian Manimekalai
Supplementary Information: Table S1. Potential energy and essential dynamics (ED) analysis of the MD simulations of the Bcl-2 complexes under study.
Supplementary Information: Table S1. Potential energy and essential dynamics (ED) analysis of the MD simulations of the Bcl-2 complexes under study. Bcl2 and complex Potential energy (kj/mol) ED 2D projection
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Jan 17, 2019 09:42 AM EST PDB ID : 6D3Z Title : Protease SFTI complex Authors : Law, R.H.P.; Wu, G. Deposited on : 2018-04-17 Resolution : 2.00 Å(reported)
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/5/243/ra68/dc1 Supplementary Materials for Superbinder SH2 Domains Act as Antagonists of Cell Signaling Tomonori Kaneko, Haiming Huang, Xuan Cao, Xing Li, Chengjun
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 13, 2018 04:03 pm GMT PDB ID : 5NMJ Title : Chicken GRIFIN (crystallisation ph: 6.5) Authors : Ruiz, F.M.; Romero, A. Deposited on : 2017-04-06 Resolution
type GroEL-GroES complex. Crystals were grown in buffer D (100 mm HEPES, ph 7.5,
Supplementary Material Supplementary Materials and Methods Structure Determination of SR1-GroES-ADP AlF x SR1-GroES-ADP AlF x was purified as described in Materials and Methods for the wild type GroEL-GroES
Crystal lattice Real Space. Reflections Reciprocal Space. I. Solving Phases II. Model Building for CHEM 645. Purified Protein. Build model.
I. Solving Phases II. Model Building for CHEM 645 Purified Protein Solve Phase Build model and refine Crystal lattice Real Space Reflections Reciprocal Space ρ (x, y, z) pronounced rho F hkl 2 I F (h,
Bioinformatics. Macromolecular structure
Bioinformatics Macromolecular structure Contents Determination of protein structure Structure databases Secondary structure elements (SSE) Tertiary structure Structure analysis Structure alignment Domain
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 8, 2018 08:34 pm GMT PDB ID : 1RUT Title : Complex of LMO4 LIM domains 1 and 2 with the ldb1 LID domain Authors : Deane, J.E.; Ryan, D.P.; Maher, M.J.;
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11744 Supplementary Table 1. Crystallographic data collection and refinement statistics. Wild-type Se-Met-BcsA-B SmCl 3 -soaked EMTS-soaked Data collection Space