Supplemental Information. Molecular Basis of Spectral Diversity. in Near-Infrared Phytochrome-Based. Fluorescent Proteins

Supplementary Figure 1. Biochemical and sequence alignment analyses the

Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).

SUPPLEMENTARY INFORMATION

doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-

SUPPLEMENTARY INFORMATION

Fig. 1 Influences of crystal lattice contacts on Pol η structures. a. The dominant lattice contact between two hpol η molecules (silver and gold) in the type 1 crystals. b. A close-up view of the hydrophobic

SUPPLEMENTARY INFORMATION

Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/5/243/ra68/dc1 Supplementary Materials for Superbinder SH2 Domains Act as Antagonists of Cell Signaling Tomonori Kaneko, Haiming Huang, Xuan Cao, Xing Li, Chengjun

Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases

Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3

SUPPLEMENTARY INFORMATION

Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Supplementary Information

Supplementary Information Structural analysis of leader peptide binding enables leaderfree cyanobactin processing Jesko Koehnke 1,2, Greg Mann 1,2, Andrew F Bent 1,2, Hannes Ludewig 1, Sally Shirran 1,

Supplemental Information

Supplemental Information Combinatorial Readout of Unmodified H3R2 and Acetylated H3K14 by the Tandem PHD Finger of MOZ Reveals a Regulatory Mechanism for HOXA9 Transcription Yu Qiu 1, Lei Liu 1, Chen Zhao

Supplementary Figures

1 Supplementary Figures Supplementary Figure 1 Type I FGFR1 inhibitors (a) Chemical structures of a pyrazolylaminopyrimidine inhibitor (henceforth referred to as PAPI; PDB-code of the FGFR1-PAPI complex:

SUPPLEMENTARY INFORMATION

doi:1.138/nature1737 Supplementary Table 1 variant Description FSEC - 2B12 a FSEC - 6A1 a K d (leucine) c Leucine uptake e K (wild-type like) K (Y18F) K (TS) K (TSY) K288A mutant, lipid facing side chain

SUPPLEMENTARY INFORMATION. doi: /nature07461

Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11744 Supplementary Table 1. Crystallographic data collection and refinement statistics. Wild-type Se-Met-BcsA-B SmCl 3 -soaked EMTS-soaked Data collection Space

FW 1 CDR 1 FW 2 CDR 2

Supplementary Figure 1 Supplementary Figure 1: Interface of the E9:Fas structure. The two interfaces formed by V H and V L of E9 with Fas are shown in stereo. The Fas receptor is represented as a surface

Introduction to Comparative Protein Modeling. Chapter 4 Part I

Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature

SUPPLEMENTARY INFORMATION

Supplementary Table 1: Amplitudes of three current levels. Level 0 (pa) Level 1 (pa) Level 2 (pa) TrkA- TrkH WT 200 K 0.01 ± 0.01 9.5 ± 0.01 18.7 ± 0.03 200 Na * 0.001 ± 0.01 3.9 ± 0.01 12.5 ± 0.03 200

SUPPLEMENTARY INFORMATION

doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group

Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).

Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted

SUPPLEMENTARY INFORMATION

Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,

Supporting Information

Supporting Information Oxaliplatin binding to human copper chaperone Atox1 and protein dimerization Benny D. Belviso, 1 Angela Galliani, 2 Alessia Lasorsa, 2 Valentina Mirabelli, 1,3 Rocco Caliandro, 1

Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)

Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer

SUPPLEMENTARY INFORMATION

5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.

SUPPLEMENTARY INFORMATION

Supplementary Table S1 Kinetic Analyses of the AMSH-LP mutants AMSH-LP K M (μm) k cat x 10-3 (s -1 ) WT 71.8 ± 6.3 860 ± 65.4 T353A 76.8 ± 11.7 46.3 ± 3.7 F355A 58.9 ± 10.4 5.33 ± 0.30 proximal S358A 75.1

Supplementary Information

Supplementary Information The direct role of selenocysteine in [NiFeSe] hydrogenase maturation and catalysis Marta C. Marques a, Cristina Tapia b, Oscar Gutiérrez-Sanz b, Ana Raquel Ramos a, Kimberly L.

Stabilizing the CH2 domain of an Antibody by Engineering in an Enhanced Aromatic Sequon

Stabilizing the CH2 domain of an Antibody by Engineering in an Enhanced Aromatic Sequon Wentao Chen,, Leopold Kong, Stephen Connelly, Julia M. Dendle,, Yu Liu,, Ian A. Wilson,#, Evan T. Powers, *, Jeffery

Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing

Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing 0.1% SDS without boiling. The gel was analyzed by a fluorescent

CH 3 CH 2 OH +H 2 O CHO. 2e + 2H + + O 2 H 2 O +HCOOH

2 4 H CH 3 2e + 2H + + 2 H 2 2 H CH 2 H 2e + 2H + + 2 H 2 2 H +H 2 CH 2e + 2H + + 2 H 2 2 H +HCH Supplemental Figure S. The three-step 4DM reaction, each step requires two reducing equivalents from ADPH

Supporting Information

Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,

Expanded View Figures

The EMBO Journal Structure of a Dm peptide bound to the OT module Tobias Raisch et al Expanded View Figures A Hs Dm 262 297 685 8 HEAT HEAT MIF4G 9BD 1SHD 761 91 193 169 1152 1317 16 1376 1467 HEAT HEAT

Plasmid Relevant features Source. W18N_D20N and TrXE-W18N_D20N-anti

Table S1. E. coli plasmids Plasmid Relevant features Source pdg680 T. reesei XynII AA 2-190 with C-terminal His 6 tag optimized for E. coli expression in pjexpress401 Wan et al. (in press) psbn44d psbn44h

HOMOLOGY MODELING. The sequence alignment and template structure are then used to produce a structural model of the target.

HOMOLOGY MODELING Homology modeling, also known as comparative modeling of protein refers to constructing an atomic-resolution model of the "target" protein from its amino acid sequence and an experimental

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting

SI Text S1 Solution Scattering Data Collection and Analysis. SI references

SI Text S1 Solution Scattering Data Collection and Analysis. The X-ray photon energy was set to 8 kev. The PILATUS hybrid pixel array detector (RIGAKU) was positioned at a distance of 606 mm from the sample.

Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein

Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08

SUPPLEMENTARY INFORMATION

Dph2 SeMet (iron-free) # Dph2 (iron-free) Dph2-[4Fe-4S] Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 58.26, 82.08, 160.42 58.74, 81.87, 160.01 55.70, 80.53,

Your Name: Question 1. Standard Fragmentations in Mass Spectrometry. (20 points)

Exam #4, ovember 14-16, 2007. MU, hemistry 8160, FS07, Dr. Glaser Your ame: Question 1. Standard Fragmentations in Mass Spectrometry. (20 points) For (b) (d), draw the complete structure of the substrate

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier

SUPPLEMENTARY INFORMATION

www.nature.com/nature 1 Figure S1 Sequence alignment. a Structure based alignment of the plgic of E. chrysanthemi (ELIC), the acetylcholine binding protein from the snail Lymnea stagnalis (AchBP, PDB code

Supporting Information. UV-induced ligand exchange in MHC class I protein crystals

Supporting Information for the article entitled UV-induced ligand exchange in MHC class I protein crystals by Patrick H.N. Celie 1, Mireille Toebes 2, Boris Rodenko 3, Huib Ovaa 3, Anastassis Perrakis

Engineering a de novo transport tunnel

SUPPORTING INFORMATION Engineering a de novo transport tunnel Jan Brezovsky,, Petra Babkova,, Oksana Degtjarik, Andrea Fortova, Artur Gora,, Iuliia Iermak, Pavlina Rezacova, Pavel Dvorak, Ivana Kuta Smatanova,

Structure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex

Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin

THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN

THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina

Supplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine

Supplementary figure 1. Comparison of unbound and as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine GM-CSF (slate) with bound GM-CSF in the GIF:GM-CSF complex (GIF: green,

Experimental and Computational Mutagenesis to Investigate the. Positioning of a General Base within an Enzyme Active Site

Experimental and Computational Mutagenesis to Investigate the Positioning of a General Base within an Enzyme Active Site Jason P. Schwans, Philip Hanoian, Benjamin J. Lengerich, Fanny Sunden, Ana Gonzalez

Crystal lattice Real Space. Reflections Reciprocal Space. I. Solving Phases II. Model Building for CHEM 645. Purified Protein. Build model.

I. Solving Phases II. Model Building for CHEM 645 Purified Protein Solve Phase Build model and refine Crystal lattice Real Space Reflections Reciprocal Space ρ (x, y, z) pronounced rho F hkl 2 I F (h,

NB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5

SUPPLEMENTARY TABLES Suppl. Table 1. Protonation states at ph 7.4 and 4.5. Protonation states of titratable residues in GCase at ph 7.4 and 4.5. Histidine: HID, H at δ-nitrogen; HIE, H at ε-nitrogen; HIP,

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),

Supplemental Figure and Movie Legends Figure S1. Time course experiments on the thermal stability of apo AT cpn-α by native PAGE (related to Figure 2B). The samples were heated, respectively, to (A) 45

Diphthamide biosynthesis requires a radical iron-sulfur enzyme. Pennsylvania State University, University Park, Pennsylvania 16802, USA

Diphthamide biosynthesis requires a radical iron-sulfur enzyme Yang Zhang, 1,4 Xuling Zhu, 1,4 Andrew T. Torelli, 1 Michael Lee, 2 Boris Dzikovski, 1 Rachel Koralewski, 1 Eileen Wang, 1 Jack Freed, 1 Carsten

Acta Cryst. (2017). D73, doi: /s

Acta Cryst. (2017). D73, doi:10.1107/s2059798317010932 Supporting information Volume 73 (2017) Supporting information for article: Designing better diffracting crystals of biotin carboxyl carrier protein

Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets

Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas

Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27

Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase

Supporting information for

Supporting information for Rewiring multi-domain protein switches: transforming a fluorescent Zn 2+ -sensor into a light-responsive Zn 2+ binding protein Stijn J.A. Aper and Maarten Merkx Laboratory of

Supporting Information

Supporting Information Decoding Allosteric Networks in Biocatalysts: Rational Approach to Therapies and Biotechnologies Johannes T. Cramer 1,2, Jana I. Führing 1, Petra Baruch 2, Christian Brütting 3,

Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2

Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell

SUPPLEMENTARY INFORMATION

doi:10.1038/nature10955 Supplementary Figures Supplementary Figure 1. Electron-density maps and crystallographic dimer structures of the motor domain. (a f) Stereo views of the final electron-density maps

SUPPLEMENTARY INFORMATION

Parallel Allostery by camp and PDE Coordinates Activation and Termination Phases in camp Signaling Srinath Krishnamurthy, 1 Nikhil Kumar Tulsian, 1 Arun Chandramohan, 1 and Ganesh S. Anand 1, * 1 Department

of the Guanine Nucleotide Exchange Factor FARP2

Structure, Volume 21 Supplemental Information Structural Basis for Autoinhibition of the Guanine Nucleotide Exchange Factor FARP2 Xiaojing He, Yi-Chun Kuo, Tyler J. Rosche, and Xuewu Zhang Inventory of

Design of a Novel Globular Protein Fold with Atomic-Level Accuracy

Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Brian Kuhlman, Gautam Dantas, Gregory C. Ireton, Gabriele Varani, Barry L. Stoddard, David Baker Presented by Kate Stafford 4 May 05 Protein

Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps

Cell Reports Supplemental Information Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps Chih-Chia Su, Jani Reddy Bolla, Nitin Kumar, Abhijith Radhakrishnan,

Cryo-EM data collection, refinement and validation statistics

1 Table S1 Cryo-EM data collection, refinement and validation statistics Data collection and processing CPSF-160 WDR33 (EMDB-7114) (PDB 6BM0) CPSF-160 WDR33 (EMDB-7113) (PDB 6BLY) CPSF-160 WDR33 CPSF-30

Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS

Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS CNS input file generatemetal.inp: remarks file generate/generatemetal.inp

Structural basis of PROTAC cooperative recognition for selective protein degradation

SUPPLEMENTARY INFORMATION Structural basis of PROTAC cooperative recognition for selective protein degradation Morgan S. Gadd 1, Andrea Testa 1, Xavier Lucas 1, Kwok-Ho Chan, Wenzhang Chen, Douglas J.

Figure 1. Molecules geometries of 5021 and Each neutral group in CHARMM topology was grouped in dash circle.

Project I Chemistry 8021, Spring 2005/2/23 This document was turned in by a student as a homework paper. 1. Methods First, the cartesian coordinates of 5021 and 8021 molecules (Fig. 1) are generated, in

SUPPLEMENTARY INFORMATION

Data collection Supplementary Table 1 Statistics of data collection, phasing and refinement Native Se-MAD Space group P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 50.4, 94.2, 115.4 49.8, 94.2,

Supplementary Materials for

www.advances.sciencemag.org/cgi/content/full/1/7/e1500263/dc1 Supplementary Materials for Newton s cradle proton relay with amide imidic acid tautomerization in inverting cellulase visualized by neutron

The Fic protein Doc uses an inverted substrate to phosphorylate and. inactivate EF-Tu

The Fic protein Doc uses an inverted substrate to phosphorylate and inactivate EF-Tu Daniel Castro-Roa 1, Abel Garcia-Pino 2,3 *, Steven De Gieter 2,3, Nico A.J. van Nuland 2,3, Remy Loris 2,3, Nikolay

Supporting Information

Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)

NMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease

University of Wollongong Research Online Faculty of Science - Papers (Archive) Faculty of Science, Medicine and Health 2009 NMR study of complexes between low molecular mass inhibitors and the West Nile

IgE binds asymmetrically to its B cell receptor CD23

Supplementary Information IgE binds asymmetrically to its B cell receptor CD23 Balvinder Dhaliwal 1*, Marie O. Y. Pang 2, Anthony H. Keeble 2,3, Louisa K. James 2,4, Hannah J. Gould 2, James M. McDonnell

17. Biomolecular Interaction

17. Biomolecular Interaction Methods for characterizing biomolecular interactions Sequence-specific DNA binding ligands Molecular mechanisms of drug action and drug resistance In silico compound design

Disulfide Linkage Characterization of Disulfide Bond-Containing Proteins and Peptides by Reducing Electrochemistry and Mass Spectrometry

Supporting Information to: Disulfide Linkage Characterization of Disulfide ond-containing roteins and eptides y Reducing Electrochemistry and Mass Spectrometry Christian N. Cramer 1,2, Kim F. Haselmann

Higher -o-o-o- Past Paper questions o-o-o- 3.4 Spectra

Higher -o-o-o- Past Paper questions 1991-2010 -o-o-o- 3.4 Spectra 1992 Q37 The diagram below shows the energy levels for the hydrogen atom. (a) Between which two energy levels would an electron transition

*Corresponding Author *K. F.: *T. H.:

Theoretical Analysis of Activity Cliffs among Benzofuranone Class Pim1 Inhibitors Using the Fragment Molecular Orbital Method with Molecular Mechanics Poisson-Boltzmann Surface Area (FMO+MM-PBSA) Approach

Full wwpdb X-ray Structure Validation Report i

Full wwpdb X-ray Structure Validation Report i Jan 17, 2019 09:42 AM EST PDB ID : 6D3Z Title : Protease SFTI complex Authors : Law, R.H.P.; Wu, G. Deposited on : 2018-04-17 Resolution : 2.00 Å(reported)

Cks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved

Cks1 d CKS1 Supplementary Figure 1 The -Cks1 crystal lattice. (a) Schematic of the - Cks1 crystal lattice. -Cks1 crystallizes in a lattice that contains c 4 copies of the t - Cks1 dimer in the crystallographic

Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions. Implicated in Dimerization and Autoinhibition

JBC Papers in Press. Published on November 1, 2000 as Manuscript M006502200 Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions Implicated in Dimerization and Autoinhibition 1 Copyright

The copper active site in CBM33 polysaccharide oxygenases

Supporting Information for: The copper active site in CBM33 polysaccharide oxygenases Glyn R. Hemsworth, Edward J. Taylor, Robbert Q. Kim, Rebecca C. Gregory, Sally J. Lewis, Johan P. Turkenburg, Alison

LS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor

LS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor Note: Adequate space is given for each answer. Questions that require a brief explanation should

Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate

SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,

Acta Crystallographica Section D

Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural basis of the heterodimerization of the MST and RASSF SARAH domains in the Hippo signalling

Nature Methods: doi: /nmeth Supplementary Figure 1. Fragment indexing allows efficient spectra similarity comparisons.

Supplementary Figure 1 Fragment indexing allows efficient spectra similarity comparisons. The cost and efficiency of spectra similarity calculations can be approximated by the number of fragment comparisons

Electronic Supplementary Information (ESI) for Chem. Commun. Unveiling the three- dimensional structure of the green pigment of nitrite- cured meat

Electronic Supplementary Information (ESI) for Chem. Commun. Unveiling the three- dimensional structure of the green pigment of nitrite- cured meat Jun Yi* and George B. Richter- Addo* Department of Chemistry

Structure of the α-helix

Structure of the α-helix Structure of the β Sheet Protein Dynamics Basics of Quenching HDX Hydrogen exchange of amide protons is catalyzed by H 2 O, OH -, and H 3 O +, but it s most dominated by base

Dihedral Angles. Homayoun Valafar. Department of Computer Science and Engineering, USC 02/03/10 CSCE 769

Dihedral Angles Homayoun Valafar Department of Computer Science and Engineering, USC The precise definition of a dihedral or torsion angle can be found in spatial geometry Angle between to planes Dihedral

Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a

Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a series of tmfret-pairs comprised of single cysteine mutants

NH 2. Biochemistry I, Fall Term Sept 9, Lecture 5: Amino Acids & Peptides Assigned reading in Campbell: Chapter

Biochemistry I, Fall Term Sept 9, 2005 Lecture 5: Amino Acids & Peptides Assigned reading in Campbell: Chapter 3.1-3.4. Key Terms: ptical Activity, Chirality Peptide bond Condensation reaction ydrolysis

Structures of holo wild-type human cellular retinol-binding protein II (hcrbpii) bound to retinol and retinal

Supporting information Volume 70 (2014) Supporting information for article: Structures of holo wild-type human cellular retinol-binding protein II (hcrbpii) bound to retinol and retinal Zahra Nossoni,

SUPPLEMENTARY INFORMATION. Structural basis of laminin binding to the LARGE glycans on dystroglycan

SUPPLEMENTARY INFORMATION Structural asis of laminin inding to the LARGE glycans on dystroglycan David C. Briggs 1, Takako Yoshida-Moriguchi 2, Tianqing Zheng 2, David Venzke 2, Mary Anderson 2, Andrea

Homology Modeling (Comparative Structure Modeling) GBCB 5874: Problem Solving in GBCB

Homology Modeling (Comparative Structure Modeling) Aims of Structural Genomics High-throughput 3D structure determination and analysis To determine or predict the 3D structures of all the proteins encoded

CD Basis Set of Spectra that is used is that derived from comparing the spectra of globular proteins whose secondary structures are known from X-ray

CD Basis Set of Spectra that is used is that derived from comparing the spectra of globular proteins whose secondary structures are known from X-ray crystallography An example of the use of CD Modeling

Structural insights into Aspergillus fumigatus lectin specificity - AFL binding sites are functionally non-equivalent

Acta Cryst. (2015). D71, doi:10.1107/s1399004714026595 Supporting information Volume 71 (2015) Supporting information for article: Structural insights into Aspergillus fumigatus lectin specificity - AFL

Full wwpdb X-ray Structure Validation Report i

Full wwpdb X-ray Structure Validation Report i Mar 8, 2018 08:34 pm GMT PDB ID : 1RUT Title : Complex of LMO4 LIM domains 1 and 2 with the ldb1 LID domain Authors : Deane, J.E.; Ryan, D.P.; Maher, M.J.;

SUPPLEMENTARY INFORMATION

doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2

Electronic Supplementary Material (ESI) for Nanoscale This journal is The Royal Society of Chemistry Characterization of CeO2 NP suspensions

% Vol. Electronic Supplementary Material (ESI) for Nanoscale Characterization of CeO2 NP suspensions CeO2 NPs show a strong tendency to aggregate as a function of ph, ionic strength, dilution and sonication

Dr. Yonca Yuzugullu PERG (Protein Engineering Research Group)

Dr. Yonca Yuzugullu PERG (Protein Engineering Research Group) BSc, 1997 Ankara University, Turkey PhD, 2010 Middle East Technical University, Turkey Lecturer in Department of Biology Kocaeli University,