SUPPLEMENTARY FIGURES

Size: px
Start display at page:

Download "SUPPLEMENTARY FIGURES"

Transcription

1 SUPPLEMENTARY FIGURES

2

3 Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background. Incomplete identities among aligned sequences are in red text. The alignment was prepared with ClustalW 1 and ESPript (

4 Supplementary Figure 2 Temperature factor distribution in the three FadR structures is shown as B- factor putty as implemented by PyMOL ( The C-atom B-factors are depicted on the structure in dark blue (lowest B-factor) through to red (highest B-factor), with the radius of the ribbon increasing from low to high B-factor. Only one monomer is shown for each structure for clarity. Residue G66 at the tip of the wing of the winged-helix motif, is indicated by a * for orientation. Arrows indicate the positions of residues F74 and I97, which contains the short helical linker α4 (residues 81-89) in the apo and DNA-bound structures; this region becomes much more flexible (including α4 melting ) in the ligand-bound structure. (a) apo-fadr: the highest B factor region includes residues 64 to 74 (the wing of the HTH region). (b) FadR-DNA complex: the insertion region has the highest B factors. (c) FadR-ligand complex: the entire N-terminal DNA binding domains has comparatively high B-factors, and the region including helix α4 has melted and has the highest B-factors. All four oleoyl-coa ligands are shown as grey spheres.

5 Supplementary Figure 3 Schematic overview of the FadR-DNA contacts calculated by NUCPLOT 3. (a) V. cholerae. (b) E. coli (PDB 1H9T) 4. Bases are represented by one-letter codes. Bases making standard H-bonding base-pair interactions are connected by a solid black line. The DNA backbone is drawn next to the bases: the sugars as brown pentagons and phosphates as purple circles. The base numbers, as given in the PDB file, are inside the sugars. Interactions are plotted on either side of the

6 strands; interacting protein residues are represented by their atom name, residue name, number and the chain identifier (A or B) in parentheses with hydrogen bonds as blue dotted lines and non-bonded contacts (<3.35Å) as red dotted lines. Atom names are blue for nitrogen and red for oxygen; here, atom names are omitted from residues interacting only by non-bonded contacts. Water molecules are drawn as blue circles and labeled by their PDB number 3. The DNA chains are labeled C, D for V. cholerae and X, Y for E. coli.

7

8 Supplementary Figure 4 Electron density showing oleoyl-coa binding to FadR. (a) Fo-Fc electron density at 3.0σ for ligand site #1 of chain A. (b) Fo-Fc density at 2.3σ for ligand site #2 of chain B. Note the tail region of the site #2 ligand is in contact with the tail region of the adjacent monomer, and as such appears to be flexible and less well defined than regions of the ligand that form close contacts with the protein, as well as the tail region of the site #1 ligand shown in (a). In both panels, the ligand and alpha carbon trace of the final refined structure as described in the manuscript is shown for reference, with carbons in green. The alpha carbon trace following simulated annealing refinement with the ligand at the specific site omitted is shown in yellow and yellow sticks for the non-omitted ligand molecules. Positive electron density is shown in blue, and negative density is shown in green. (c) Stereo view of 2Fo-Fc electron density at 1.0σ for ligand site #1 of chain A. All panels in this figure were made using the auto open mtz option of Coot 5, followed by export using the Screenshot Raster3D option; final rendering was done using PyMOL (

9 Supplementary Figure 5 Two-dimensional diagrams showing interactions between VcFadR and oleoyl- CoA as calculated by LIGPLOT 6. (a) The ligand binding pocket similar to that of E. coli (site #1, monomer A). The ligands and protein side chains are shown in ball-and-stick representation, with the ligand bonds in purple and protein bonds in orange. Hydrogen bonds are green dashed lines with indicated distances (in Å). Residues in hydrophobic contact with the ligand are represented by red semicircles with radiating spokes. The atoms are colored as follows: nitrogen, blue; oxygen, red; carbon, black; sulfur, yellow; phosphorous, purple. (b) The ligand binding pocket involving the insertion region (site #2, monomer A). Colors are the same as in (a).

10 Supplementary Figure 6 The interaction of oleoyl-coa (site #1, monomer B) with VcFadR. The conformation of the phosphorylated adenosine head group of oleoyl-coa bound to site #1 in monomer B is different from that bound to site #1 in monomer A. (a) The structure of oleoyl-coa bound to site #1 in monomer B, highlighting critical residues interacting with the ligand. Positively charged residues that interact with ligand phosphates are in blue. Residues forming hydrogen bonds are cyan, and those forming hydrophobic interactions are in green. (b). Two-dimensional diagram showing interactions between VcFadR and oleoyl-coa (site #1, monomer B) as calculated by LIGPLOT 6. Colors are the same as in Supplementary Fig. 5.

11 Supplementary Figure 7 Stereo view showing the superposition of VcFadR-oleoyl-CoA complex and EcFadR-myristoyl-CoA complex (PDB 1H9G). Carbon atoms are colored salmon in VcFadR and slate blue in EcFadR. VcL208 and EcM168 are labeled. Carbon atoms are colored magenta in oleoyl-coa and cyan in myristoyl-coa. The black arrow indicates double bond between C9 and C10 in oleoyl-coa. Other atoms are colored as follows: nitrogen, blue; oxygen, red; sulfur, yellow.

12 Supplementary Figure 8 Isothermal titration calorimetry (ITC) binding isotherm of VcFadR titrated with oleoyl-coa. Top, the raw heat signal from 29 injections of 10 μl aliquots of a 0.2 mm solution of oleoyl-coa into a cell containing mm VcFadR at 30 C; Bottom, the integrated area (heat) of each injection after background correction. ITC indicates that every monomer binds two molecules of oleoyl-coa (N 1 =1.1 and N 2 =0.8) with different thermodynamic parameters. K a = ± M -1 and M -1, H = ± 1.75 kcal/mol and ± 0.21 kcal/mol, G = kcal/mol

13 and kcal/mol, -T S = kcal/mol and kcal/mol for binding site #1 and site #2 of oleoyl- CoA, respectively. The reported values were derived from duplicate measurements. The difference in the free energy change between the two binding steps, G 1 G 2, is -1.7 kcal/mol, resulting in the second oleoyl-coa molecule binding VcFadR with a roughly 10-fold lower affinity than the first oleoyl- CoA. Binding of the second oleoyl-coa is accompanied by a more favorable enthalpy change ( H 2 - H 1 = -9.9 kcal/mol). By contrast, the second oleoyl-coa binds VcFadR with a much less favorable entropy change than the first oleoyl-coa, amounting to an entropic penalty [(-T S 2 ) - (-T S 1 ) = 11.6 kcal/mol]. Thus, the thermodynamic basis for the observed roughly 10-fold difference in the affinity of oleoyl-coa for these two sites is entirely entropic in nature. The pink and yellow spheres denote sites #1 and #2, respectively.

14 Supplementary Figure 9 The helix to loop transition in linker helix 4 upon ligand binding. (a) V. cholerae apo-fadr structure shown in two orientations. 4 in helix conformation is red, the rest of the protein is white. (b) VcFadR-ligand structure shown in two orientations. 4 in loop conformation is red, the rest of the protein is white. (c) The region boxed in (a) showing extensive and conserved hydrophobic interactions of 4 with the two flanking domains, the N-terminal DNA binding domain (residues involved in interactions shown in cyan) and the C-terminal ligand binding domain (residues involved in interactions shown in yellow).

15 Supplementary Figure 10 Comparison of effector mediated conformational changes between VcFadR and EcFadR. (a) Superposition of the structures of VcFadR-DNA complex and VcFadR-ligand complex. The DNA binding domain is in magenta (VcFadR-DNA complex) or cyan (VcFadR-ligand complex) and the rest of the protein is white. The distance between the two DNA recognition helices (R45 at the beginning of helix ) is 65 Å in VcFadR-ligand structure whereas that in the VcFadR-DNA complex is 15 Å. (b) Superposition of the structures of EcFadR-DNA complex (PDB 1H9T) 4 and EcFadR-ligand complex (PDB 1H9G) 4. The DNA binding domain is magenta (EcFadR-DNA complex) or green (EcFadR-ligand complex) and the rest of the protein is white. The distance between the two DNA recognition helices (R45, at the beginning of helix ) is 23 Å in EcFadR-ligand structure whereas that in the EcFadR-DNA complex is 15 Å.

16 Supplementary Table 1. Oligonucleotides used in this study Designation WS1 WS2 FabA1 FabA3 Chr1 Chr2 LacNot LacBgl FadE1 FadE3 FadH1 FadH3 FadB1 FadB4 FabB3 FabB4 FadR1 FadR2 FadR3 FadR4 FadR5 FadR6 Sequence (5'-3') CTTAGGCAACTGGTCAAACCAGAACATAAAA TTTTATGTTCTGGTTTGACCAGTTGCCTAAG GATCGGCGGCCGCAACGTTTGTTCTGCATTATTGG GATCGAGATCTAGTGCCTTGAATCTTGATGG GATCGGCGGCCGCGATATCATGCTAACGATTTTTAGAAC GATCGGAATTCGACCGCCACCAAACACTAAG GATCGGCGGCCGCGATCCGGGCATTGAGCAGTC GATCGAGATCTTCGCAACCAGATGATTGAGG GATCGGCGGCCGCAGAGAGCAAGATTTCCATAC GATCGGAATTCGCATCACAATGCGAACCACC GATCGGCGGCCGCGAGAGGCTGAAATAGATTTGGG GATCGGAATTCGAGCTCTTCACCAAACACG GATCGGCGGCCGCGTAAATCATTGTCTATCTCC GATCGGAATTCATGAGACCCCGTGAGCTGAG GATCGGCGGCCGCGACTCGTTTCATGTAACATTC GTTCCTGCGTCGTTCCAGC GATCGAGATCTTGCGTAACGAGTTGGATGTG GATCGGCGGCCGCAGACGATTGCTAATCTAGCACTG GATCGGCGGCCGCTGCCTTAATGACCATTAATG GATCGGAATTCCAGCTAAGTCACTCCCTGAG GGGAATCGCATATGGTCATTAAGGCAAAAAGCC GATCGGCTCTTCAGCACGCGCAATCGTCTTCAGTAAAATTG

17 Supplementary Methods ITC experiments Calorimetric titrations of VcFadR with oleoyl-coa were performed on a VP-Isothermal titration calorimeter (MicroCal). To improve baseline stability, the temperature of the system was kept about 5 C below the working temperature. Protein samples were buffer exchange to ITC buffer containing 20 mm Tris-HCl (ph 7.0), 50 mm NaCl, 1mM EDTA, 0.1 mm Tris (2 carboxyethyl) phosphine hydrochloride. The ligand solution was prepared by dissolving oleoyl-coa (Sigma) in the flow-through of the last buffer exchange. When establishing protein concentration, the monomeric molecular weight g/mole was used. The VcFadR protein concentration was measured spectrophotometrically at 280 nm using calculated molar extinction coefficient (M -1 cm -1 ) of Each titration typically consisted of two preliminary 2-µl injections followed by 29 subsequent 10-µl injections. Each injection consisted of 10 µl of a 0.2 mm solution of oleoyl-coa into a cell containing mm VcFadR at 30 C with a 10 sec duration and a 300 sec interval between injections. The syringe was rotated at 300 rpm during the experiment to assure immediate mixing. Data for two preliminary 2 µl injections were discarded. The heat of dilution control (titration of ligand into buffer) was subtracted from the titration. Raw data were integrated, corrected for nonspecific heat, and fit using the two sets of binding sites model embedded in Origin 7.0 (Microcal). The ITC experiments were highly reproducible, and the reported values were derived from duplicate measurements. Calculations of interactions Hydrogen bonds and van der Waals contacts in FadR-DNA complex structure were calculated using the program HBPLUS and plotted by NUCPLOT 3. To identify hydrogen bonds, the program finds all proximal donor (D) and acceptor (A) atom pairs that satisfy specified geometrical criteria for bond formation. Theoretical hydrogen atom (H) positions are then calculated for those donor atoms that fit the criteria and bonds are calculated between the hydrogen and acceptor atoms. The criteria used for the current study are: the H-A distance is <2.7 Å, the D-A distance is <3.0 Å, the D-H-A angle is >90 and the H-A-AA angle is >90, where AA is the atom attached to the acceptor. All atoms not involved in hydrogen bonds but separated by <3.35 Å were considered to be interacting through van der Waals contacts. NUCPLOT uses the list of interactions generated by HBPLUS to plot all H-bonds and nonbonded interactions between the protein and nucleic acid, between water and nucleic acid, and between

18 protein and nucleic acid via a bridging water molecule. Hydrogen bonds and non-bonded interactions in FadR-ligand complex structure were calculated using the program HBPLUS and plotted by LIGPLOT 6. To identify hydrogen bonds, the program computes all possible positions for hydrogen atoms (H) attached to donor atoms (D) which satisfy specified geometrical criteria with acceptor atoms (A) in the vicinity. The criteria used for the current study are: the H-A distance is <2.7 A, the D-A distance is <3.3 A, the D-H-A angle is >90 and the H- AAA angle is >90, where the AA atom is the one attached to the acceptor, usually preceding it along the amino acid chain. LIGPLOT uses the list of interactions generated by HBPLUS to plot all H-bonds between protein and ligand. All atoms not involved in hydrogen bonds but separated by <3.9 Å were considered to be interacting through non-bonded contacts. LIGPLOT uses the list of interactions generated by HBPLUS to extract and plot all hydrophobic interactions between pairs of carbon atoms between protein and ligand. Supplementary References 1. Larkin, M. A. et al. Clustal W and Clustal X version 2.0. Bioinformatics 23, (2007). 2. Gouet, P., Robert, X. & Courcelle, E. ESPript/ENDscript: Extracting and rendering sequence and 3D information from atomic structures of proteins. Nucleic Acids Res. 31, (2003). 3. Luscombe, N. M., Laskowski, R. A. & Thornton, J. M. NUCPLOT: a program to generate schematic diagrams of protein-nucleic acid interactions. Nucleic Acids Res. 25, (1997). 4. van Aalten, D. M., DiRusso, C. C. & Knudsen, J. The structural basis of acyl coenzyme A- dependent regulation of the transcription factor FadR. EMBO J. 20, (2001). 5. Emsley, P. & Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallogr. D Biol. Crystallogr. 60, (2004). 6. Wallace, A. C., Laskowski, R. A. & Thornton, J. M. LIGPLOT: a program to generate schematic diagrams of protein-ligand interactions. Protein. Eng. 8, (1995).

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,

More information

Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate

Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10458 Active Site Remodeling in the Bifunctional Fructose-1,6- bisphosphate aldolase/phosphatase Juan Du, Rafael F. Say, Wei Lü, Georg Fuchs & Oliver Einsle SUPPLEMENTARY FIGURES Figure

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved

More information

Structural insights into WcbI, a novel polysaccharide-biosynthesis enzyme

Structural insights into WcbI, a novel polysaccharide-biosynthesis enzyme Volume 1 (2014) Supporting information for article: Structural insights into WcbI, a novel polysaccharide-biosynthesis enzyme Mirella Vivoli, Emily Ayres, Edward Beaumont, Michail N. Isupov and Nicholas

More information

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1. Secondary structure of CAP (in the camp 2 -bound state) 10. α-helices are shown as cylinders and β- strands as arrows. Labeling of secondary structure is indicated. CDB, DBD and the hinge are

More information

SUPPLEMENTARY FIGURES. Structure of the cholera toxin secretion channel in its. closed state

SUPPLEMENTARY FIGURES. Structure of the cholera toxin secretion channel in its. closed state SUPPLEMENTARY FIGURES Structure of the cholera toxin secretion channel in its closed state Steve L. Reichow 1,3, Konstantin V. Korotkov 1,3, Wim G. J. Hol 1$ and Tamir Gonen 1,2$ 1, Department of Biochemistry

More information

Cks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved

Cks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved Cks1 d CKS1 Supplementary Figure 1 The -Cks1 crystal lattice. (a) Schematic of the - Cks1 crystal lattice. -Cks1 crystallizes in a lattice that contains c 4 copies of the t - Cks1 dimer in the crystallographic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group

More information

Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli

Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits AhpC and AhpF from Escherichia coli Phat Vinh Dip 1,#, Neelagandan Kamariah 2,#, Malathy Sony Subramanian Manimekalai

More information

Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions. Implicated in Dimerization and Autoinhibition

Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions. Implicated in Dimerization and Autoinhibition JBC Papers in Press. Published on November 1, 2000 as Manuscript M006502200 Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions Implicated in Dimerization and Autoinhibition 1 Copyright

More information

Supplementary Figures

Supplementary Figures 1 Supplementary Figures Supplementary Figure 1 Type I FGFR1 inhibitors (a) Chemical structures of a pyrazolylaminopyrimidine inhibitor (henceforth referred to as PAPI; PDB-code of the FGFR1-PAPI complex:

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10955 Supplementary Figures Supplementary Figure 1. Electron-density maps and crystallographic dimer structures of the motor domain. (a f) Stereo views of the final electron-density maps

More information

Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS

Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS CNS input file generatemetal.inp: remarks file generate/generatemetal.inp

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase

More information

Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein

Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08

More information

Supporting Information

Supporting Information Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)

More information

SUPPLEMENTARY INFORMATION. doi: /nature07461

SUPPLEMENTARY INFORMATION. doi: /nature07461 Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of

More information

Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2

Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2 Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell

More information

S2004 Methods for characterization of biomolecular interactions - classical versus modern

S2004 Methods for characterization of biomolecular interactions - classical versus modern S2004 Methods for characterization of biomolecular interactions - classical versus modern Isothermal Titration Calorimetry (ITC) Eva Dubská email: eva.dubska@ceitec.cz Outline Calorimetry - history + a

More information

Time-dependence of key H-bond/electrostatic interaction distances in the sirna5-hago2 complexes... Page S14

Time-dependence of key H-bond/electrostatic interaction distances in the sirna5-hago2 complexes... Page S14 Supporting Information Probing the Binding Interactions between Chemically Modified sirnas and Human Argonaute 2 Using Microsecond Molecular Dynamics Simulations S. Harikrishna* and P. I. Pradeepkumar*

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Fig. 1 Influences of crystal lattice contacts on Pol η structures. a. The dominant lattice contact between two hpol η molecules (silver and gold) in the type 1 crystals. b. A close-up view of the hydrophobic

More information

Tex 25mer ssrna Binding Stoichiometry

Tex 25mer ssrna Binding Stoichiometry Figure S. Determination of Tex:2nt ssrna binding stoichiometry using fluorescence polarization. Fluorescein labeled RNA was held at a constant concentration 2-fold above the K d. Tex protein was titrated

More information

Ranjit P. Bahadur Assistant Professor Department of Biotechnology Indian Institute of Technology Kharagpur, India. 1 st November, 2013

Ranjit P. Bahadur Assistant Professor Department of Biotechnology Indian Institute of Technology Kharagpur, India. 1 st November, 2013 Hydration of protein-rna recognition sites Ranjit P. Bahadur Assistant Professor Department of Biotechnology Indian Institute of Technology Kharagpur, India 1 st November, 2013 Central Dogma of life DNA

More information

Supporting Information

Supporting Information Supporting Information Oxaliplatin binding to human copper chaperone Atox1 and protein dimerization Benny D. Belviso, 1 Angela Galliani, 2 Alessia Lasorsa, 2 Valentina Mirabelli, 1,3 Rocco Caliandro, 1

More information

Supplementary Figure 1. Biochemical and sequence alignment analyses the

Supplementary Figure 1. Biochemical and sequence alignment analyses the Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).

More information

Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27

Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27 Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase

More information

Acta Crystallographica Section D

Acta Crystallographica Section D Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural characterization of the virulence factor Nuclease A from Streptococcus agalactiae

More information

Pathogenic C9ORF72 Antisense Repeat RNA Forms a Double Helix with Tandem C:C Mismatches

Pathogenic C9ORF72 Antisense Repeat RNA Forms a Double Helix with Tandem C:C Mismatches Supporting Information Pathogenic C9ORF72 Antisense Repeat RNA Forms a Double Helix with Tandem C:C Mismatches David W. Dodd, Diana R. Tomchick, David R. Corey, and Keith T. Gagnon METHODS S1 RNA synthesis.

More information

Bacterial protease uses distinct thermodynamic signatures for substrate recognition

Bacterial protease uses distinct thermodynamic signatures for substrate recognition Bacterial protease uses distinct thermodynamic signatures for substrate recognition Gustavo Arruda Bezerra, Yuko Ohara-Nemoto, Irina Cornaciu, Sofiya Fedosyuk, Guillaume Hoffmann, Adam Round, José A. Márquez,

More information

Pymol Practial Guide

Pymol Practial Guide Pymol Practial Guide Pymol is a powerful visualizor very convenient to work with protein molecules. Its interface may seem complex at first, but you will see that with a little practice is simple and powerful

More information

Nature Structural and Molecular Biology: doi: /nsmb.2938

Nature Structural and Molecular Biology: doi: /nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat proteins. (a) Water-mediate hydrogen-bond network is frequently visible in the convex region of LRR crystal structures. Examples

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Table 1: Data collection, phasing and refinement statistics ChbC/Ta 6 Br 12 Native ChbC Data collection Space group P4 3 2 1 2 P4 3 2 1 2 Cell dimensions a, c (Å) 132.75, 453.57 132.81, 452.95

More information

Structural insights into Aspergillus fumigatus lectin specificity - AFL binding sites are functionally non-equivalent

Structural insights into Aspergillus fumigatus lectin specificity - AFL binding sites are functionally non-equivalent Acta Cryst. (2015). D71, doi:10.1107/s1399004714026595 Supporting information Volume 71 (2015) Supporting information for article: Structural insights into Aspergillus fumigatus lectin specificity - AFL

More information

ISoTherMal TITraTIon Calorimetry

ISoTherMal TITraTIon Calorimetry ISoTherMal TITraTIon Calorimetry With the Nano ITC, heat effects as small as 1 nanojoules are detectable using one nanomole or less of biopolymer. The Nano ITC uses a solid-state thermoelectric heating

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2

More information

Tutorial: Structural Analysis of a Protein-Protein Complex

Tutorial: Structural Analysis of a Protein-Protein Complex Molecular Modeling Section (MMS) Department of Pharmaceutical and Pharmacological Sciences University of Padova Via Marzolo 5-35131 Padova (IT) @contact: stefano.moro@unipd.it Tutorial: Structural Analysis

More information

Cholera Toxin Invasion

Cholera Toxin Invasion Protein-carbohydrate interactions: Isothermal Titration Calorimetry Dr Bruce Turnbull School of Chemistry and Astbury Centre for Structural Molecular Biology University of Leeds Cholera Toxin Invasion

More information

Supplementary information for cloud computing approaches for prediction of ligand binding poses and pathways

Supplementary information for cloud computing approaches for prediction of ligand binding poses and pathways Supplementary information for cloud computing approaches for prediction of ligand binding poses and pathways Morgan Lawrenz 1, Diwakar Shukla 1,2 & Vijay S. Pande 1,2 1 Department of Chemistry, Stanford

More information

LS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor

LS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor LS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor Note: Adequate space is given for each answer. Questions that require a brief explanation should

More information

Supplementary Information

Supplementary Information Supplementary Information The direct role of selenocysteine in [NiFeSe] hydrogenase maturation and catalysis Marta C. Marques a, Cristina Tapia b, Oscar Gutiérrez-Sanz b, Ana Raquel Ramos a, Kimberly L.

More information

Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).

Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted

More information

schematic diagram; EGF binding, dimerization, phosphorylation, Grb2 binding, etc.

schematic diagram; EGF binding, dimerization, phosphorylation, Grb2 binding, etc. Lecture 1: Noncovalent Biomolecular Interactions Bioengineering and Modeling of biological processes -e.g. tissue engineering, cancer, autoimmune disease Example: RTK signaling, e.g. EGFR Growth responses

More information

Model Worksheet Teacher Key

Model Worksheet Teacher Key Introduction Despite the complexity of life on Earth, the most important large molecules found in all living things (biomolecules) can be classified into only four main categories: carbohydrates, lipids,

More information

Structurale, Université Grenoble Alpes, CNRS, CEA, Grenoble, France

Structurale, Université Grenoble Alpes, CNRS, CEA, Grenoble, France Supplementary Information to Lysine relay mechanism coordinates intermediate transfer in vitamin B6 biosynthesis Matthew J. Rodrigues 1,2, Volker Windeisen 1,3, Yang Zhang 4, Gabriela Guédez 3, Stefan

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Dph2 SeMet (iron-free) # Dph2 (iron-free) Dph2-[4Fe-4S] Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 58.26, 82.08, 160.42 58.74, 81.87, 160.01 55.70, 80.53,

More information

A conserved P-loop anchor limits the structural dynamics that mediate. nucleotide dissociation in EF-Tu.

A conserved P-loop anchor limits the structural dynamics that mediate. nucleotide dissociation in EF-Tu. Supplemental Material for A conserved P-loop anchor limits the structural dynamics that mediate nucleotide dissociation in EF-Tu. Evan Mercier 1,2, Dylan Girodat 1, and Hans-Joachim Wieden 1 * 1 Alberta

More information

Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)

Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer

More information

Supplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine

Supplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine Supplementary figure 1. Comparison of unbound and as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine GM-CSF (slate) with bound GM-CSF in the GIF:GM-CSF complex (GIF: green,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Table 1: Amplitudes of three current levels. Level 0 (pa) Level 1 (pa) Level 2 (pa) TrkA- TrkH WT 200 K 0.01 ± 0.01 9.5 ± 0.01 18.7 ± 0.03 200 Na * 0.001 ± 0.01 3.9 ± 0.01 12.5 ± 0.03 200

More information

NB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5

NB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5 SUPPLEMENTARY TABLES Suppl. Table 1. Protonation states at ph 7.4 and 4.5. Protonation states of titratable residues in GCase at ph 7.4 and 4.5. Histidine: HID, H at δ-nitrogen; HIE, H at ε-nitrogen; HIP,

More information

Redox-Responsive Complexation between a. Pillar[5]arene with Mono ethylene oxide Substituents. and Paraquat

Redox-Responsive Complexation between a. Pillar[5]arene with Mono ethylene oxide Substituents. and Paraquat Redox-Responsive Complexation between a Pillar[5]arene with Mono ethylene oxide Substituents and Paraquat Xiaodong Chi, Min Xue, Yong Yao and Feihe Huang* MOE Key Laboratory of Macromolecular Synthesis

More information

Model Worksheet Student Handout

Model Worksheet Student Handout Introduction Despite the complexity of life on Earth, the most important large molecules found in all living things (biomolecules) can be classified into only four main categories: carbohydrates, lipids,

More information

RNA Polymerase I Contains a TFIIF-Related DNA-Binding Subcomplex

RNA Polymerase I Contains a TFIIF-Related DNA-Binding Subcomplex Molecular Cell, Volume 39 Supplemental Information RNA Polymerase I Contains a TFIIFRelated DNABinding Subcomplex Sebastian R. Geiger, Kristina Lorenzen, Amelie Schreieck, Patrizia Hanecker, Dirk Kostrewa,

More information

Presentation Microcalorimetry for Life Science Research

Presentation Microcalorimetry for Life Science Research Presentation Microcalorimetry for Life Science Research MicroCalorimetry The Universal Detector Heat is either generated or absorbed in every chemical process Capable of thermal measurements over a wide

More information

Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases

Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),

More information

Supplementary Figure 1 Schematic overview of ASTNs in neuronal migration. (a) Schematic of roles played by ASTNs 1 and 2. ASTN-1-mediated adhesions

Supplementary Figure 1 Schematic overview of ASTNs in neuronal migration. (a) Schematic of roles played by ASTNs 1 and 2. ASTN-1-mediated adhesions Supplementary Figure 1 Schematic overview of ASTNs in neuronal migration. (a) Schematic of roles played by ASTNs 1 and 2. ASTN-1-mediated adhesions undergo endocytosis into clathrin-coated vesicles dependent

More information

Impact of the crystallization condition on importin-β conformation

Impact of the crystallization condition on importin-β conformation Supporting information Volume 72 (2016) Supporting information for article: Impact of the crystallization condition on importin-β conformation Marcel J. Tauchert, Clément Hémonnot, Piotr Neumann, Sarah

More information

T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp

T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp S u p p l e m e n ta l m at e r i a l jgp Lee et al., http://www.jgp.org/cgi/content/full/jgp.201411219/dc1 T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y S u p p l e m e n ta l D I S C U S

More information

Nature Structural & Molecular Biology doi: /nsmb Supplementary Figure 1. CRBN binding assay with thalidomide enantiomers.

Nature Structural & Molecular Biology doi: /nsmb Supplementary Figure 1. CRBN binding assay with thalidomide enantiomers. Supplementary Figure 1 CRBN binding assay with thalidomide enantiomers. (a) Competitive elution assay using thalidomide-immobilized beads coupled with racemic thalidomide. Beads were washed three times

More information

Comparing crystal structure of M.HhaI with and without DNA1, 2 (PDBID:1hmy and PDBID:2hmy),

Comparing crystal structure of M.HhaI with and without DNA1, 2 (PDBID:1hmy and PDBID:2hmy), Supporting Information 1. Constructing the starting structure Comparing crystal structure of M.HhaI with and without DNA1, 2 (PDBID:1hmy and PDBID:2hmy), we find that: the RMSD of overall structure and

More information

Supplementary Information

Supplementary Information 1 Supplementary Information Figure S1 The V=0.5 Harker section of an anomalous difference Patterson map calculated using diffraction data from the NNQQNY crystal at 1.3 Å resolution. The position of the

More information

Chapter 9 DNA recognition by eukaryotic transcription factors

Chapter 9 DNA recognition by eukaryotic transcription factors Chapter 9 DNA recognition by eukaryotic transcription factors TRANSCRIPTION 101 Eukaryotic RNA polymerases RNA polymerase RNA polymerase I RNA polymerase II RNA polymerase III RNA polymerase IV Function

More information

Isothermal titration calorimetry (ITC)

Isothermal titration calorimetry (ITC) Isothermal titration calorimetry (ITC) Peter.gimeson@malvern.com Why microcalorimetry? Label-free Broad dynamic range Information rich Ease-of-use Direct measurement of heat change (ITC) Direct measurement

More information

THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN

THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina

More information

New Delhi Metallo-β-Lactamase: Structural Insights into β- Lactam Recognition and Inhibition

New Delhi Metallo-β-Lactamase: Structural Insights into β- Lactam Recognition and Inhibition Supporting Information New Delhi Metallo-β-Lactamase: Structural Insights into β- Lactam Recognition and Inhibition Dustin T. King, Liam J. Worrall, Robert Gruninger, Natalie C.J. Strynadka* AUTHOR ADDRESS:

More information

Three-dimensional structure of a viral genome-delivery portal vertex

Three-dimensional structure of a viral genome-delivery portal vertex Three-dimensional structure of a viral genome-delivery portal vertex Adam S. Olia 1, Peter E. Prevelige Jr. 2, John E. Johnson 3 and Gino Cingolani 4 1 Department of Biological Sciences, Purdue University,

More information

Supporting Information

Supporting Information Supporting Information Superagonist, Full Agonist, Partial Agonist and Antagonist Actions of Arylguanidines at 5-Hydroxytryptamine-3 (5-HT 3 ) Subunit A Receptors Katie Alix, Shailesh Khatri, Philip D.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION www.nature.com/nature 1 Figure S1 Sequence alignment. a Structure based alignment of the plgic of E. chrysanthemi (ELIC), the acetylcholine binding protein from the snail Lymnea stagnalis (AchBP, PDB code

More information

Viewing and Analyzing Proteins, Ligands and their Complexes 2

Viewing and Analyzing Proteins, Ligands and their Complexes 2 2 Viewing and Analyzing Proteins, Ligands and their Complexes 2 Overview Viewing the accessible surface Analyzing the properties of proteins containing thousands of atoms is best accomplished by representing

More information

Energetics of chitooligosaccharide binding to pumpkin (Cucurbita maxima) phloem exudate Lectin

Energetics of chitooligosaccharide binding to pumpkin (Cucurbita maxima) phloem exudate Lectin Chapter 3 Energetics of chitooligosaccharide binding to pumpkin (Cucurbita maxima) phloem exudate Lectin 50 Chapter 3 Energetics of 51 Summary Binding of chitooligosaccharides [(GlcNAc) 2-6 ] to pumpkin

More information

SUPPLEMENTARY FIGURES. Figure S1

SUPPLEMENTARY FIGURES. Figure S1 SUPPLEMENTARY FIGURES Figure S1 The substrate for DH domain (2R,3R,4R,6R,7S,8S,9R)-3,7,9-trihydroxy-5-oxo-2,4,6,8 tetramethylundecanoate) was docked as two separate fragments shown in magenta and blue

More information

MicroCal itc 200. System MicroCal Auto-iTC 200. System. GE Healthcare Life Sciences. System design and description. provide:

MicroCal itc 200. System MicroCal Auto-iTC 200. System. GE Healthcare Life Sciences. System design and description. provide: GE Healthcare Life Sciences Data file 28-97822 AC MicroCal label-free interaction analysis MicroCal itc 2 System MicroCal Auto-iTC 2 System MicroCal itc 2 and MicroCal Auto-iTC 2 isothermal titration calorimetry

More information

Structural basis for catalytically restrictive dynamics of a high-energy enzyme state

Structural basis for catalytically restrictive dynamics of a high-energy enzyme state Supplementary Material Structural basis for catalytically restrictive dynamics of a high-energy enzyme state Michael Kovermann, Jörgen Ådén, Christin Grundström, A. Elisabeth Sauer-Eriksson, Uwe H. Sauer

More information

SI Text S1 Solution Scattering Data Collection and Analysis. SI references

SI Text S1 Solution Scattering Data Collection and Analysis. SI references SI Text S1 Solution Scattering Data Collection and Analysis. The X-ray photon energy was set to 8 kev. The PILATUS hybrid pixel array detector (RIGAKU) was positioned at a distance of 606 mm from the sample.

More information

Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets

Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin

More information

Supplemental Data SUPPLEMENTAL FIGURES

Supplemental Data SUPPLEMENTAL FIGURES Supplemental Data CRYSTAL STRUCTURE OF THE MG.ADP-INHIBITED STATE OF THE YEAST F 1 C 10 ATP SYNTHASE Alain Dautant*, Jean Velours and Marie-France Giraud* From Université Bordeaux 2, CNRS; Institut de

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/5/243/ra68/dc1 Supplementary Materials for Superbinder SH2 Domains Act as Antagonists of Cell Signaling Tomonori Kaneko, Haiming Huang, Xuan Cao, Xing Li, Chengjun

More information

Biophysics II. Hydrophobic Bio-molecules. Key points to be covered. Molecular Interactions in Bio-molecular Structures - van der Waals Interaction

Biophysics II. Hydrophobic Bio-molecules. Key points to be covered. Molecular Interactions in Bio-molecular Structures - van der Waals Interaction Biophysics II Key points to be covered By A/Prof. Xiang Yang Liu Biophysics & Micro/nanostructures Lab Department of Physics, NUS 1. van der Waals Interaction 2. Hydrogen bond 3. Hydrophilic vs hydrophobic

More information

Model Mélange. Physical Models of Peptides and Proteins

Model Mélange. Physical Models of Peptides and Proteins Model Mélange Physical Models of Peptides and Proteins In the Model Mélange activity, you will visit four different stations each featuring a variety of different physical models of peptides or proteins.

More information

Part 8 Working with Nucleic Acids

Part 8 Working with Nucleic Acids Part 8 Working with Nucleic Acids http://cbm.msoe.edu/newwebsite/learntomodel Introduction Most Protein Databank files loaded into the CBM's Jmol Design Environment include protein structures and small

More information

Section III - Designing Models for 3D Printing

Section III - Designing Models for 3D Printing Section III - Designing Models for 3D Printing In this section of the Jmol Training Guide, you will become familiar with the commands needed to design a model that will be built on a 3D Printer. As you

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Parallel Allostery by camp and PDE Coordinates Activation and Termination Phases in camp Signaling Srinath Krishnamurthy, 1 Nikhil Kumar Tulsian, 1 Arun Chandramohan, 1 and Ganesh S. Anand 1, * 1 Department

More information

2: CHEMICAL COMPOSITION OF THE BODY

2: CHEMICAL COMPOSITION OF THE BODY 1 2: CHEMICAL COMPOSITION OF THE BODY Although most students of human physiology have had at least some chemistry, this chapter serves very well as a review and as a glossary of chemical terms. In particular,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11744 Supplementary Table 1. Crystallographic data collection and refinement statistics. Wild-type Se-Met-BcsA-B SmCl 3 -soaked EMTS-soaked Data collection Space

More information

F. Piazza Center for Molecular Biophysics and University of Orléans, France. Selected topic in Physical Biology. Lecture 1

F. Piazza Center for Molecular Biophysics and University of Orléans, France. Selected topic in Physical Biology. Lecture 1 Zhou Pei-Yuan Centre for Applied Mathematics, Tsinghua University November 2013 F. Piazza Center for Molecular Biophysics and University of Orléans, France Selected topic in Physical Biology Lecture 1

More information

Principles of Physical Biochemistry

Principles of Physical Biochemistry Principles of Physical Biochemistry Kensal E. van Hold e W. Curtis Johnso n P. Shing Ho Preface x i PART 1 MACROMOLECULAR STRUCTURE AND DYNAMICS 1 1 Biological Macromolecules 2 1.1 General Principles

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2016 Supporting Information Lipid molecules can induce an opening of membrane-facing

More information

Lecture 2-3: Review of forces (ctd.) and elementary statistical mechanics. Contributions to protein stability

Lecture 2-3: Review of forces (ctd.) and elementary statistical mechanics. Contributions to protein stability Lecture 2-3: Review of forces (ctd.) and elementary statistical mechanics. Contributions to protein stability Part I. Review of forces Covalent bonds Non-covalent Interactions Van der Waals Interactions

More information

Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached

Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached to HpUreI. Urea hydrolysis products 2NH 3 and 1CO 2

More information

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Experimental approach for enhancement of unbiased Fo Fc maps.

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Experimental approach for enhancement of unbiased Fo Fc maps. Supplementary Figure 1 Experimental approach for enhancement of unbiased Fo Fc maps. a, c, Unbiased Fo-Fc maps of the Tth 70S post-catalysis complex at 2.55 Å resolution with (a) or without (c) bulk solvent

More information

Catalytic Mechanism of the Glycyl Radical Enzyme 4-Hydroxyphenylacetate Decarboxylase from Continuum Electrostatic and QC/MM Calculations

Catalytic Mechanism of the Glycyl Radical Enzyme 4-Hydroxyphenylacetate Decarboxylase from Continuum Electrostatic and QC/MM Calculations Catalytic Mechanism of the Glycyl Radical Enzyme 4-Hydroxyphenylacetate Decarboxylase from Continuum Electrostatic and QC/MM Calculations Supplementary Materials Mikolaj Feliks, 1 Berta M. Martins, 2 G.

More information