Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR
|
|
- Iris Bailey
- 5 years ago
- Views:
Transcription
1 Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR
2 Residual Dipolar Couplings (RDC s) Relatively new technique ~ 1996 Nico Tjandra, Ad Bax- NIH, Jim Prestegard, UGA Combination of ideas from solid state NMR, and liquid crystal chemistry NMR (Saupé, early 1960 s) Complementary information for NMR structural determinations, novel information for inter-domain orientation, dynamics and intermolecular complexes
3 Classical NMR Structure Determination 1980 s Wuthrich s lab, Gerhard Wagner Most NMR structures rely on NOEs NOE- Nuclear Overhauser Effect ( or enhancement) Dipolar interactions between 1 H s Only detectable for 1 H s separated by <6 Å Can be interpreted on in terms of a loosely defined distances between 1 H s, no directional information
4 NMR Structure Determination Essentially you fold the polypeptide chain to find the best fit to the NOEs
5 NOE Structures Usually NOEs identified per residue, ~60-70% of NOEs are intraresidue or to a neighbouring residue Well determined secondary and tertiary structures of globular domains due to large number of loose constraints Difficult to identify interdomain and intermolecular NOEs: NOE intensity is sensitive to dynamics of nuclei involved
6 J(spin-spin)-coupling 15 N J N-H =93 Hz 1 H (decoupled) ppm ppm (not decoupled) Only occurs between covalently bonded nuclei (very weak coupling also seen in some H-bonded systems) Independent of dynamics and magnetic field strength
7 Dipolar Coupling B 0 θ 1 H 15 N In isotropic solution J N-H + ν D = 93Hz (not decoupled) Dipolar coupling- through space interaction, bonded or unbonded ppm ν D = ν (3cos 2 θ-1) /2 ν = (γ H γ N h)/(4π 2 r 3 ) ν Dipolar coupling constant N-H r= 1.02Å, ν = 22,600 Hz H-H r= 3.0 Å, ν = 4,500 Hz
8 Solid State NMR: dipolar coupling Samples in powders, crystals, membranes etc No motional averaging of dipolar coupling ν D = ν (3cos 2 θ-1)/2 ν D B 0 θ 1 H 15 N -very broad overlapping signals, low signal to noise but directional information Hz
9 Residual Dipolar Coupling Goal is to get some of the orientational information without the line broadening ν D = ν (3cos 2 θ-1) /2, ν = (γ H γ N h)/(4π 2 r 3 ) J N-H + ν D = 93Hz (not decoupled) ppm J N-H + ν D = 110Hz ppm B 0 -isotropic tumbling: no preferred orientation to B 0 B 0 -anisotropic
10 Partial Alignment Techniques for Proteins (1) DNA, RNA have large anisotropic magnetic susceptibilities, aromatic ring stacking effects (2) paramagnetic ions bound to proteins also can cause alignment (3) liquid crystal media-molecules with large (unlabeled, NMR invisible) anisotropic magnetic susceptibilities will align with magnetic field and form a liquid crystal:ie phage, bicelles, purple membranes.. (4) mechanical-stretched or compressed polyacrylamide gels
11 Liquid Crystal Media B 0 -ie: bicelles (a mixture of phospholipids, DMPC(14), DHPC(6)) form disc or puck shaped structures that align with the magnetic field (Sanders, 1992) -interaction of the protein with the liquid crystal is non-specific steric hindrance of some orientations leading to a small fraction in a preferred orientation
12 Alternate Alignment Methods Phage primarily electrostatic interactions with proteins Gels radial or axial compression, charged or steric interactions
13 Measuring RDC s Need to orient the protein about 10-3 of the time to get N-H dipolar couplings of ~ 0-±30 Hz, size of ν D can be tuned by varying the concentration of the alignment media J J+ ν D T4 lysozyme
14 How to convert measured RDC s into structural information Define an arbitrary molecular frame for the protein Relate molecular frame to a molecular alignment tensor to the magnetic field: A A: (3x3) matrix that define direction and degree of alignment relative to B 0 A a :axial component A r :rhombic component S: order parameter r ij : NH bond length
15 Defining the Alignment Tensor If structure (or preliminary structure) is known and alignment is steric it can be calculated If structure is not known then the alignment tensor can be determined from the distribution of rdc s
16 (a)bands defined for θ and φ values for an NH vector in ubiquitin relative to the alignment frame (b) no way to tell the difference between A ZZ and -A ZZ
17 Data Interpretation Once an alignment tensor is defined the RDC s can be interpreted in terms of the angle each bond vector makes with a reference frame Can then be used for data refinement in structure calculations degeneracy can be reduced by using two alignment media
18
19 Data Refinement Usually not used in initial refinement steps Once initial NOE structure is calculated, and reasonable fold defined then RDCs can be used to further refine most degenerate orientations can be ruled out by initial fold Calculate RDC based on initial structure E dip =k dip (ν calc - ν meas ) 2 Energy minimize for best fit
20 RDC refinement improves structures, lower RMSD, more angles in good Ramachandran regions Homology models can be refined using just chemical shift assignments and rdc s -good for structural genomics approaches Ab initio structures have been done but are not common (Hus et al, J. Mol. Biol.298:927,2000)
21 B 0 Overlay of structure of the CVN protein Red with rdc s Blue without rdc s Small difference Between structures Large difference in quality indicators
22 Multiple Dipolar Couplings Can define orientation of peptide planes
23 Orienting Domains Each domain treated separately for initial NOE derived fold and for RDCs Determine the molecular alignment tensor for each domain No translational information, NOE or covalent linker restraints are necessary Wheat germ agglutinin(a) vs BLBC (Biochemistry Jul 13;38(28): ) NMR X-ray
24 RDC s have a dramatic effect on NMR structures of nucleic acid because of low density of 1 H s and hence few NOEs
25 Interpretation of Dynamics using RDCs NMR relaxation studies are very useful for identifying the location and rates of dynamic motions in proteins in solution RDC s can also potentially be used to identify the magnitude and orientation of motions Relative orientation of BLBC domains is not constant in solution
26 Dynamics from RDC s Approaches are still being developed alignment tensor contains information about degree of ordering A generalized degree of order parameter (GDO) can be defined for the a protein or a subset of a protein Ratio of fragment GDO to overall GDO gives an order parameter υ υ, S NH or _, and S CαHα ---
27 Gaussian Average Fluctuation (GAF) of peptide planes in protein G (Bouvignes et al, PNAS (2005) 102, ) -millisecond timescale
28 Summary Dipolar couplings provide a non-short range structural restraint that can be used to improve the quality of globular protein domain structures Dramatically improve the knowledge of interdomain orientation in proteins and nuclei acids Allows new insights into protein dynamics and some knowledge of the types of motions involved Allows accurate docking of intermolecular complexes with minimal NOE input
Dipolar Couplings in Partially Aligned Macromolecules - New Directions in. Structure Determination using Solution State NMR.
Dipolar Couplings in Partially Aligned Macromolecules - New Directions in Structure Determination using Solution State NMR. Recently developed methods for the partial alignment of macromolecules in dilute
More informationOrientational degeneracy in the presence of one alignment tensor.
Orientational degeneracy in the presence of one alignment tensor. Rotation about the x, y and z axes can be performed in the aligned mode of the program to examine the four degenerate orientations of two
More informationInterpreting and evaluating biological NMR in the literature. Worksheet 1
Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively
More informationNMR in Structural Biology
NMR in Structural Biology Exercise session 2 1. a. List 3 NMR observables that report on structure. b. Also indicate whether the information they give is short/medium or long-range, or perhaps all three?
More informationExperimental Techniques in Protein Structure Determination
Experimental Techniques in Protein Structure Determination Homayoun Valafar Department of Computer Science and Engineering, USC Two Main Experimental Methods X-Ray crystallography Nuclear Magnetic Resonance
More informationIntroduction solution NMR
2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,100 116,000 120M Open access books available International authors and editors Downloads Our
More informationProtein Structure Determination Using NMR Restraints BCMB/CHEM 8190
Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brunger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationI690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy
I690/B680 Structural Bioinformatics Spring 2006 Protein Structure Determination by NMR Spectroscopy Suggested Reading (1) Van Holde, Johnson, Ho. Principles of Physical Biochemistry, 2 nd Ed., Prentice
More informationIntroduction to biomolecular NMR spectroscopy
Oct 2002 Introduction to biomolecular NMR spectroscopy Michael Sattler, Structural & Computational Biology EMBL Heidelberg Contents Introduction...2 History... 3 Methodological developments for structure
More informationPractical Manual. General outline to use the structural information obtained from molecular alignment
Practical Manual General outline to use the structural information obtained from molecular alignment 1. In order to use the information one needs to know the direction and the size of the tensor (susceptibility,
More informationMagnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A
Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu " J.A. 12/11/13 Dec. 4 Dec. 9 Dec. 11" " Outline" " 1. Introduction / Spectroscopy Overview 2. NMR Spectroscopy
More informationResidual Dipolar Couplings BCMB/CHEM 8190
Residual Dipolar Couplings BCMB/CHEM 8190 Recent Reviews Prestegard, A-Hashimi & Tolman, Quart. Reviews Biophys. 33, 371-424 (2000). Bax, Kontaxis & Tjandra, Methods in Enzymology, 339, 127-174 (2001)
More informationSolving the three-dimensional solution structures of larger
Accurate and rapid docking of protein protein complexes on the basis of intermolecular nuclear Overhauser enhancement data and dipolar couplings by rigid body minimization G. Marius Clore* Laboratory of
More informationA.D.J. van Dijk "Modelling of biomolecular complexes by data-driven docking"
Chapter 3. Various strategies of using Residual Dipolar Couplings in NMRdriven protein docking: application to Lys48-linked di-ubiquitin and validation against 15 N-relaxation data. Aalt D.J. van Dijk,
More informationPrinciples of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination
1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination Protein Expression overexpression in E. coli - BL21(DE3) 1
More information1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )
Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,
More informationResidual Dipolar Couplings: Measurements and Applications to Biomolecular Studies
Residual Dipolar Couplings: Measurements and Applications to Biomolecular Studies Weidong Hu Lincong Wang Abstract Since the first successful demonstration of the tunable alignment of ubiquitin in an anisotropic
More informationNMR Assay of Purity and Folding
NMR Assay of Purity and Folding Don t Need Resonance Assignments or Labeling 1D requires only 10-50 µm protein concentration 2D Provides A More Detailed Assay 15 N- 1 H HSQC 1 H COSY 13 C HSQC also! Analyze
More informationProtein Structure Analysis and Verification. Course S Basics for Biosystems of the Cell exercise work. Maija Nevala, BIO, 67485U 16.1.
Protein Structure Analysis and Verification Course S-114.2500 Basics for Biosystems of the Cell exercise work Maija Nevala, BIO, 67485U 16.1.2008 1. Preface When faced with an unknown protein, scientists
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen Transverse Relaxation Ensemble
More informationChittaranjan Tripathy 1, Anthony K. Yan 1,2, Pei Zhou 2, and Bruce Randall Donald 1,2,
Extracting Structural Information from Residual Chemical Shift Anisotropy: Analytic Solutions for Peptide Plane Orientations and Applications to Determine Protein Structure Chittaranjan Tripathy 1, Anthony
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Summary of 1D Experiment time domain data Fourier Transform (FT) frequency domain data or Transverse Relaxation Ensemble of Nuclear
More information6 NMR Interactions: Zeeman and CSA
6 NMR Interactions: Zeeman and CSA 6.1 Zeeman Interaction Up to this point, we have mentioned a number of NMR interactions - Zeeman, quadrupolar, dipolar - but we have not looked at the nature of these
More informationProtein Structure Determination Using NMR Restraints BCMB/CHEM 8190
Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationResidual Dipolar Couplings Measured in Multiple Alignment Media.
Residual Dipolar Couplings Measured in Multiple Alignment Media. We have already seen that the orientational degeneracy inherent to a single measured coupling can be raised by measuring different directions
More informationRESIDUAL DIPOLAR COUPLINGS BCMB/CHEM 8190
RESIDUAL DIPOLAR COUPLINGS BCMB/CHEM 8190 Long-Range Structural NMR Restraints Traditional NOE-based protein structure determination methods suffer from the lack of long-range structural restraints - in
More informationSolid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum,
Solid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum, 16.02.2009 Solid-state and solution NMR spectroscopy have many things in common Several concepts have been/will
More informationPROTEIN'STRUCTURE'DETERMINATION'
PROTEIN'STRUCTURE'DETERMINATION' USING'NMR'RESTRAINTS' BCMB/CHEM'8190' Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationOrigin of Scalar Couplings BCMB/CHEM 8190
Origin of Scalar Couplings BCMB/CHEM 8190 Traditional View of Scalar Coupling Splitting of NMR signals due to through-bond interactions between nuclei is called scalar coupling (or J coupling or through-bond
More informationPrinciples of Physical Biochemistry
Principles of Physical Biochemistry Kensal E. van Hold e W. Curtis Johnso n P. Shing Ho Preface x i PART 1 MACROMOLECULAR STRUCTURE AND DYNAMICS 1 1 Biological Macromolecules 2 1.1 General Principles
More informationNMR parameters intensity chemical shift coupling constants 1D 1 H spectra of nucleic acids and proteins
Lecture #2 M230 NMR parameters intensity chemical shift coupling constants Juli Feigon 1D 1 H spectra of nucleic acids and proteins NMR Parameters A. Intensity (area) 1D NMR spectrum: integrated intensity
More informationHSQC spectra for three proteins
HSQC spectra for three proteins SH3 domain from Abp1p Kinase domain from EphB2 apo Calmodulin What do the spectra tell you about the three proteins? HSQC spectra for three proteins Small protein Big protein
More informationT 1, T 2, NOE (reminder)
T 1, T 2, NOE (reminder) T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations of the system following perturbation
More informationIntroduction to" Protein Structure
Introduction to" Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Learning Objectives Outline the basic levels of protein structure.
More informationNMR, X-ray Diffraction, Protein Structure, and RasMol
NMR, X-ray Diffraction, Protein Structure, and RasMol Introduction So far we have been mostly concerned with the proteins themselves. The techniques (NMR or X-ray diffraction) used to determine a structure
More informationProtein NMR spectroscopy
Protein NMR spectroscopy Perttu Permi National Biological NMR Center, Institute of Biotechnology, University of elsinki Protein NMR spectroscopy course, 19th January 2009 1 spectrum of 20 kda Ca-binding
More informationPROTEIN NMR SPECTROSCOPY
List of Figures List of Tables xvii xxvi 1. NMR SPECTROSCOPY 1 1.1 Introduction to NMR Spectroscopy 2 1.2 One Dimensional NMR Spectroscopy 3 1.2.1 Classical Description of NMR Spectroscopy 3 1.2.2 Nuclear
More informationEvaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example
Biochemistry 2000, 39, 13365-13375 13365 Evaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example Xuemei Huang,
More informationKey words: alignment tensor, dipolar coupling, histogram, liquid crystal, molecular alignment, powder pattern, residual dipolar couplings, RNA
Journal of Biomolecular NMR 28: 273 287, 2004. KLUWER/ESCOM 2004 Kluwer Academic Publishers. Printed in the Netherlands. 273 Application of correlated residual dipolar couplings to the determination of
More informationProteins are not rigid structures: Protein dynamics, conformational variability, and thermodynamic stability
Proteins are not rigid structures: Protein dynamics, conformational variability, and thermodynamic stability Dr. Andrew Lee UNC School of Pharmacy (Div. Chemical Biology and Medicinal Chemistry) UNC Med
More informationSupplementary Materials belonging to
Supplementary Materials belonging to Solution conformation of the 70 kda E.coli Hsp70 complexed with ADP and substrate. Eric B. Bertelsen 1, Lyra Chang 2, Jason E. Gestwicki 2 and Erik R. P. Zuiderweg
More informationProtein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.
Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small
More informationNMR in Medicine and Biology
NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR
More informationA new approach for applying residual dipolar couplings as restraints in structure elucidation
Journal of Biomolecular NMR, 16: 245 252, 2000. KLUWER/ESCOM 2000 Kluwer Academic Publishers. Printed in the Netherlands. 245 A new approach for applying residual dipolar couplings as restraints in structure
More informationDetermining Protein Structure BIBC 100
Determining Protein Structure BIBC 100 Determining Protein Structure X-Ray Diffraction Interactions of x-rays with electrons in molecules in a crystal NMR- Nuclear Magnetic Resonance Interactions of magnetic
More informationSequential resonance assignments in (small) proteins: homonuclear method 2º structure determination
Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield
More informationBiochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationEXAM I COURSE TFY4310 MOLECULAR BIOPHYSICS December Suggested resolution
page 1 of 7 EXAM I COURSE TFY4310 MOLECULAR BIOPHYSICS December 2013 Suggested resolution Exercise 1. [total: 25 p] a) [t: 5 p] Describe the bonding [1.5 p] and the molecular orbitals [1.5 p] of the ethylene
More information1. 3-hour Open book exam. No discussion among yourselves.
Lecture 13 Review 1. 3-hour Open book exam. No discussion among yourselves. 2. Simple calculations. 3. Terminologies. 4. Decriptive questions. 5. Analyze a pulse program using density matrix approach (omonuclear
More informationMacromolecular X-ray Crystallography
Protein Structural Models for CHEM 641 Fall 07 Brian Bahnson Department of Chemistry & Biochemistry University of Delaware Macromolecular X-ray Crystallography Purified Protein X-ray Diffraction Data collection
More informationResonance assignments in proteins. Christina Redfield
Resonance assignments in proteins Christina Redfield 1. Introduction The assignment of resonances in the complex NMR spectrum of a protein is the first step in any study of protein structure, function
More informationNMR journey. Introduction to solution NMR. Alexandre Bonvin. Topics. Why use NMR...? Bijvoet Center for Biomolecular Research
2 NMR journey Introduction to solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, CCMB, Hyderabad, India November 29th
More informatione 2m e c I, (7.1) = g e β B I(I +1), (7.2) = erg/gauss. (7.3)
Chemistry 126 Molecular Spectra & Molecular Structure Week # 7 Electron Spin Resonance Spectroscopy, Supplement Like the hydrogen nucleus, an unpaired electron in a sample has a spin of I=1/2. The magnetic
More informationSolid state and advanced NMR
Solid state and advanced NMR Dr. Magnus Wolf-Watz Department of Chemistry Umeå University magnus.wolf-watz@chem.umu.se NMR is useful for many things!!! Chemistry Structure of small molecules, chemical
More informationThe Physical Basis of the NMR Experiment
The Physical Basis of the NMR Experiment 1 Interaction of Materials with Magnetic Fields F F S N S N Paramagnetism Diamagnetism 2 Microscopic View: Single Spins an electron has mass and charge in addition
More informationH B. θ = 90 o. Lecture notes Part 4: Spin-Spin Coupling. θ θ
Lecture notes Part 4: Spin-Spin Coupling F. olger Försterling October 4, 2011 So far, spins were regarded spins isolated from each other. owever, the magnetic moment of nuclear spins also have effect on
More informationStructure Determination of Membrane Proteins by NMR Spectroscopy
Chem. Rev. 2004, 104, 3587 3606 3587 Structure Determination of Membrane Proteins by NMR Spectroscopy Stanley J. Opella*, and Francesca M. Marassi Department of Chemistry and Biochemistry, University of
More informationBCMB / CHEM 8190 Biomolecular NMR GRADUATE COURSE OFFERING IN NUCLEAR MAGNETIC RESONANCE
BCMB / CHEM 8190 Biomolecular NMR GRADUATE COURSE OFFERING IN NUCLEAR MAGNETIC RESONANCE "Biomolecular Nuclear Magnetic Resonance" is a course intended for all graduate students with an interest in applications
More informationDeuteration: Structural Studies of Larger Proteins
Deuteration: Structural Studies of Larger Proteins Problems with larger proteins Impact of deuteration on relaxation rates Approaches to structure determination Practical aspects of producing deuterated
More informationA Probability-Based Similarity Measure for Saupe Alignment Tensors with Applications to Residual Dipolar Couplings in NMR Structural Biology
A Probability-Based Similarity Measure for Saupe Alignment Tensors with Applications to Residual Dipolar Couplings in NMR Structural Biology Anthony K. Yan Christopher J. Langmead Bruce Randall Donald,,,,
More informationBruce Randall Donald Professor Department of Computer Science Department of Chemistry Department of Biological Sciences
This is an electronic reprint of: C. Langmead, A. Yan, R. Lilien, L. Wang, and B. R. Donald. A Polynomial-Time Nuclear Vector Replacement Algorithm for Automated NMR Resonance Assignments. Proceedings
More informationMagic-Angle Spinning (MAS) drive bearing
Magic-Angle Spinning (MAS) magic-angle spinning is done pneumatically spinning frequency can be stabilized within a few Hz Magic-Angle Spinning (MAS) drive bearing Magic-Angle Spinning (MAS) Maximum spinning
More informationPAPER No. 12: ORGANIC SPECTROSCOPY. Module 19: NMR Spectroscopy of N, P and F-atoms
Subject Chemistry Paper No and Title Module No and Title Module Tag Paper 12: Organic Spectroscopy CHE_P12_M19_e-Text TABLE OF CONTENTS 1. Learning Outcomes 2. 15 N NMR spectroscopy 3. 19 F NMR spectroscopy
More informationContents. xiii. Preface v
Contents Preface Chapter 1 Biological Macromolecules 1.1 General PrincipIes 1.1.1 Macrornolecules 1.2 1.1.2 Configuration and Conformation Molecular lnteractions in Macromolecular Structures 1.2.1 Weak
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin
More informationBasics of protein structure
Today: 1. Projects a. Requirements: i. Critical review of one paper ii. At least one computational result b. Noon, Dec. 3 rd written report and oral presentation are due; submit via email to bphys101@fas.harvard.edu
More informationMolecular Modeling lecture 2
Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography
More informationProtein dynamics from NMR Relaxation data
Protein dynamics from NMR Relaxation data Clubb 3/15/17 (S f2 ) ( e ) Nitrogen-15 relaxation ZZ-exchange R 1 = 1/T 1 Longitudinal relaxation (decay back to z-axis) R 2 = 1/T 2 Spin-spin relaxation (dephasing
More informationDesign of a Novel Globular Protein Fold with Atomic-Level Accuracy
Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Brian Kuhlman, Gautam Dantas, Gregory C. Ireton, Gabriele Varani, Barry L. Stoddard, David Baker Presented by Kate Stafford 4 May 05 Protein
More informationHomology Modeling (Comparative Structure Modeling) GBCB 5874: Problem Solving in GBCB
Homology Modeling (Comparative Structure Modeling) Aims of Structural Genomics High-throughput 3D structure determination and analysis To determine or predict the 3D structures of all the proteins encoded
More informationChem8028(1314) - Spin Dynamics: Spin Interactions
Chem8028(1314) - Spin Dynamics: Spin Interactions Malcolm Levitt see also IK m106 1 Nuclear spin interactions (diamagnetic materials) 2 Chemical Shift 3 Direct dipole-dipole coupling 4 J-coupling 5 Nuclear
More informationWhere do we stand on Projection NMR Spectroscopy? Thomas Szyperski Chianti Workshop 06/05/07
Where do we stand on Projection NMR Spectroscopy? Definition: Projection Mapping an N dimensional vector space onto an N-K dimensional sub-space Associated Definitions Specify field over which vector space
More informationTheoretical Analysis of Residual Dipolar Coupling Patterns in Regular Secondary Structures of Proteins
Published on Web 09/8/003 Theoretical Analysis of Residual Dipolar Coupling Patterns in Regular Secondary Structures of Proteins Alessandro Mascioni and Gianluigi Veglia* Contribution from the Department
More informationUsing NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017
Using NMR to study Macromolecular Interactions John Gross, BP204A UCSF Nov 27, 2017 Outline Review of basic NMR experiment Multidimensional NMR Monitoring ligand binding Structure Determination Review:
More informationMolecular Mechanics. I. Quantum mechanical treatment of molecular systems
Molecular Mechanics I. Quantum mechanical treatment of molecular systems The first principle approach for describing the properties of molecules, including proteins, involves quantum mechanics. For example,
More informationName: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10
Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Instructions: This is an open book, limited time, exam. You may use notes you have from class and any text book you find useful. You may also use
More informationNMR Spectroscopy. Guangjin Hou
NMR Spectroscopy Guangjin Hou 22-04-2009 NMR History 1 H NMR spectra of water H NMR spectra of water (First NMR Spectra on Water, 1946) 1 H NMR spectra ethanol (First bservation of the Chemical Shift,
More informationA Combined Optical and EPR Spectroscopy Study: Azobenzene-Based Biradicals as Reversible Molecular Photoswitches
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2017 A Combined Optical and EPR Spectroscopy Study: Azobenzene-Based Biradicals as Reversible
More informationDipolar Couplings in Partially Aligned Macromolecules - New Directions in Structure Determination using Solution State NMR.
Dipolar Couplings in Partially Aligned Macromolecules - New Directions in Structure Determination using Solution State NMR. NMR spectroscopy is now established as the most effective method for the determination
More informationNMR of large protein systems: Solid state and dynamic nuclear polarization. Sascha Lange, Leibniz-Institut für Molekulare Pharmakologie (FMP)
NMR of large protein systems: Solid state and dynamic nuclear polarization Sascha Lange, Leibniz-Institut für Molekulare Pharmakologie (FMP) The Aim of the Game solution NMR other methods solid state NMR
More informationSpin Relaxation and NOEs BCMB/CHEM 8190
Spin Relaxation and NOEs BCMB/CHEM 8190 T 1, T 2 (reminder), NOE T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations
More informationProtein Structure. W. M. Grogan, Ph.D. OBJECTIVES
Protein Structure W. M. Grogan, Ph.D. OBJECTIVES 1. Describe the structure and characteristic properties of typical proteins. 2. List and describe the four levels of structure found in proteins. 3. Relate
More informationStructurele Biologie NMR
MR journey Structurele Biologie MR 5 /3C 3 /65 MR & Structural biology course setup lectures - Sprangers R & Kay LE ature (27) basics of MR (Klaartje ouben: k.houben@uu.nl; 4/2) from peaks to data (ans
More informationLecture #6 (The NOE)
Lecture #6 (The OE) 2/18/15 Clubb Determining Protein tructures by MR: Measure thousands of shorter inter-hydrogen atom distances. Use these to restrain the structure of protein computationally. Distance
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationSolution Structure and Backbone Dynamics of the TGFβ Type II Receptor Extracellular Domain,
026 Biochemistry 2003, 42, 026-039 Solution Structure and Backbone Dynamics of the TGFβ Type II Receptor Extracellular Domain, Shashank Deep, Kerfoot P. Walker, III, Zhanyong Shu, and Andrew P. Hinck*,
More informationFiltered/edited NOESY spectra
Filtered/edited NOESY spectra NMR Seminar HS 207 Nina Ripin 22..7 Overview NMR of biomolecular complexes Problems and Solutions Filtered/edited nomenclature Experimental elements NOESY vs filtered pulse
More informationRaman Optical Activity Comes of Age
Raman Optical Activity Comes of Age Laurence D. Barron Department of Chemistry, University of Glasgow, Glasgow G12 8QQ, UK E-mail: laurence.barron@glasgow.ac.uk Raman optical activity (ROA) provides vibrational
More informationSpin Interactions. Giuseppe Pileio 24/10/2006
Spin Interactions Giuseppe Pileio 24/10/2006 Magnetic moment µ = " I ˆ µ = " h I(I +1) " = g# h Spin interactions overview Zeeman Interaction Zeeman interaction Interaction with the static magnetic field
More informationNMR (CHEM8028) Solid-state NMR: Anisotropic interactions and how we use them. Dr Philip Williamson January 2015
NMR (CEM808) Solid-state NMR: Anisotropic interactions and how we use them Dr Philip Williamson January 015 NMR: From Molecular to Cellular Level Cell Solid State NMR Mitochondrion Membrane Liquid NMR
More informationTo Do s. Read Chapter 3. Complete the end-of-chapter problems, 3-1, 3-3, 3-4, 3-6 and 3-7. Answer Keys are available in CHB204H
Read Chapter 3. To Do s Complete the end-of-chapter problems, 3-1, 3-3, 3-4, 3-6 and 3-7 Answer Keys are available in CB204 NMR Chemical Shifts Further Discussion A set of spectral data is reported when
More informationMagnetic Resonance Spectroscopy
INTRODUCTION TO Magnetic Resonance Spectroscopy ESR, NMR, NQR D. N. SATHYANARAYANA Formerly, Chairman Department of Inorganic and Physical Chemistry Indian Institute of Science, Bangalore % I.K. International
More informationProtein Structure Marianne Øksnes Dalheim, PhD candidate Biopolymers, TBT4135, Autumn 2013
Protein Structure Marianne Øksnes Dalheim, PhD candidate Biopolymers, TBT4135, Autumn 2013 The presentation is based on the presentation by Professor Alexander Dikiy, which is given in the course compedium:
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice David Baker Autumn Quarter 2014 Slides Courtesy of Gabriele Varani Recommended NMR Textbooks Derome, A. E. (1987) Modern NMR Techniques for Chemistry Research,
More informationNMR Relaxation and Molecular Dynamics
Ecole RMN Cargese Mars 2008 NMR Relaxation and Molecular Dynamics Martin Blackledge IBS Grenoble Carine van Heijenoort ICSN, CNRS Gif-sur-Yvette Solution NMR Timescales for Biomolecular Motion ps ns µs
More informationMagnetic Nuclei other than 1 H
Magnetic Nuclei other than 1 H 2 H (Deuterium): I = 1 H,D-Exchange might be used to simplify 1 H-NMR spectra since H-D couplings are generally small; - - - -O- - - -D 2 -O- triplet of triplets slightly
More informationTHE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION
THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION AND CALIBRATION Calculation of turn and beta intrinsic propensities. A statistical analysis of a protein structure
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More information