Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR

Size: px
Start display at page:

Download "Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR"

Transcription

1 Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR

2 Residual Dipolar Couplings (RDC s) Relatively new technique ~ 1996 Nico Tjandra, Ad Bax- NIH, Jim Prestegard, UGA Combination of ideas from solid state NMR, and liquid crystal chemistry NMR (Saupé, early 1960 s) Complementary information for NMR structural determinations, novel information for inter-domain orientation, dynamics and intermolecular complexes

3 Classical NMR Structure Determination 1980 s Wuthrich s lab, Gerhard Wagner Most NMR structures rely on NOEs NOE- Nuclear Overhauser Effect ( or enhancement) Dipolar interactions between 1 H s Only detectable for 1 H s separated by <6 Å Can be interpreted on in terms of a loosely defined distances between 1 H s, no directional information

4 NMR Structure Determination Essentially you fold the polypeptide chain to find the best fit to the NOEs

5 NOE Structures Usually NOEs identified per residue, ~60-70% of NOEs are intraresidue or to a neighbouring residue Well determined secondary and tertiary structures of globular domains due to large number of loose constraints Difficult to identify interdomain and intermolecular NOEs: NOE intensity is sensitive to dynamics of nuclei involved

6 J(spin-spin)-coupling 15 N J N-H =93 Hz 1 H (decoupled) ppm ppm (not decoupled) Only occurs between covalently bonded nuclei (very weak coupling also seen in some H-bonded systems) Independent of dynamics and magnetic field strength

7 Dipolar Coupling B 0 θ 1 H 15 N In isotropic solution J N-H + ν D = 93Hz (not decoupled) Dipolar coupling- through space interaction, bonded or unbonded ppm ν D = ν (3cos 2 θ-1) /2 ν = (γ H γ N h)/(4π 2 r 3 ) ν Dipolar coupling constant N-H r= 1.02Å, ν = 22,600 Hz H-H r= 3.0 Å, ν = 4,500 Hz

8 Solid State NMR: dipolar coupling Samples in powders, crystals, membranes etc No motional averaging of dipolar coupling ν D = ν (3cos 2 θ-1)/2 ν D B 0 θ 1 H 15 N -very broad overlapping signals, low signal to noise but directional information Hz

9 Residual Dipolar Coupling Goal is to get some of the orientational information without the line broadening ν D = ν (3cos 2 θ-1) /2, ν = (γ H γ N h)/(4π 2 r 3 ) J N-H + ν D = 93Hz (not decoupled) ppm J N-H + ν D = 110Hz ppm B 0 -isotropic tumbling: no preferred orientation to B 0 B 0 -anisotropic

10 Partial Alignment Techniques for Proteins (1) DNA, RNA have large anisotropic magnetic susceptibilities, aromatic ring stacking effects (2) paramagnetic ions bound to proteins also can cause alignment (3) liquid crystal media-molecules with large (unlabeled, NMR invisible) anisotropic magnetic susceptibilities will align with magnetic field and form a liquid crystal:ie phage, bicelles, purple membranes.. (4) mechanical-stretched or compressed polyacrylamide gels

11 Liquid Crystal Media B 0 -ie: bicelles (a mixture of phospholipids, DMPC(14), DHPC(6)) form disc or puck shaped structures that align with the magnetic field (Sanders, 1992) -interaction of the protein with the liquid crystal is non-specific steric hindrance of some orientations leading to a small fraction in a preferred orientation

12 Alternate Alignment Methods Phage primarily electrostatic interactions with proteins Gels radial or axial compression, charged or steric interactions

13 Measuring RDC s Need to orient the protein about 10-3 of the time to get N-H dipolar couplings of ~ 0-±30 Hz, size of ν D can be tuned by varying the concentration of the alignment media J J+ ν D T4 lysozyme

14 How to convert measured RDC s into structural information Define an arbitrary molecular frame for the protein Relate molecular frame to a molecular alignment tensor to the magnetic field: A A: (3x3) matrix that define direction and degree of alignment relative to B 0 A a :axial component A r :rhombic component S: order parameter r ij : NH bond length

15 Defining the Alignment Tensor If structure (or preliminary structure) is known and alignment is steric it can be calculated If structure is not known then the alignment tensor can be determined from the distribution of rdc s

16 (a)bands defined for θ and φ values for an NH vector in ubiquitin relative to the alignment frame (b) no way to tell the difference between A ZZ and -A ZZ

17 Data Interpretation Once an alignment tensor is defined the RDC s can be interpreted in terms of the angle each bond vector makes with a reference frame Can then be used for data refinement in structure calculations degeneracy can be reduced by using two alignment media

18

19 Data Refinement Usually not used in initial refinement steps Once initial NOE structure is calculated, and reasonable fold defined then RDCs can be used to further refine most degenerate orientations can be ruled out by initial fold Calculate RDC based on initial structure E dip =k dip (ν calc - ν meas ) 2 Energy minimize for best fit

20 RDC refinement improves structures, lower RMSD, more angles in good Ramachandran regions Homology models can be refined using just chemical shift assignments and rdc s -good for structural genomics approaches Ab initio structures have been done but are not common (Hus et al, J. Mol. Biol.298:927,2000)

21 B 0 Overlay of structure of the CVN protein Red with rdc s Blue without rdc s Small difference Between structures Large difference in quality indicators

22 Multiple Dipolar Couplings Can define orientation of peptide planes

23 Orienting Domains Each domain treated separately for initial NOE derived fold and for RDCs Determine the molecular alignment tensor for each domain No translational information, NOE or covalent linker restraints are necessary Wheat germ agglutinin(a) vs BLBC (Biochemistry Jul 13;38(28): ) NMR X-ray

24 RDC s have a dramatic effect on NMR structures of nucleic acid because of low density of 1 H s and hence few NOEs

25 Interpretation of Dynamics using RDCs NMR relaxation studies are very useful for identifying the location and rates of dynamic motions in proteins in solution RDC s can also potentially be used to identify the magnitude and orientation of motions Relative orientation of BLBC domains is not constant in solution

26 Dynamics from RDC s Approaches are still being developed alignment tensor contains information about degree of ordering A generalized degree of order parameter (GDO) can be defined for the a protein or a subset of a protein Ratio of fragment GDO to overall GDO gives an order parameter υ υ, S NH or _, and S CαHα ---

27 Gaussian Average Fluctuation (GAF) of peptide planes in protein G (Bouvignes et al, PNAS (2005) 102, ) -millisecond timescale

28 Summary Dipolar couplings provide a non-short range structural restraint that can be used to improve the quality of globular protein domain structures Dramatically improve the knowledge of interdomain orientation in proteins and nuclei acids Allows new insights into protein dynamics and some knowledge of the types of motions involved Allows accurate docking of intermolecular complexes with minimal NOE input

Dipolar Couplings in Partially Aligned Macromolecules - New Directions in. Structure Determination using Solution State NMR.

Dipolar Couplings in Partially Aligned Macromolecules - New Directions in. Structure Determination using Solution State NMR. Dipolar Couplings in Partially Aligned Macromolecules - New Directions in Structure Determination using Solution State NMR. Recently developed methods for the partial alignment of macromolecules in dilute

More information

Orientational degeneracy in the presence of one alignment tensor.

Orientational degeneracy in the presence of one alignment tensor. Orientational degeneracy in the presence of one alignment tensor. Rotation about the x, y and z axes can be performed in the aligned mode of the program to examine the four degenerate orientations of two

More information

Interpreting and evaluating biological NMR in the literature. Worksheet 1

Interpreting and evaluating biological NMR in the literature. Worksheet 1 Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively

More information

NMR in Structural Biology

NMR in Structural Biology NMR in Structural Biology Exercise session 2 1. a. List 3 NMR observables that report on structure. b. Also indicate whether the information they give is short/medium or long-range, or perhaps all three?

More information

Experimental Techniques in Protein Structure Determination

Experimental Techniques in Protein Structure Determination Experimental Techniques in Protein Structure Determination Homayoun Valafar Department of Computer Science and Engineering, USC Two Main Experimental Methods X-Ray crystallography Nuclear Magnetic Resonance

More information

Introduction solution NMR

Introduction solution NMR 2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics

More information

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,100 116,000 120M Open access books available International authors and editors Downloads Our

More information

Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190

Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brunger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,

More information

I690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy

I690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy I690/B680 Structural Bioinformatics Spring 2006 Protein Structure Determination by NMR Spectroscopy Suggested Reading (1) Van Holde, Johnson, Ho. Principles of Physical Biochemistry, 2 nd Ed., Prentice

More information

Introduction to biomolecular NMR spectroscopy

Introduction to biomolecular NMR spectroscopy Oct 2002 Introduction to biomolecular NMR spectroscopy Michael Sattler, Structural & Computational Biology EMBL Heidelberg Contents Introduction...2 History... 3 Methodological developments for structure

More information

Practical Manual. General outline to use the structural information obtained from molecular alignment

Practical Manual. General outline to use the structural information obtained from molecular alignment Practical Manual General outline to use the structural information obtained from molecular alignment 1. In order to use the information one needs to know the direction and the size of the tensor (susceptibility,

More information

Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A

Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu " J.A. 12/11/13 Dec. 4 Dec. 9 Dec. 11" " Outline" " 1. Introduction / Spectroscopy Overview 2. NMR Spectroscopy

More information

Residual Dipolar Couplings BCMB/CHEM 8190

Residual Dipolar Couplings BCMB/CHEM 8190 Residual Dipolar Couplings BCMB/CHEM 8190 Recent Reviews Prestegard, A-Hashimi & Tolman, Quart. Reviews Biophys. 33, 371-424 (2000). Bax, Kontaxis & Tjandra, Methods in Enzymology, 339, 127-174 (2001)

More information

Solving the three-dimensional solution structures of larger

Solving the three-dimensional solution structures of larger Accurate and rapid docking of protein protein complexes on the basis of intermolecular nuclear Overhauser enhancement data and dipolar couplings by rigid body minimization G. Marius Clore* Laboratory of

More information

A.D.J. van Dijk "Modelling of biomolecular complexes by data-driven docking"

A.D.J. van Dijk Modelling of biomolecular complexes by data-driven docking Chapter 3. Various strategies of using Residual Dipolar Couplings in NMRdriven protein docking: application to Lys48-linked di-ubiquitin and validation against 15 N-relaxation data. Aalt D.J. van Dijk,

More information

Principles of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination

Principles of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination 1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination Protein Expression overexpression in E. coli - BL21(DE3) 1

More information

1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )

1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,

More information

Residual Dipolar Couplings: Measurements and Applications to Biomolecular Studies

Residual Dipolar Couplings: Measurements and Applications to Biomolecular Studies Residual Dipolar Couplings: Measurements and Applications to Biomolecular Studies Weidong Hu Lincong Wang Abstract Since the first successful demonstration of the tunable alignment of ubiquitin in an anisotropic

More information

NMR Assay of Purity and Folding

NMR Assay of Purity and Folding NMR Assay of Purity and Folding Don t Need Resonance Assignments or Labeling 1D requires only 10-50 µm protein concentration 2D Provides A More Detailed Assay 15 N- 1 H HSQC 1 H COSY 13 C HSQC also! Analyze

More information

Protein Structure Analysis and Verification. Course S Basics for Biosystems of the Cell exercise work. Maija Nevala, BIO, 67485U 16.1.

Protein Structure Analysis and Verification. Course S Basics for Biosystems of the Cell exercise work. Maija Nevala, BIO, 67485U 16.1. Protein Structure Analysis and Verification Course S-114.2500 Basics for Biosystems of the Cell exercise work Maija Nevala, BIO, 67485U 16.1.2008 1. Preface When faced with an unknown protein, scientists

More information

Timescales of Protein Dynamics

Timescales of Protein Dynamics Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen Transverse Relaxation Ensemble

More information

Chittaranjan Tripathy 1, Anthony K. Yan 1,2, Pei Zhou 2, and Bruce Randall Donald 1,2,

Chittaranjan Tripathy 1, Anthony K. Yan 1,2, Pei Zhou 2, and Bruce Randall Donald 1,2, Extracting Structural Information from Residual Chemical Shift Anisotropy: Analytic Solutions for Peptide Plane Orientations and Applications to Determine Protein Structure Chittaranjan Tripathy 1, Anthony

More information

Timescales of Protein Dynamics

Timescales of Protein Dynamics Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Summary of 1D Experiment time domain data Fourier Transform (FT) frequency domain data or Transverse Relaxation Ensemble of Nuclear

More information

6 NMR Interactions: Zeeman and CSA

6 NMR Interactions: Zeeman and CSA 6 NMR Interactions: Zeeman and CSA 6.1 Zeeman Interaction Up to this point, we have mentioned a number of NMR interactions - Zeeman, quadrupolar, dipolar - but we have not looked at the nature of these

More information

Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190

Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,

More information

Residual Dipolar Couplings Measured in Multiple Alignment Media.

Residual Dipolar Couplings Measured in Multiple Alignment Media. Residual Dipolar Couplings Measured in Multiple Alignment Media. We have already seen that the orientational degeneracy inherent to a single measured coupling can be raised by measuring different directions

More information

RESIDUAL DIPOLAR COUPLINGS BCMB/CHEM 8190

RESIDUAL DIPOLAR COUPLINGS BCMB/CHEM 8190 RESIDUAL DIPOLAR COUPLINGS BCMB/CHEM 8190 Long-Range Structural NMR Restraints Traditional NOE-based protein structure determination methods suffer from the lack of long-range structural restraints - in

More information

Solid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum,

Solid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum, Solid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum, 16.02.2009 Solid-state and solution NMR spectroscopy have many things in common Several concepts have been/will

More information

PROTEIN'STRUCTURE'DETERMINATION'

PROTEIN'STRUCTURE'DETERMINATION' PROTEIN'STRUCTURE'DETERMINATION' USING'NMR'RESTRAINTS' BCMB/CHEM'8190' Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,

More information

Origin of Scalar Couplings BCMB/CHEM 8190

Origin of Scalar Couplings BCMB/CHEM 8190 Origin of Scalar Couplings BCMB/CHEM 8190 Traditional View of Scalar Coupling Splitting of NMR signals due to through-bond interactions between nuclei is called scalar coupling (or J coupling or through-bond

More information

Principles of Physical Biochemistry

Principles of Physical Biochemistry Principles of Physical Biochemistry Kensal E. van Hold e W. Curtis Johnso n P. Shing Ho Preface x i PART 1 MACROMOLECULAR STRUCTURE AND DYNAMICS 1 1 Biological Macromolecules 2 1.1 General Principles

More information

NMR parameters intensity chemical shift coupling constants 1D 1 H spectra of nucleic acids and proteins

NMR parameters intensity chemical shift coupling constants 1D 1 H spectra of nucleic acids and proteins Lecture #2 M230 NMR parameters intensity chemical shift coupling constants Juli Feigon 1D 1 H spectra of nucleic acids and proteins NMR Parameters A. Intensity (area) 1D NMR spectrum: integrated intensity

More information

HSQC spectra for three proteins

HSQC spectra for three proteins HSQC spectra for three proteins SH3 domain from Abp1p Kinase domain from EphB2 apo Calmodulin What do the spectra tell you about the three proteins? HSQC spectra for three proteins Small protein Big protein

More information

T 1, T 2, NOE (reminder)

T 1, T 2, NOE (reminder) T 1, T 2, NOE (reminder) T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations of the system following perturbation

More information

Introduction to" Protein Structure

Introduction to Protein Structure Introduction to" Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Learning Objectives Outline the basic levels of protein structure.

More information

NMR, X-ray Diffraction, Protein Structure, and RasMol

NMR, X-ray Diffraction, Protein Structure, and RasMol NMR, X-ray Diffraction, Protein Structure, and RasMol Introduction So far we have been mostly concerned with the proteins themselves. The techniques (NMR or X-ray diffraction) used to determine a structure

More information

Protein NMR spectroscopy

Protein NMR spectroscopy Protein NMR spectroscopy Perttu Permi National Biological NMR Center, Institute of Biotechnology, University of elsinki Protein NMR spectroscopy course, 19th January 2009 1 spectrum of 20 kda Ca-binding

More information

PROTEIN NMR SPECTROSCOPY

PROTEIN NMR SPECTROSCOPY List of Figures List of Tables xvii xxvi 1. NMR SPECTROSCOPY 1 1.1 Introduction to NMR Spectroscopy 2 1.2 One Dimensional NMR Spectroscopy 3 1.2.1 Classical Description of NMR Spectroscopy 3 1.2.2 Nuclear

More information

Evaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example

Evaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example Biochemistry 2000, 39, 13365-13375 13365 Evaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example Xuemei Huang,

More information

Key words: alignment tensor, dipolar coupling, histogram, liquid crystal, molecular alignment, powder pattern, residual dipolar couplings, RNA

Key words: alignment tensor, dipolar coupling, histogram, liquid crystal, molecular alignment, powder pattern, residual dipolar couplings, RNA Journal of Biomolecular NMR 28: 273 287, 2004. KLUWER/ESCOM 2004 Kluwer Academic Publishers. Printed in the Netherlands. 273 Application of correlated residual dipolar couplings to the determination of

More information

Proteins are not rigid structures: Protein dynamics, conformational variability, and thermodynamic stability

Proteins are not rigid structures: Protein dynamics, conformational variability, and thermodynamic stability Proteins are not rigid structures: Protein dynamics, conformational variability, and thermodynamic stability Dr. Andrew Lee UNC School of Pharmacy (Div. Chemical Biology and Medicinal Chemistry) UNC Med

More information

Supplementary Materials belonging to

Supplementary Materials belonging to Supplementary Materials belonging to Solution conformation of the 70 kda E.coli Hsp70 complexed with ADP and substrate. Eric B. Bertelsen 1, Lyra Chang 2, Jason E. Gestwicki 2 and Erik R. P. Zuiderweg

More information

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small

More information

NMR in Medicine and Biology

NMR in Medicine and Biology NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR

More information

A new approach for applying residual dipolar couplings as restraints in structure elucidation

A new approach for applying residual dipolar couplings as restraints in structure elucidation Journal of Biomolecular NMR, 16: 245 252, 2000. KLUWER/ESCOM 2000 Kluwer Academic Publishers. Printed in the Netherlands. 245 A new approach for applying residual dipolar couplings as restraints in structure

More information

Determining Protein Structure BIBC 100

Determining Protein Structure BIBC 100 Determining Protein Structure BIBC 100 Determining Protein Structure X-Ray Diffraction Interactions of x-rays with electrons in molecules in a crystal NMR- Nuclear Magnetic Resonance Interactions of magnetic

More information

Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination

Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield

More information

Biochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington

Biochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:

More information

EXAM I COURSE TFY4310 MOLECULAR BIOPHYSICS December Suggested resolution

EXAM I COURSE TFY4310 MOLECULAR BIOPHYSICS December Suggested resolution page 1 of 7 EXAM I COURSE TFY4310 MOLECULAR BIOPHYSICS December 2013 Suggested resolution Exercise 1. [total: 25 p] a) [t: 5 p] Describe the bonding [1.5 p] and the molecular orbitals [1.5 p] of the ethylene

More information

1. 3-hour Open book exam. No discussion among yourselves.

1. 3-hour Open book exam. No discussion among yourselves. Lecture 13 Review 1. 3-hour Open book exam. No discussion among yourselves. 2. Simple calculations. 3. Terminologies. 4. Decriptive questions. 5. Analyze a pulse program using density matrix approach (omonuclear

More information

Macromolecular X-ray Crystallography

Macromolecular X-ray Crystallography Protein Structural Models for CHEM 641 Fall 07 Brian Bahnson Department of Chemistry & Biochemistry University of Delaware Macromolecular X-ray Crystallography Purified Protein X-ray Diffraction Data collection

More information

Resonance assignments in proteins. Christina Redfield

Resonance assignments in proteins. Christina Redfield Resonance assignments in proteins Christina Redfield 1. Introduction The assignment of resonances in the complex NMR spectrum of a protein is the first step in any study of protein structure, function

More information

NMR journey. Introduction to solution NMR. Alexandre Bonvin. Topics. Why use NMR...? Bijvoet Center for Biomolecular Research

NMR journey. Introduction to solution NMR. Alexandre Bonvin. Topics. Why use NMR...? Bijvoet Center for Biomolecular Research 2 NMR journey Introduction to solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, CCMB, Hyderabad, India November 29th

More information

e 2m e c I, (7.1) = g e β B I(I +1), (7.2) = erg/gauss. (7.3)

e 2m e c I, (7.1) = g e β B I(I +1), (7.2) = erg/gauss. (7.3) Chemistry 126 Molecular Spectra & Molecular Structure Week # 7 Electron Spin Resonance Spectroscopy, Supplement Like the hydrogen nucleus, an unpaired electron in a sample has a spin of I=1/2. The magnetic

More information

Solid state and advanced NMR

Solid state and advanced NMR Solid state and advanced NMR Dr. Magnus Wolf-Watz Department of Chemistry Umeå University magnus.wolf-watz@chem.umu.se NMR is useful for many things!!! Chemistry Structure of small molecules, chemical

More information

The Physical Basis of the NMR Experiment

The Physical Basis of the NMR Experiment The Physical Basis of the NMR Experiment 1 Interaction of Materials with Magnetic Fields F F S N S N Paramagnetism Diamagnetism 2 Microscopic View: Single Spins an electron has mass and charge in addition

More information

H B. θ = 90 o. Lecture notes Part 4: Spin-Spin Coupling. θ θ

H B. θ = 90 o. Lecture notes Part 4: Spin-Spin Coupling. θ θ Lecture notes Part 4: Spin-Spin Coupling F. olger Försterling October 4, 2011 So far, spins were regarded spins isolated from each other. owever, the magnetic moment of nuclear spins also have effect on

More information

Structure Determination of Membrane Proteins by NMR Spectroscopy

Structure Determination of Membrane Proteins by NMR Spectroscopy Chem. Rev. 2004, 104, 3587 3606 3587 Structure Determination of Membrane Proteins by NMR Spectroscopy Stanley J. Opella*, and Francesca M. Marassi Department of Chemistry and Biochemistry, University of

More information

BCMB / CHEM 8190 Biomolecular NMR GRADUATE COURSE OFFERING IN NUCLEAR MAGNETIC RESONANCE

BCMB / CHEM 8190 Biomolecular NMR GRADUATE COURSE OFFERING IN NUCLEAR MAGNETIC RESONANCE BCMB / CHEM 8190 Biomolecular NMR GRADUATE COURSE OFFERING IN NUCLEAR MAGNETIC RESONANCE "Biomolecular Nuclear Magnetic Resonance" is a course intended for all graduate students with an interest in applications

More information

Deuteration: Structural Studies of Larger Proteins

Deuteration: Structural Studies of Larger Proteins Deuteration: Structural Studies of Larger Proteins Problems with larger proteins Impact of deuteration on relaxation rates Approaches to structure determination Practical aspects of producing deuterated

More information

A Probability-Based Similarity Measure for Saupe Alignment Tensors with Applications to Residual Dipolar Couplings in NMR Structural Biology

A Probability-Based Similarity Measure for Saupe Alignment Tensors with Applications to Residual Dipolar Couplings in NMR Structural Biology A Probability-Based Similarity Measure for Saupe Alignment Tensors with Applications to Residual Dipolar Couplings in NMR Structural Biology Anthony K. Yan Christopher J. Langmead Bruce Randall Donald,,,,

More information

Bruce Randall Donald Professor Department of Computer Science Department of Chemistry Department of Biological Sciences

Bruce Randall Donald Professor Department of Computer Science Department of Chemistry Department of Biological Sciences This is an electronic reprint of: C. Langmead, A. Yan, R. Lilien, L. Wang, and B. R. Donald. A Polynomial-Time Nuclear Vector Replacement Algorithm for Automated NMR Resonance Assignments. Proceedings

More information

Magic-Angle Spinning (MAS) drive bearing

Magic-Angle Spinning (MAS) drive bearing Magic-Angle Spinning (MAS) magic-angle spinning is done pneumatically spinning frequency can be stabilized within a few Hz Magic-Angle Spinning (MAS) drive bearing Magic-Angle Spinning (MAS) Maximum spinning

More information

PAPER No. 12: ORGANIC SPECTROSCOPY. Module 19: NMR Spectroscopy of N, P and F-atoms

PAPER No. 12: ORGANIC SPECTROSCOPY. Module 19: NMR Spectroscopy of N, P and F-atoms Subject Chemistry Paper No and Title Module No and Title Module Tag Paper 12: Organic Spectroscopy CHE_P12_M19_e-Text TABLE OF CONTENTS 1. Learning Outcomes 2. 15 N NMR spectroscopy 3. 19 F NMR spectroscopy

More information

Contents. xiii. Preface v

Contents. xiii. Preface v Contents Preface Chapter 1 Biological Macromolecules 1.1 General PrincipIes 1.1.1 Macrornolecules 1.2 1.1.2 Configuration and Conformation Molecular lnteractions in Macromolecular Structures 1.2.1 Weak

More information

BMB/Bi/Ch 173 Winter 2018

BMB/Bi/Ch 173 Winter 2018 BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin

More information

Basics of protein structure

Basics of protein structure Today: 1. Projects a. Requirements: i. Critical review of one paper ii. At least one computational result b. Noon, Dec. 3 rd written report and oral presentation are due; submit via email to bphys101@fas.harvard.edu

More information

Molecular Modeling lecture 2

Molecular Modeling lecture 2 Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography

More information

Protein dynamics from NMR Relaxation data

Protein dynamics from NMR Relaxation data Protein dynamics from NMR Relaxation data Clubb 3/15/17 (S f2 ) ( e ) Nitrogen-15 relaxation ZZ-exchange R 1 = 1/T 1 Longitudinal relaxation (decay back to z-axis) R 2 = 1/T 2 Spin-spin relaxation (dephasing

More information

Design of a Novel Globular Protein Fold with Atomic-Level Accuracy

Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Brian Kuhlman, Gautam Dantas, Gregory C. Ireton, Gabriele Varani, Barry L. Stoddard, David Baker Presented by Kate Stafford 4 May 05 Protein

More information

Homology Modeling (Comparative Structure Modeling) GBCB 5874: Problem Solving in GBCB

Homology Modeling (Comparative Structure Modeling) GBCB 5874: Problem Solving in GBCB Homology Modeling (Comparative Structure Modeling) Aims of Structural Genomics High-throughput 3D structure determination and analysis To determine or predict the 3D structures of all the proteins encoded

More information

Chem8028(1314) - Spin Dynamics: Spin Interactions

Chem8028(1314) - Spin Dynamics: Spin Interactions Chem8028(1314) - Spin Dynamics: Spin Interactions Malcolm Levitt see also IK m106 1 Nuclear spin interactions (diamagnetic materials) 2 Chemical Shift 3 Direct dipole-dipole coupling 4 J-coupling 5 Nuclear

More information

Where do we stand on Projection NMR Spectroscopy? Thomas Szyperski Chianti Workshop 06/05/07

Where do we stand on Projection NMR Spectroscopy? Thomas Szyperski Chianti Workshop 06/05/07 Where do we stand on Projection NMR Spectroscopy? Definition: Projection Mapping an N dimensional vector space onto an N-K dimensional sub-space Associated Definitions Specify field over which vector space

More information

Theoretical Analysis of Residual Dipolar Coupling Patterns in Regular Secondary Structures of Proteins

Theoretical Analysis of Residual Dipolar Coupling Patterns in Regular Secondary Structures of Proteins Published on Web 09/8/003 Theoretical Analysis of Residual Dipolar Coupling Patterns in Regular Secondary Structures of Proteins Alessandro Mascioni and Gianluigi Veglia* Contribution from the Department

More information

Using NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017

Using NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017 Using NMR to study Macromolecular Interactions John Gross, BP204A UCSF Nov 27, 2017 Outline Review of basic NMR experiment Multidimensional NMR Monitoring ligand binding Structure Determination Review:

More information

Molecular Mechanics. I. Quantum mechanical treatment of molecular systems

Molecular Mechanics. I. Quantum mechanical treatment of molecular systems Molecular Mechanics I. Quantum mechanical treatment of molecular systems The first principle approach for describing the properties of molecules, including proteins, involves quantum mechanics. For example,

More information

Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10

Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Instructions: This is an open book, limited time, exam. You may use notes you have from class and any text book you find useful. You may also use

More information

NMR Spectroscopy. Guangjin Hou

NMR Spectroscopy. Guangjin Hou NMR Spectroscopy Guangjin Hou 22-04-2009 NMR History 1 H NMR spectra of water H NMR spectra of water (First NMR Spectra on Water, 1946) 1 H NMR spectra ethanol (First bservation of the Chemical Shift,

More information

A Combined Optical and EPR Spectroscopy Study: Azobenzene-Based Biradicals as Reversible Molecular Photoswitches

A Combined Optical and EPR Spectroscopy Study: Azobenzene-Based Biradicals as Reversible Molecular Photoswitches Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2017 A Combined Optical and EPR Spectroscopy Study: Azobenzene-Based Biradicals as Reversible

More information

Dipolar Couplings in Partially Aligned Macromolecules - New Directions in Structure Determination using Solution State NMR.

Dipolar Couplings in Partially Aligned Macromolecules - New Directions in Structure Determination using Solution State NMR. Dipolar Couplings in Partially Aligned Macromolecules - New Directions in Structure Determination using Solution State NMR. NMR spectroscopy is now established as the most effective method for the determination

More information

NMR of large protein systems: Solid state and dynamic nuclear polarization. Sascha Lange, Leibniz-Institut für Molekulare Pharmakologie (FMP)

NMR of large protein systems: Solid state and dynamic nuclear polarization. Sascha Lange, Leibniz-Institut für Molekulare Pharmakologie (FMP) NMR of large protein systems: Solid state and dynamic nuclear polarization Sascha Lange, Leibniz-Institut für Molekulare Pharmakologie (FMP) The Aim of the Game solution NMR other methods solid state NMR

More information

Spin Relaxation and NOEs BCMB/CHEM 8190

Spin Relaxation and NOEs BCMB/CHEM 8190 Spin Relaxation and NOEs BCMB/CHEM 8190 T 1, T 2 (reminder), NOE T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations

More information

Protein Structure. W. M. Grogan, Ph.D. OBJECTIVES

Protein Structure. W. M. Grogan, Ph.D. OBJECTIVES Protein Structure W. M. Grogan, Ph.D. OBJECTIVES 1. Describe the structure and characteristic properties of typical proteins. 2. List and describe the four levels of structure found in proteins. 3. Relate

More information

Structurele Biologie NMR

Structurele Biologie NMR MR journey Structurele Biologie MR 5 /3C 3 /65 MR & Structural biology course setup lectures - Sprangers R & Kay LE ature (27) basics of MR (Klaartje ouben: k.houben@uu.nl; 4/2) from peaks to data (ans

More information

Lecture #6 (The NOE)

Lecture #6 (The NOE) Lecture #6 (The OE) 2/18/15 Clubb Determining Protein tructures by MR: Measure thousands of shorter inter-hydrogen atom distances. Use these to restrain the structure of protein computationally. Distance

More information

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

More information

Solution Structure and Backbone Dynamics of the TGFβ Type II Receptor Extracellular Domain,

Solution Structure and Backbone Dynamics of the TGFβ Type II Receptor Extracellular Domain, 026 Biochemistry 2003, 42, 026-039 Solution Structure and Backbone Dynamics of the TGFβ Type II Receptor Extracellular Domain, Shashank Deep, Kerfoot P. Walker, III, Zhanyong Shu, and Andrew P. Hinck*,

More information

Filtered/edited NOESY spectra

Filtered/edited NOESY spectra Filtered/edited NOESY spectra NMR Seminar HS 207 Nina Ripin 22..7 Overview NMR of biomolecular complexes Problems and Solutions Filtered/edited nomenclature Experimental elements NOESY vs filtered pulse

More information

Raman Optical Activity Comes of Age

Raman Optical Activity Comes of Age Raman Optical Activity Comes of Age Laurence D. Barron Department of Chemistry, University of Glasgow, Glasgow G12 8QQ, UK E-mail: laurence.barron@glasgow.ac.uk Raman optical activity (ROA) provides vibrational

More information

Spin Interactions. Giuseppe Pileio 24/10/2006

Spin Interactions. Giuseppe Pileio 24/10/2006 Spin Interactions Giuseppe Pileio 24/10/2006 Magnetic moment µ = " I ˆ µ = " h I(I +1) " = g# h Spin interactions overview Zeeman Interaction Zeeman interaction Interaction with the static magnetic field

More information

NMR (CHEM8028) Solid-state NMR: Anisotropic interactions and how we use them. Dr Philip Williamson January 2015

NMR (CHEM8028) Solid-state NMR: Anisotropic interactions and how we use them. Dr Philip Williamson January 2015 NMR (CEM808) Solid-state NMR: Anisotropic interactions and how we use them Dr Philip Williamson January 015 NMR: From Molecular to Cellular Level Cell Solid State NMR Mitochondrion Membrane Liquid NMR

More information

To Do s. Read Chapter 3. Complete the end-of-chapter problems, 3-1, 3-3, 3-4, 3-6 and 3-7. Answer Keys are available in CHB204H

To Do s. Read Chapter 3. Complete the end-of-chapter problems, 3-1, 3-3, 3-4, 3-6 and 3-7. Answer Keys are available in CHB204H Read Chapter 3. To Do s Complete the end-of-chapter problems, 3-1, 3-3, 3-4, 3-6 and 3-7 Answer Keys are available in CB204 NMR Chemical Shifts Further Discussion A set of spectral data is reported when

More information

Magnetic Resonance Spectroscopy

Magnetic Resonance Spectroscopy INTRODUCTION TO Magnetic Resonance Spectroscopy ESR, NMR, NQR D. N. SATHYANARAYANA Formerly, Chairman Department of Inorganic and Physical Chemistry Indian Institute of Science, Bangalore % I.K. International

More information

Protein Structure Marianne Øksnes Dalheim, PhD candidate Biopolymers, TBT4135, Autumn 2013

Protein Structure Marianne Øksnes Dalheim, PhD candidate Biopolymers, TBT4135, Autumn 2013 Protein Structure Marianne Øksnes Dalheim, PhD candidate Biopolymers, TBT4135, Autumn 2013 The presentation is based on the presentation by Professor Alexander Dikiy, which is given in the course compedium:

More information

Biochemistry 530 NMR Theory and Practice

Biochemistry 530 NMR Theory and Practice Biochemistry 530 NMR Theory and Practice David Baker Autumn Quarter 2014 Slides Courtesy of Gabriele Varani Recommended NMR Textbooks Derome, A. E. (1987) Modern NMR Techniques for Chemistry Research,

More information

NMR Relaxation and Molecular Dynamics

NMR Relaxation and Molecular Dynamics Ecole RMN Cargese Mars 2008 NMR Relaxation and Molecular Dynamics Martin Blackledge IBS Grenoble Carine van Heijenoort ICSN, CNRS Gif-sur-Yvette Solution NMR Timescales for Biomolecular Motion ps ns µs

More information

Magnetic Nuclei other than 1 H

Magnetic Nuclei other than 1 H Magnetic Nuclei other than 1 H 2 H (Deuterium): I = 1 H,D-Exchange might be used to simplify 1 H-NMR spectra since H-D couplings are generally small; - - - -O- - - -D 2 -O- triplet of triplets slightly

More information

THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION

THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION AND CALIBRATION Calculation of turn and beta intrinsic propensities. A statistical analysis of a protein structure

More information

Biochemistry 530 NMR Theory and Practice

Biochemistry 530 NMR Theory and Practice Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:

More information