CH 3 CH 2 OH +H 2 O CHO. 2e + 2H + + O 2 H 2 O +HCOOH

Size: px
Start display at page:

Download "CH 3 CH 2 OH +H 2 O CHO. 2e + 2H + + O 2 H 2 O +HCOOH"

Transcription

1 2 4 H CH 3 2e + 2H H 2 2 H CH 2 H 2e + 2H H 2 2 H +H 2 CH 2e + 2H H 2 2 H +HCH Supplemental Figure S. The three-step 4DM reaction, each step requires two reducing equivalents from ADPH (transferred via the FAD and FM cofactors of cytochrome P450 reductase), two protons and one molecular oxygen. nly (H or CH 3 ) and 2 (H or =CH) vary in the 4DM substrates across the biological kingdoms. In the enzyme active center, the 4α-methyl group of the substrate is sequentially converted into the alcohol, then into the aldehyde derivative an then it is released as formic acid concomitantly with the introduction of the Δ 4-5 -double bound into the sterol core.

2 a i 47/280 =.8 b 448 nm 00 C/absolute, % Ligand free VI-bound Time (min) c 0. mm Supplemental Figure S2. Ligand-free (left/red) and VI-bound (right/blue) Tbb4DM. a. Absolute absorbance; b. C-difference spectra ( (Δt= min) Timecourse graph shows the rate and percentage of C-complexes formation in ligand-free and VI-bound state. c. Crystals.

3 G B B F K C B H G A A K I F F K L E J D J Supplemental Figure S3. A ribbon diagram showing the overall Tbb4DM structure. Distal view. -terminus (starting at G29) is colored in dark blue, and the C-terminus (ending at 476) is colored in red, full-length protein numbering. The 2 main helices are labeled from A to L; ten additional shorter helices between them are marked as ( ) and 2 β-strands arranged in 4 bundles are labeled by structure succession (5 strands in bundle, 2 in bundle 2, 3 in bundle 3, and 2 in bundle 4).The heme is shown in stick representation.

4

5 Supplemental Figure S4. Sequence alignment of 4DMs from Trypanosomatidae (75% average amino acid sequence identity), Candida albicans (24% identity to Tbb4DM), human (27% identity) and Mycobacterium tuberculosis (27% identity). Secondary structure elements of 4DM from Tbb and Mt are shown at the top and the bottom, respectively. The P450-fold nomenclature is provided for Tbb4DM; differences in the secondary structure elements are indicated in red.

6 Supplemental Figure S5. Superimposition of four molecules of ligand-free (white) and four molecules of VI-bound (red) Tbb4DM (distal view).

7 G F I G H C K B D L K J J Supplemental Figure S6. View of the superposed ligand-free and VI-bound Tbb4DM structures from the proximal (opposite to Fig.2b) side. Some shift toward the heme in the VI-bound structure can be seen for helices C, D, H, J and the C-terminal part of helix G. Elongated secondary structure elements (helices C, H and G in all four molecules) are marked in red near the places of their extensions. The tendency to form additional helix-like turns has been also observed for azole-bound drug-metabolizing CYP2B4 [SU and 2V0M] and for substrate-bound CYP46A [2q9f] and might indicate some additional molecule surface stabilization.

8 a Y6 Y A29 F24 L V46 T295 I45 F48 b VI C422 Heme Supplemental Figure S7. 2Fo-Fc electron density map for VI in the active site of Tbb4DM contoured at σ (a) and 2.5 σ (b). The bond distances (Å) are marked.

9 a Substrate conversion (%) C. albicans 4DM 5min 60min Human 4DM b VI/4DM (molar ratio) Absorbance Kd=0.37 µm Wavelength, nm Supplemental Figure S8. a. Inhibition of C. albicans and human 4DM activity by VI. Enzyme concentration 0.5 µm, substrate (lanosterol) concentration 50 µm, SD<0%. The other details of the reaction conditions are as described in (9). b. Binding of VI to human 4DM, difference absorbance spectra. The human 4DM concentration.7 µm; mm VI solution in DMS, titration range µm, titration step 0.5 µm

10 a b c 00 B Y H V46 I/E 2 3 H T295 A29 Tbb C.alb Human 4 H I Supplemental Figure S9. VI amide group fragment as the most likely cause for its selectivity towards 4DM from pathogenic microbes. a. Comparison of inhibitory effects of VI (black bars) and clinical antifungal drug ketoconazole (white bars) on 4DMs from two pathogens, Tbb and Candida albicans, and from human. I/E 2 represents the inhibitor/enzyme ratio that causes a two-fold decrease in the initial rate of reaction, log scale. b. Chemical structures of ketoconazole (), VI (2) and two VI-scaffold derivatives: the β-phenyl azole SDZ (3) with the inhibitory potency and antiparasitic effect in Trypanosomatidae comparable to VI and the α-phenyl azole SDZ (4), a competitive, short-term inhibitor that binds with the same apparent Kd (<00 nm) but can be easily replaced in the enzyme active site by substrate (). c. VI-induced hydrogen bonding network between helices B and I. V46 and its mutation to isoleucine (grey), corresponding to I488 in human 4DM, are shown. Heme is presented as spheres.

11 Supplemental Table S. Data collection and refinement statistics Ligand-free Inhibitor-bound Data collection ative Iron SAD (peak) ative Wavelength, Å Space group P P P Cell dimensions a, b, c, Å 59.8,79.9, , 79.9, , 79., 6.0 α, β, γ, 74.2, 8.6, , 8., , 79., 68.6 umber of molecules per asymmetric unit esolution, Å ( )* ( ) (.9-.87) merge (0.470) (0.536) (0.603) I/σ(I) 8.5 (3.) 44.5 (3.4) 28 (.8) Completeness (%) 97.8 (96.7) 96.8 (95.2) (9.7) edundancy 4.0 (3.8) 7.8 (7.7) 3.9 (3.5) efinement esolution, Å umber of reflections 42,726 44,527 work/ / free 0.95/ /0.238 Average B-factors protein heme/inhibitor 22 23/32 water ms deviations Bond lengths, Å Bond angles, Cα positions between 4 molecules, Å *Values in parenthesis are for highest-resolution shell.

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3

More information

Supporting Information

Supporting Information Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase

More information

2015 AP Biology Unit 2 PRETEST- Introduction to the Cell and Biochemistry

2015 AP Biology Unit 2 PRETEST- Introduction to the Cell and Biochemistry Name: Class: _ Date: _ 2015 AP Biology Unit 2 PRETEST- Introduction to the Cell and Biochemistry Multiple Choice Identify the choice that best completes the statement or answers the question. 1) In what

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Table 1: Amplitudes of three current levels. Level 0 (pa) Level 1 (pa) Level 2 (pa) TrkA- TrkH WT 200 K 0.01 ± 0.01 9.5 ± 0.01 18.7 ± 0.03 200 Na * 0.001 ± 0.01 3.9 ± 0.01 12.5 ± 0.03 200

More information

Supplementary Figure 1. Biochemical and sequence alignment analyses the

Supplementary Figure 1. Biochemical and sequence alignment analyses the Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Dph2 SeMet (iron-free) # Dph2 (iron-free) Dph2-[4Fe-4S] Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 58.26, 82.08, 160.42 58.74, 81.87, 160.01 55.70, 80.53,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group

More information

Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets

Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas

More information

Biochemistry 3100 Sample Problems Binding proteins, Kinetics & Catalysis

Biochemistry 3100 Sample Problems Binding proteins, Kinetics & Catalysis (1) Draw an approximate denaturation curve for a typical blood protein (eg myoglobin) as a function of ph. (2) Myoglobin is a simple, single subunit binding protein that has an oxygen storage function

More information

SI Text S1 Solution Scattering Data Collection and Analysis. SI references

SI Text S1 Solution Scattering Data Collection and Analysis. SI references SI Text S1 Solution Scattering Data Collection and Analysis. The X-ray photon energy was set to 8 kev. The PILATUS hybrid pixel array detector (RIGAKU) was positioned at a distance of 606 mm from the sample.

More information

Supplemental Information for: Characterizing the Membrane-Bound State of Cytochrome P450 3A4: Structure, Depth of Insertion and Orientation

Supplemental Information for: Characterizing the Membrane-Bound State of Cytochrome P450 3A4: Structure, Depth of Insertion and Orientation Supplemental Information for: Characterizing the Membrane-Bound State of Cytochrome P450 3A4: Structure, Depth of Insertion and Orientation Javier L. Baylon, Ivan L. Lenov, Stephen G. Sligar and Emad Tajkhorshid

More information

Biomolecules: lecture 10

Biomolecules: lecture 10 Biomolecules: lecture 10 - understanding in detail how protein 3D structures form - realize that protein molecules are not static wire models but instead dynamic, where in principle every atom moves (yet

More information

Supplementary Figures

Supplementary Figures 1 Supplementary Figures Supplementary Figure 1 Type I FGFR1 inhibitors (a) Chemical structures of a pyrazolylaminopyrimidine inhibitor (henceforth referred to as PAPI; PDB-code of the FGFR1-PAPI complex:

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Table 1: Data collection, phasing and refinement statistics ChbC/Ta 6 Br 12 Native ChbC Data collection Space group P4 3 2 1 2 P4 3 2 1 2 Cell dimensions a, c (Å) 132.75, 453.57 132.81, 452.95

More information

Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate

Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Fig. 1 Influences of crystal lattice contacts on Pol η structures. a. The dominant lattice contact between two hpol η molecules (silver and gold) in the type 1 crystals. b. A close-up view of the hydrophobic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Table S1 Kinetic Analyses of the AMSH-LP mutants AMSH-LP K M (μm) k cat x 10-3 (s -1 ) WT 71.8 ± 6.3 860 ± 65.4 T353A 76.8 ± 11.7 46.3 ± 3.7 F355A 58.9 ± 10.4 5.33 ± 0.30 proximal S358A 75.1

More information

1. What is an ångstrom unit, and why is it used to describe molecular structures?

1. What is an ångstrom unit, and why is it used to describe molecular structures? 1. What is an ångstrom unit, and why is it used to describe molecular structures? The ångstrom unit is a unit of distance suitable for measuring atomic scale objects. 1 ångstrom (Å) = 1 10-10 m. The diameter

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11744 Supplementary Table 1. Crystallographic data collection and refinement statistics. Wild-type Se-Met-BcsA-B SmCl 3 -soaked EMTS-soaked Data collection Space

More information

Chemistry 1506: Allied Health Chemistry 2. Section 10: Enzymes. Biochemical Catalysts. Outline

Chemistry 1506: Allied Health Chemistry 2. Section 10: Enzymes. Biochemical Catalysts. Outline Chemistry 1506 Dr. Hunter s Class Section 10 Notes - Page 1/14 Chemistry 1506: Allied Health Chemistry 2 Section 10: Enzymes Biochemical Catalysts. Outline SECTION 10.1 INTRODUCTION...2 SECTION SECTION

More information

Protein Structure. W. M. Grogan, Ph.D. OBJECTIVES

Protein Structure. W. M. Grogan, Ph.D. OBJECTIVES Protein Structure W. M. Grogan, Ph.D. OBJECTIVES 1. Describe the structure and characteristic properties of typical proteins. 2. List and describe the four levels of structure found in proteins. 3. Relate

More information

Supplemental Information. Molecular Basis of Spectral Diversity. in Near-Infrared Phytochrome-Based. Fluorescent Proteins

Supplemental Information. Molecular Basis of Spectral Diversity. in Near-Infrared Phytochrome-Based. Fluorescent Proteins Chemistry & Biology, Volume 22 Supplemental Information Molecular Basis of Spectral Diversity in Near-Infrared Phytochrome-Based Fluorescent Proteins Daria M. Shcherbakova, Mikhail Baloban, Sergei Pletnev,

More information

The structure of a nucleolytic ribozyme that employs a catalytic metal ion. Yijin Liu, Timothy J. Wilson and David M.J. Lilley

The structure of a nucleolytic ribozyme that employs a catalytic metal ion. Yijin Liu, Timothy J. Wilson and David M.J. Lilley SUPPLEMENTARY INFORMATION The structure of a nucleolytic ribozyme that employs a catalytic metal ion Yijin Liu, Timothy J. Wilson and David M.J. Lilley Cancer Research UK Nucleic Acid Structure Research

More information

Supplementary Information for

Supplementary Information for Supplementary Information for Structural basis for the inhibition of Mycobacterium tuberculosis L,D-transpeptidase by meropenem, a drug effective against extensively drug-resistant strains Hyoun Sook Kim

More information

The structure of vanadium nitrogenase reveals an unusual bridging ligand

The structure of vanadium nitrogenase reveals an unusual bridging ligand SUPPLEMENTARY INFORMATION The structure of vanadium nitrogenase reveals an unusual bridging ligand Daniel Sippel and Oliver Einsle Lehrstuhl Biochemie, Institut für Biochemie, Albert-Ludwigs-Universität

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2016 Supporting Information Lipid molecules can induce an opening of membrane-facing

More information

Enzymes are macromolecules (proteins) that act as a catalyst

Enzymes are macromolecules (proteins) that act as a catalyst Chapter 8.4 Enzymes Enzymes speed up metabolic reactions by lowering energy barriers Even though a reaction is spontaneous (exergonic) it may be incredibly slow Enzymes cause hydrolysis to occur at a faster

More information

Diphthamide biosynthesis requires a radical iron-sulfur enzyme. Pennsylvania State University, University Park, Pennsylvania 16802, USA

Diphthamide biosynthesis requires a radical iron-sulfur enzyme. Pennsylvania State University, University Park, Pennsylvania 16802, USA Diphthamide biosynthesis requires a radical iron-sulfur enzyme Yang Zhang, 1,4 Xuling Zhu, 1,4 Andrew T. Torelli, 1 Michael Lee, 2 Boris Dzikovski, 1 Rachel Koralewski, 1 Eileen Wang, 1 Jack Freed, 1 Carsten

More information

2054, Chap. 8, page 1

2054, Chap. 8, page 1 2054, Chap. 8, page 1 I. Metabolism: Energetics, Enzymes, and Regulation (Chapter 8) A. Energetics and work 1. overview a. energy = ability to do work (1) chemical, transport, mechanical (2) ultimate source

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier

More information

Chapter 8: An Introduction to Metabolism

Chapter 8: An Introduction to Metabolism AP Biology Reading Guide Name Chapter 8: An Introduction to Metabolism Concept 8.1 An organism s metabolism transforms matter and energy, subject to the laws of thermodynamics 1. Define metabolism. 2.

More information

Biological Chemistry and Metabolic Pathways

Biological Chemistry and Metabolic Pathways Biological Chemistry and Metabolic Pathways 1. Reaction a. Thermodynamics b. Kinetics 2. Enzyme a. Structure and Function b. Regulation of Activity c. Kinetics d. Inhibition 3. Metabolic Pathways a. REDOX

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10955 Supplementary Figures Supplementary Figure 1. Electron-density maps and crystallographic dimer structures of the motor domain. (a f) Stereo views of the final electron-density maps

More information

Scattering Lecture. February 24, 2014

Scattering Lecture. February 24, 2014 Scattering Lecture February 24, 2014 Structure Determination by Scattering Waves of radiation scattered by different objects interfere to give rise to an observable pattern! The wavelength needs to close

More information

Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein

Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08

More information

SUPPLEMENTARY INFORMATION. Pistol Ribozyme Adopts a Pseudoknot Fold. Facilitating Site-specific In-line Cleavage

SUPPLEMENTARY INFORMATION. Pistol Ribozyme Adopts a Pseudoknot Fold. Facilitating Site-specific In-line Cleavage UPPLEMENTAY INFMATIN Pistol ibozyme Adopts a Pseudoknot Fold Facilitating ite-specific In-line Cleavage Aiming en 1,2,4, Nikola Vušurović 3,4, Jennifer Gebetsberger 3, Pu Gao 2, Michael Juen 3, Christoph

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.

More information

Detailed description of overall and active site architecture of PPDC- 3dThDP, PPDC-2HE3dThDP, PPDC-3dThDP-PPA and PPDC- 3dThDP-POVA

Detailed description of overall and active site architecture of PPDC- 3dThDP, PPDC-2HE3dThDP, PPDC-3dThDP-PPA and PPDC- 3dThDP-POVA Online Supplemental Results Detailed description of overall and active site architecture of PPDC- 3dThDP, PPDC-2HE3dThDP, PPDC-3dThDP-PPA and PPDC- 3dThDP-POVA Structure solution and overall architecture

More information

Fluorine in Peptide and Protein Engineering

Fluorine in Peptide and Protein Engineering Fluorine in Peptide and Protein Engineering Rita Fernandes Porto, February 11 th 2016 Supervisor: Prof. Dr. Beate Koksch 1 Fluorine a unique element for molecule design The most abundant halogen in earth

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.

More information

SUPPLEMENTARY INFORMATION. doi: /nature07461

SUPPLEMENTARY INFORMATION. doi: /nature07461 Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of

More information

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION www.nature.com/nature 1 Figure S1 Sequence alignment. a Structure based alignment of the plgic of E. chrysanthemi (ELIC), the acetylcholine binding protein from the snail Lymnea stagnalis (AchBP, PDB code

More information

1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )

1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,

More information

Pymol Practial Guide

Pymol Practial Guide Pymol Practial Guide Pymol is a powerful visualizor very convenient to work with protein molecules. Its interface may seem complex at first, but you will see that with a little practice is simple and powerful

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Data collection Supplementary Table 1 Statistics of data collection, phasing and refinement Native Se-MAD Space group P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 50.4, 94.2, 115.4 49.8, 94.2,

More information

Bacterial protease uses distinct thermodynamic signatures for substrate recognition

Bacterial protease uses distinct thermodynamic signatures for substrate recognition Bacterial protease uses distinct thermodynamic signatures for substrate recognition Gustavo Arruda Bezerra, Yuko Ohara-Nemoto, Irina Cornaciu, Sofiya Fedosyuk, Guillaume Hoffmann, Adam Round, José A. Márquez,

More information

Chapter 25 Organic and Biological Chemistry

Chapter 25 Organic and Biological Chemistry Chapter 25 Organic and Biological Chemistry Organic Chemistry The chemistry of carbon compounds. Carbon has the ability to form long chains. Without this property, large biomolecules such as proteins,

More information

NB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5

NB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5 SUPPLEMENTARY TABLES Suppl. Table 1. Protonation states at ph 7.4 and 4.5. Protonation states of titratable residues in GCase at ph 7.4 and 4.5. Histidine: HID, H at δ-nitrogen; HIE, H at ε-nitrogen; HIP,

More information

Chapter 8: An Introduction to Metabolism

Chapter 8: An Introduction to Metabolism Chapter 8: An Introduction to Metabolism Key Concepts 8.1 An organism s metabolism transforms matter and energy, subject to the laws of thermodynamics 8.2 The free-energy change of a reaction tells us

More information

The structure of a nucleolytic ribozyme that employs a catalytic metal ion Liu, Yijin; Wilson, Timothy; Lilley, David

The structure of a nucleolytic ribozyme that employs a catalytic metal ion Liu, Yijin; Wilson, Timothy; Lilley, David University of Dundee The structure of a nucleolytic ribozyme that employs a catalytic metal ion Liu, Yijin; Wilson, Timothy; Lilley, David Published in: Nature Chemical Biology DOI: 10.1038/nchembio.2333

More information

Supplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization

Supplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization Supplementary Information Structural basis for precursor protein-directed ribosomal peptide macrocyclization Kunhua Li 1,3, Heather L. Condurso 1,3, Gengnan Li 1, Yousong Ding 2 and Steven D. Bruner 1*

More information

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

More information

Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2

Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2 Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell

More information

Membrane Proteins: 1. Integral proteins: 2. Peripheral proteins: 3. Amphitropic proteins:

Membrane Proteins: 1. Integral proteins: 2. Peripheral proteins: 3. Amphitropic proteins: Membrane Proteins: 1. Integral proteins: proteins that insert into/span the membrane bilayer; or covalently linked to membrane lipids. (Interact with the hydrophobic part of the membrane) 2. Peripheral

More information

Dr. Yonca Yuzugullu PERG (Protein Engineering Research Group)

Dr. Yonca Yuzugullu PERG (Protein Engineering Research Group) Dr. Yonca Yuzugullu PERG (Protein Engineering Research Group) BSc, 1997 Ankara University, Turkey PhD, 2010 Middle East Technical University, Turkey Lecturer in Department of Biology Kocaeli University,

More information

Structural characterization of NiV N 0 P in solution and in crystal.

Structural characterization of NiV N 0 P in solution and in crystal. Supplementary Figure 1 Structural characterization of NiV N 0 P in solution and in crystal. (a) SAXS analysis of the N 32-383 0 -P 50 complex. The Guinier plot for complex concentrations of 0.55, 1.1,

More information

Examples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE

Examples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE Examples of Protein Modeling Protein Modeling Visualization Examination of an experimental structure to gain insight about a research question Dynamics To examine the dynamics of protein structures To

More information

Viewing and Analyzing Proteins, Ligands and their Complexes 2

Viewing and Analyzing Proteins, Ligands and their Complexes 2 2 Viewing and Analyzing Proteins, Ligands and their Complexes 2 Overview Viewing the accessible surface Analyzing the properties of proteins containing thousands of atoms is best accomplished by representing

More information

RNA Polymerase I Contains a TFIIF-Related DNA-Binding Subcomplex

RNA Polymerase I Contains a TFIIF-Related DNA-Binding Subcomplex Molecular Cell, Volume 39 Supplemental Information RNA Polymerase I Contains a TFIIFRelated DNABinding Subcomplex Sebastian R. Geiger, Kristina Lorenzen, Amelie Schreieck, Patrizia Hanecker, Dirk Kostrewa,

More information

Chemistry in Biology. Section 1. Atoms, Elements, and Compounds

Chemistry in Biology. Section 1. Atoms, Elements, and Compounds Section 1 Atoms, Elements, and Compounds Atoms! Chemistry is the study of matter.! Atoms are the building blocks of matter.! Neutrons and protons are located at the center of the atom.! Protons are positively

More information

You are advised to spend an equal amount of time on each question.

You are advised to spend an equal amount of time on each question. UNIVERSITY OF EAST ANGLIA School of Chemistry Main Series UG Examination 2015-16 BIOPHYSICAL CHEMISTRY CHE-5601Y Time allowed: 2 hours Answer THREE questions. You are advised to spend an equal amount of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10458 Active Site Remodeling in the Bifunctional Fructose-1,6- bisphosphate aldolase/phosphatase Juan Du, Rafael F. Say, Wei Lü, Georg Fuchs & Oliver Einsle SUPPLEMENTARY FIGURES Figure

More information

THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN

THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina

More information

CHEM 3653 Exam # 1 (03/07/13)

CHEM 3653 Exam # 1 (03/07/13) 1. Using phylogeny all living organisms can be divided into the following domains: A. Bacteria, Eukarya, and Vertebrate B. Archaea and Eukarya C. Bacteria, Eukarya, and Archaea D. Eukarya and Bacteria

More information

Supplementary information for:

Supplementary information for: SUPPLEMETARY IFRMATI Supplementary information for: Structure of a β 1 -adrenergic G protein-coupled receptor Tony Warne, Maria J. Serrano-Vega, Jillian G. Baker#, Rouslan Moukhametzianov, Patricia C.

More information

Supporting Information

Supporting Information Supporting Information Decoding Allosteric Networks in Biocatalysts: Rational Approach to Therapies and Biotechnologies Johannes T. Cramer 1,2, Jana I. Führing 1, Petra Baruch 2, Christian Brütting 3,

More information

Affinity labels for studying enzyme active sites. Irreversible Enzyme Inhibition. Inhibition of serine protease with DFP

Affinity labels for studying enzyme active sites. Irreversible Enzyme Inhibition. Inhibition of serine protease with DFP Irreversible Enzyme Inhibition Irreversible inhibitors form stable covalent bonds with the enzyme (e.g. alkylation or acylation of an active site side chain) There are many naturally-occurring and synthetic

More information

Multiple choice: 10 questions, worth 2 points each. Circle all of the correct answers. Some questions many have more than one correct answer.

Multiple choice: 10 questions, worth 2 points each. Circle all of the correct answers. Some questions many have more than one correct answer. Biochemistry I Fall 2014 Exam 1 Dr. Stone Name Page 1 of 6 Some constants and equations that may be useful: K w = [H+][OH-]= 1 x 10 14 K a for H 2 CO 3 = 2.7 x 10-4 K eq for the formation of carbonic acid

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/5/243/ra68/dc1 Supplementary Materials for Superbinder SH2 Domains Act as Antagonists of Cell Signaling Tomonori Kaneko, Haiming Huang, Xuan Cao, Xing Li, Chengjun

More information

Chapter 8: An Introduction to Metabolism

Chapter 8: An Introduction to Metabolism Chapter 8: An Introduction to Metabolism Name Period Concept 8.1 An organism s metabolism transforms matter and energy, subject to the laws of thermodynamics 1. Define metabolism. 2. There are two types

More information

BIOCHEMISTRY/MOLECULAR BIOLOGY

BIOCHEMISTRY/MOLECULAR BIOLOGY Enzymes Activation Energy Chemical reactions require an initial input of energy activation energy large biomolecules are stable must absorb energy to break bonds cellulose energy CO 2 + H 2 O + heat Activation

More information

Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).

Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature1737 Supplementary Table 1 variant Description FSEC - 2B12 a FSEC - 6A1 a K d (leucine) c Leucine uptake e K (wild-type like) K (Y18F) K (TS) K (TSY) K288A mutant, lipid facing side chain

More information

Interpreting and evaluating biological NMR in the literature. Worksheet 1

Interpreting and evaluating biological NMR in the literature. Worksheet 1 Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively

More information

Supplementary Material

Supplementary Material upplementary Material Molecular docking and ligand specificity in fragmentbased inhibitor discovery Chen & hoichet 26 27 (a) 2 1 2 3 4 5 6 7 8 9 10 11 12 15 16 13 14 17 18 19 (b) (c) igure 1 Inhibitors

More information

CHAPTER 29 HW: AMINO ACIDS + PROTEINS

CHAPTER 29 HW: AMINO ACIDS + PROTEINS CAPTER 29 W: AMI ACIDS + PRTEIS For all problems, consult the table of 20 Amino Acids provided in lecture if an amino acid structure is needed; these will be given on exams. Use natural amino acids (L)

More information

Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a

Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a series of tmfret-pairs comprised of single cysteine mutants

More information

Ch. 3 Metabolism and Enzymes

Ch. 3 Metabolism and Enzymes Ch. 3 Metabolism and Enzymes Originally prepared by Kim B. Foglia. Revised and adapted by Nhan A. Pham Flow of energy through life Life is built on chemical reactions that enable energy to flow through

More information

Structural basis of PROTAC cooperative recognition for selective protein degradation

Structural basis of PROTAC cooperative recognition for selective protein degradation SUPPLEMENTARY INFORMATION Structural basis of PROTAC cooperative recognition for selective protein degradation Morgan S. Gadd 1, Andrea Testa 1, Xavier Lucas 1, Kwok-Ho Chan, Wenzhang Chen, Douglas J.

More information

Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27

Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27 Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Parallel Allostery by camp and PDE Coordinates Activation and Termination Phases in camp Signaling Srinath Krishnamurthy, 1 Nikhil Kumar Tulsian, 1 Arun Chandramohan, 1 and Ganesh S. Anand 1, * 1 Department

More information

Objective: Students will be able identify peptide bonds in proteins and describe the overall reaction between amino acids that create peptide bonds.

Objective: Students will be able identify peptide bonds in proteins and describe the overall reaction between amino acids that create peptide bonds. Scott Seiple AP Biology Lesson Plan Lesson: Primary and Secondary Structure of Proteins Purpose:. To understand how amino acids can react to form peptides through peptide bonds.. Students will be able

More information

Final Chem 4511/6501 Spring 2011 May 5, 2011 b Name

Final Chem 4511/6501 Spring 2011 May 5, 2011 b Name Key 1) [10 points] In RNA, G commonly forms a wobble pair with U. a) Draw a G-U wobble base pair, include riboses and 5 phosphates. b) Label the major groove and the minor groove. c) Label the atoms of

More information

The Basics of General, Organic, and Biological Chemistry

The Basics of General, Organic, and Biological Chemistry The Basics of General, Organic, and Biological Chemistry By Ball, Hill and Scott Download PDF at https://open.umn.edu/opentextbooks/bookdetail.aspx?bookid=40 Page 5 Chapter 1 Chemistry, Matter, and Measurement

More information

Principles of Physical Biochemistry

Principles of Physical Biochemistry Principles of Physical Biochemistry Kensal E. van Hold e W. Curtis Johnso n P. Shing Ho Preface x i PART 1 MACROMOLECULAR STRUCTURE AND DYNAMICS 1 1 Biological Macromolecules 2 1.1 General Principles

More information

Overview. The peptide bond. Page 1

Overview. The peptide bond. Page 1 Overview Secondary structure: the conformation of the peptide backbone The peptide bond, steric implications Steric hindrance and sterically allowed conformations. Ramachandran diagrams Side chain conformations

More information

Infrared Spectroscopy: How to use the 5 zone approach to identify functional groups

Infrared Spectroscopy: How to use the 5 zone approach to identify functional groups Infrared Spectroscopy: How to use the 5 zone approach to identify functional groups Definition: Infrared Spectroscopy is the study of the Infrared Spectrum. An Infrared Spectrum is the plot of photon energy

More information

Three-dimensional structure of a viral genome-delivery portal vertex

Three-dimensional structure of a viral genome-delivery portal vertex Three-dimensional structure of a viral genome-delivery portal vertex Adam S. Olia 1, Peter E. Prevelige Jr. 2, John E. Johnson 3 and Gino Cingolani 4 1 Department of Biological Sciences, Purdue University,

More information

BSc and MSc Degree Examinations

BSc and MSc Degree Examinations Examination Candidate Number: Desk Number: BSc and MSc Degree Examinations 2018-9 Department : BIOLOGY Title of Exam: Molecular Biology and Biochemistry Part I Time Allowed: 1 hour and 30 minutes Marking

More information

A primer on pharmacology pharmacodynamics

A primer on pharmacology pharmacodynamics A primer on pharmacology pharmacodynamics Drug binding & effect Universidade do Algarve Faro 2017 by Ferdi Engels, Ph.D. 1 Pharmacodynamics Relation with pharmacokinetics? dosage plasma concentration site

More information

The living world has a hierarchy of organizational levels - from molecules to ecosystems

The living world has a hierarchy of organizational levels - from molecules to ecosystems The living world has a hierarchy of organizational levels - from molecules to ecosystems In order to understand the whole, biologists study the parts (reductionism) With each level, new properties EMERGE

More information

Structural insights into Aspergillus fumigatus lectin specificity - AFL binding sites are functionally non-equivalent

Structural insights into Aspergillus fumigatus lectin specificity - AFL binding sites are functionally non-equivalent Acta Cryst. (2015). D71, doi:10.1107/s1399004714026595 Supporting information Volume 71 (2015) Supporting information for article: Structural insights into Aspergillus fumigatus lectin specificity - AFL

More information