Supplemental Methods. Protein expression and purification
|
|
- Tiffany Jackson
- 5 years ago
- Views:
Transcription
1 Supplemental Methods Protein expression and purification The isolated collagen-binding domain of hlair-1, amino acid , was cloned into pet3xa using introduced BamHI and NotI sites at the 5 and 3 end respectively. Protein was expressed in Escherichia coli Origami (DE3) using LB medium supplemented with 0.5% (v/v) glycerol, 0.05% (w/v) D- glucose, 0.02% (w/v) lactose, 5 mm MgSO 4 and 50 mm K-phosphate buffer ph 6.9 at 20 C. The expressed hlair collagen-binding domain has an N-terminal hexa-histidine tag followed by a TEVprotease cleavage site (ENLYPQGS) and contains three additional alanine residues at the C-terminus. After proteolysis of the tag a glycine and serine residue remain at the N-terminus of the protein. hlair1-cbd was purified by affinity chromatography using Nickel-Sepharose (GE Healthcare, Belgium), followed by anion exchange chromatography on a 1 ml MonoQ column with 25 mm Tris-Cl, ph 8.2 as buffer and a mm NaCl gradient to elute the protein. After anion exchange the protein was cleaved using hexa-histidine tagged TEV-protease followed by removal of the protease by washing through a Nickel-Sepharose column. Finally, the hlair1-cbd protein was purified through a Superdex75 size-exclusion column with 25 mm Tris-Cl ph 8.2 as the running buffer. The purified protein was concentrated to mg/ml. 15 N-labeled hlair1-cbd was produced by over-expression in Escherichia coli via auto-induction at 20 C in M9-medium containing 1g/L 15 N-ammoniumchloride supplemented with 0.5% (v/v) glycerol, 0.05% (w/v) D-glucose, 0.02% (w/v) lactose, 5 mm MgSO 4 and 50 mm potassium phosphate buffer ph 6.9 enriched with 10% (v/v) Silantes E. coli OD2 15 N-labelled medium (Buchem BV, Netherlands). Purifcation of 15 N-labeled hlair1-cbd was done as for the unlabelled protein except that the buffer was exchanged for 10 mm potassium phosphate, ph 7.1 during the size exclusion step. Docking of hlair1-cbd and peptide III-30 using Haddock2.0 3D models of the hlair1-cbd/collagen III-30 complex were generated using the Haddock webserver ( Starting models for the docking were molecule A of the hlair1-cbd crystals structure and theoretical model of peptide III-30. The central 27 amino acids (collagen III-sequence) of the peptide III-30 model were constructed from the main chain of a collagen III peptide bound to SPARC (PDB code 2V53) to which side chains were added using CNS. 1 This model was flanked on either side with 3 GPP-triplets taken from the crystal structure of (GPP) 10 (PDB code 1K6F). Docking was performed using an ensemble of 20 collagen models that had their side chain conformations randomized by simulated annealing in CNS. Haddock uses a knowledge based approach in which the available experimental data is used in conjunction with structural information to drive the docking. In this procedure all residues that are thought to be involved in the interaction are designated active residues and surface accessible residues that flank interacting/active residues and therefore might be involved in the interaction are designated passive residues. This information is used in the form of distance restraints between all atoms of active residues on one protein and all active and passive residues on the interacting molecule. We defined active residues as all surface accessible residues in LAIR-1 that were indentified as part of the collagen binding surface in the NMR titration experiments plus those residues that were shown to affect collagen binding in the mutagenesis experiments, i.e. R59, E61, R62, E63, R65, T67, Y68, N69, R85 R100, W109, E111, Q112 and Y115. As no experimental data on interacting residues from collagen is available, all surface accessible residues of the collagen model (all residues at the X and X positions of the G-X-X collagen repeat), except for those of the 9 N-terminal or C-terminal residues were designated passive residues. These terminal residues were excluded to prevent the docking being driven towards the termini of the triple-helical peptide that are highly charged. To preserve the collagen tertiary structure we imposed additional restraints on
2 distances between the terminal regions of the three collagen chains. A HADDOCK run consisted of 3 docking steps; in the first step 5000 complexes were generated by randomization of orientations and rigid-body energy minimization. In the 2 nd step, the 500 best solutions were further refined using semiflexible simulated annealing and finally the top 200 solutions were refined in explicit solvent. Solutions were clustered using a ligand interface rmsd cut off of 7.5 Å and the clusters were sorted based on their HADDOCK score. REFERENCES (1) Brunger AT. Version 1.2 of the Crystallography and NMR system. Nat Protoc. 2007;2: (2) Shiroishi M, Kuroki K, Rasubala L et al. Structural basis for recognition of the nonclassical MHC molecule HLA-G by the leukocyte Ig-like receptor B2 (LILRB2/LIR2/ILT4/CD85d). Proc Natl Acad Sci U S A. 2006;103: (3) Willcox BE, Thomas LM, Bjorkman PJ. Crystal structure of HLA-A2 bound to LIR-1, a host and viral major histocompatibility complex receptor. Nat Immunol. 2003;4: (4) Boyington JC, Motyka SA, Schuck P, Brooks AG, Sun PD. Crystal structure of an NK cell immunoglobulin-like receptor in complex with its class I MHC ligand. Nature. 2000;405: (5) Herr AB, Ballister ER, Bjorkman PJ. Insights into IgA-mediated immune responses from the crystal structures of human FcalphaRI and its complex with IgA1-Fc. Nature. 2003;423: (6) Krissinel E, Henrick K. Inference of macromolecular assemblies from crystalline state. J Mol Biol. 2007;372:
3 Table S1. Data collection and refinement statistics hlair1-cbd Data collection Space group P3 2 Cell dimensions a, b, c (Å) 69.4, 69.4, 54.3 α, β, γ ( ) 90, 90, 120 Resolution (Å)* ( ) R merge (0.208) I / σi 20.2 (5.2) Completeness (%) 96.3 (78.4) Redundancy 5.5 (3.9) Refinement No. reflections Twin law h, -h-k, -l Twin Fraction R work / R free / No. atoms 2843 Protein 2389 Water/Other 443/11 Average B/ Wilson B (Å 2 ) 23.2/17.46 R.m.s. deviations Bond lengths (Å) Bond angles ( ) Ramachandran Plot (%) Core 93.4 Allowed 6.6 Generously allowed 0.0 Disallowed 0.0
4 * Values between brackets refer to the highest resolution shell of data Table S2. Root mean square differences between hlair1-cbd and D1 domains of other LRC receptors Receptor PDB code Alignment length Cα rmsd (Å) Sequence identity (residues) D1-domains GPVI 2GI LIR-1 1G0X LIR-2 2GW LILRA5 2D3V KIR2DL2 1EFX FcαRI 1OVZ
5 Table S3. Results of docking of hlair1-cbd and peptide III-30 using Haddock 2.0 Cluster a Haddock score (kcal mol -1 ) b N c RMSD-E min (Å) d E VDW (kcal mol -1 ) e E elec (kcal mol -1 ) f E desolv (kcal mol -1 ) g E AIR (kcal mol -1 ) h BSA (Å 2 ) i orientation ( ) j ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± a The final 200 solutions were clustered using an interface ligand RMSD cut off of 7.5 Å. Values represent the average of the four best scoring solutions in each cluster. b The HADDOCK score was calculated as the sum of: E vdw E elec + E desolv E AIR. c Number of structures in a given cluster d Overall backbone RMSD from the overall lowest energy structure e Intermolecular VanderWaals energy f Intermolecular electrostatic energy g Desolvation energy h HADDOCK ambiguous interaction restraint energy i Buried surface area j Estimated angle between the collagen peptide and β-strands F, C and C of LAIR-1
6 Figure S1. Ligand binding surfaces of LRC-family members Surface drawing of the D1D2 domains of LIR-1, KIR2DL2 and FcαR showing in red surface residues that in the ligand-complex crystal structures were shown to be in contact with the ligand. The D1 domain is in the same orientation as LAIR-1 in Fig. 2B, ribbon drawing. In the leukocyte inhibitory receptors LIR-1 and LIR-2, the interaction site of MHC I-β 2 M is located to the D1D2 hinge region, whereas the HLA-binding site is located in D1 and involves residues from β-strand C, and the helix that replaces strand C in these proteins. 2,3 In the KIR receptors, the interaction with MHC class I molecules is localised to the D1D2 hinge region. 4 The FcαRI receptor interacts with IgA through residues in the BC and FG loops and the tip of strand D at the apex of the D1 domain. 5
7 Figure S2. Collagen binding properties of the recombinant hlair-1 ectodomain Binding of recombinant hlair-1 to Elisa plates coated with collagen I ( ), collagen III ( ) or BSA ( ). The apparent dissociation constant was determined by fitting the equation OD = OD background + OD max * [LAIR- 1] / (K D,app + [LAIR-1]). This gives half maximal binding at 2.07 ± 0.22 μg/ml and 10.6 ± 1.0 μg/ml protein for collagen I and collagen III, respectively. Since the molecular weight of the tagged LAIR-1 protein is 14.1 kd this corresponds to apparent K D values of 147 ± 16 nm and 750 ± 71 nm, respectively. Curve fitting was done using the program SigmaPlot 11.
8 Figure S3. An unlikely dimer of LAIR-1 Cartoon drawing of LAIR-1 molecules A and B in the asymmetric unit. Both molecules are rainbowcoloured from N-terminus (blue) to C-terminus (red). The location of the two-fold rotational axis is indicated by the crossed circle. The C-termini of molecules A and B point in opposite directions along the long axis of the molecules. We analyzed the significance of the dimer using the PISA web server 6 ( On the basis of the relatively small size of the dimer interface (439 Å 2 ) and the nature of the interaction surface, PISA suggests that the dimer observed in the crystal is not likely to be of physiological relevance.
9 Figure S4. Binding of K562 cells transfected with hlair-1a mutants to peptide III-30 (A) Summary flow cytometry analyses showing binding of the triple helical peptide III-30 to parent K562 cells (-) and K562 cells expressing wt LAIR-1a or mutants as indicated. (B) Adhesion of parent K562 cells (-) and K562 cells expressing wt LAIR-1a or mutants as indicated to plate bound peptide III-30. Data represent mean + SD of at least three independent experiments.
10 Figure S5. Sequence conservation within the LAIR and LRC-families Top: alignment of hlair1 with LAIR1 and LAIR2 from several species. Sequence identities vary from 31.7% with mouse LAIR-1 to 96.1% with chimpanzee LAIR-1. Bottom: alignment with the D1 domains of a selection of human LRC-members. Residues that are 100% conserved are indicated by grey bars. The alignment was produced by 3DCoffee/Espresso which includes 3D structural information ( Arrows indicate key residues in the collagen-binding site.
11 Figure S6. Sequence conservation within the GPVI family Multiple sequence alignment of the D1D2 domains of GPVI molecules from several species. Residues that are 100% conserved residues are indicated by grey bars. Residues that are also conserved in the LAIR-family are indicated by red bars and key residues R59, E61 and W109 from the LAIR-1 collagen-binding site are indicated by arrows. The alignment was produced by 3DCoffee/Espresso which includes 3D structural information (
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1: Amplitudes of three current levels. Level 0 (pa) Level 1 (pa) Level 2 (pa) TrkA- TrkH WT 200 K 0.01 ± 0.01 9.5 ± 0.01 18.7 ± 0.03 200 Na * 0.001 ± 0.01 3.9 ± 0.01 12.5 ± 0.03 200
More informationSUPPLEMENTARY INFORMATION
Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
More informationSupporting Information
Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,
More informationSupporting Information. UV-induced ligand exchange in MHC class I protein crystals
Supporting Information for the article entitled UV-induced ligand exchange in MHC class I protein crystals by Patrick H.N. Celie 1, Mireille Toebes 2, Boris Rodenko 3, Huib Ovaa 3, Anastassis Perrakis
More informationSupplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing
Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing 0.1% SDS without boiling. The gel was analyzed by a fluorescent
More informationHADDOCK: High Ambiguity
Determination of Protein-Protein complexes HADDOCK: High Ambiguity Driven DOCKing A protein-protein docking approach based on biochemical and/or biophysical data In PDB: >15000 protein structures but
More informationml. ph 7.5 ph 6.5 ph 5.5 ph 4.5. β 2 AR-Gs complex + GDP β 2 AR-Gs complex + GTPγS
a UV28 absorption (mau) 9 8 7 5 3 β 2 AR-Gs complex β 2 AR-Gs complex + GDP β 2 AR-Gs complex + GTPγS β 2 AR-Gs complex dissociated complex excess nucleotides b 9 8 7 5 3 β 2 AR-Gs complex β 2 AR-Gs complex
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1: Data collection, phasing and refinement statistics ChbC/Ta 6 Br 12 Native ChbC Data collection Space group P4 3 2 1 2 P4 3 2 1 2 Cell dimensions a, c (Å) 132.75, 453.57 132.81, 452.95
More informationA.D.J. van Dijk "Modelling of biomolecular complexes by data-driven docking"
Chapter 3. Various strategies of using Residual Dipolar Couplings in NMRdriven protein docking: application to Lys48-linked di-ubiquitin and validation against 15 N-relaxation data. Aalt D.J. van Dijk,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10458 Active Site Remodeling in the Bifunctional Fructose-1,6- bisphosphate aldolase/phosphatase Juan Du, Rafael F. Say, Wei Lü, Georg Fuchs & Oliver Einsle SUPPLEMENTARY FIGURES Figure
More informationFull-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),
Supplementary Methods Protein expression and purification Full-length GlpG sequence was generated by PCR from E. coli genomic DNA (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.
More informationSupporting Information
Supporting Information Fera et al. 10.1073/pnas.1409954111 SI Methods Compliance. All work related to human subjects complied with protocols approved by the Duke University Health System Institutional
More informationActa Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural basis of the heterodimerization of the MST and RASSF SARAH domains in the Hippo signalling
More informationSupplementary Figure 1 Schematic overview of ASTNs in neuronal migration. (a) Schematic of roles played by ASTNs 1 and 2. ASTN-1-mediated adhesions
Supplementary Figure 1 Schematic overview of ASTNs in neuronal migration. (a) Schematic of roles played by ASTNs 1 and 2. ASTN-1-mediated adhesions undergo endocytosis into clathrin-coated vesicles dependent
More informationSupporting Information
Supporting Information Structural Basis of the Antiproliferative Activity of Largazole, a Depsipeptide Inhibitor of the Histone Deacetylases Kathryn E. Cole 1, Daniel P. Dowling 1,2, Matthew A. Boone 3,
More informationSUPPLEMENTARY INFORMATION. doi: /nature07461
Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of
More informationCks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved
Cks1 d CKS1 Supplementary Figure 1 The -Cks1 crystal lattice. (a) Schematic of the - Cks1 crystal lattice. -Cks1 crystallizes in a lattice that contains c 4 copies of the t - Cks1 dimer in the crystallographic
More informationSUPPLEMENTARY INFORMATION
Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,
More informationSupplementary materials. Crystal structure of the carboxyltransferase domain. of acetyl coenzyme A carboxylase. Department of Biological Sciences
Supplementary materials Crystal structure of the carboxyltransferase domain of acetyl coenzyme A carboxylase Hailong Zhang, Zhiru Yang, 1 Yang Shen, 1 Liang Tong Department of Biological Sciences Columbia
More informationSupplementary Figures
1 Supplementary Figures Supplementary Figure 1 Type I FGFR1 inhibitors (a) Chemical structures of a pyrazolylaminopyrimidine inhibitor (henceforth referred to as PAPI; PDB-code of the FGFR1-PAPI complex:
More informationFW 1 CDR 1 FW 2 CDR 2
Supplementary Figure 1 Supplementary Figure 1: Interface of the E9:Fas structure. The two interfaces formed by V H and V L of E9 with Fas are shown in stereo. The Fas receptor is represented as a surface
More informationBSc and MSc Degree Examinations
Examination Candidate Number: Desk Number: BSc and MSc Degree Examinations 2018-9 Department : BIOLOGY Title of Exam: Molecular Biology and Biochemistry Part I Time Allowed: 1 hour and 30 minutes Marking
More informationSupplementary Figure 1. Biochemical and sequence alignment analyses the
Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).
More informationProtein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.
Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small
More informationExamples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE
Examples of Protein Modeling Protein Modeling Visualization Examination of an experimental structure to gain insight about a research question Dynamics To examine the dynamics of protein structures To
More informationSupplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases
Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3
More informationTable 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2
Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.
More informationAdvanced Certificate in Principles in Protein Structure. You will be given a start time with your exam instructions
BIRKBECK COLLEGE (University of London) Advanced Certificate in Principles in Protein Structure MSc Structural Molecular Biology Date: Thursday, 1st September 2011 Time: 3 hours You will be given a start
More informationBacterial protease uses distinct thermodynamic signatures for substrate recognition
Bacterial protease uses distinct thermodynamic signatures for substrate recognition Gustavo Arruda Bezerra, Yuko Ohara-Nemoto, Irina Cornaciu, Sofiya Fedosyuk, Guillaume Hoffmann, Adam Round, José A. Márquez,
More informationSupplementary Figures for Tong et al.: Structure and function of the intracellular region of the plexin-b1 transmembrane receptor
Supplementary Figures for Tong et al.: Structure and function of the intracellular region of the plexin-b1 transmembrane receptor Figure S1. Plexin-B1 GAP segments are homologous to RasGAPs. Sequence alignment
More informationBBS501 Section 1 9:00 am 10:00 am Monday thru Friday LRC 105 A & B
BBS501 Section 1 9:00 am 10:00 am Monday thru Friday LRC 105 A & B Lecturers: Dr. Yie-Hwa Chang Room M130 Phone: #79263 E-mail:changy@slu.edu Dr. Tomasz Heyduk Room M99 Phone: #79238 E-mail: heydukt@slu.edu
More informationIntroduction to" Protein Structure
Introduction to" Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Learning Objectives Outline the basic levels of protein structure.
More informationCH 3 CH 2 OH +H 2 O CHO. 2e + 2H + + O 2 H 2 O +HCOOH
2 4 H CH 3 2e + 2H + + 2 H 2 2 H CH 2 H 2e + 2H + + 2 H 2 2 H +H 2 CH 2e + 2H + + 2 H 2 2 H +HCH Supplemental Figure S. The three-step 4DM reaction, each step requires two reducing equivalents from ADPH
More informationSupplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization
Supplementary Information Structural basis for precursor protein-directed ribosomal peptide macrocyclization Kunhua Li 1,3, Heather L. Condurso 1,3, Gengnan Li 1, Yousong Ding 2 and Steven D. Bruner 1*
More informationNature Structural and Molecular Biology: doi: /nsmb.2938
Supplementary Figure 1 Characterization of designed leucine-rich-repeat proteins. (a) Water-mediate hydrogen-bond network is frequently visible in the convex region of LRR crystal structures. Examples
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group
More informationSUPPLEMENTARY INFORMATION
Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3
More informationStructure of the SPRY domain of human DDX1 helicase, a putative interaction platform within a DEAD-box protein
Supporting information Volume 71 (2015) Supporting information for article: Structure of the SPRY domain of human DDX1 helicase, a putative interaction platform within a DEAD-box protein Julian Kellner
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1737 Supplementary Table 1 variant Description FSEC - 2B12 a FSEC - 6A1 a K d (leucine) c Leucine uptake e K (wild-type like) K (Y18F) K (TS) K (TSY) K288A mutant, lipid facing side chain
More informationCrystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions. Implicated in Dimerization and Autoinhibition
JBC Papers in Press. Published on November 1, 2000 as Manuscript M006502200 Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions Implicated in Dimerization and Autoinhibition 1 Copyright
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10955 Supplementary Figures Supplementary Figure 1. Electron-density maps and crystallographic dimer structures of the motor domain. (a f) Stereo views of the final electron-density maps
More informationMolecular dynamics simulations of anti-aggregation effect of ibuprofen. Wenling E. Chang, Takako Takeda, E. Prabhu Raman, and Dmitri Klimov
Biophysical Journal, Volume 98 Supporting Material Molecular dynamics simulations of anti-aggregation effect of ibuprofen Wenling E. Chang, Takako Takeda, E. Prabhu Raman, and Dmitri Klimov Supplemental
More informationSupplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer
More informationSupporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS
Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS CNS input file generatemetal.inp: remarks file generate/generatemetal.inp
More informationT H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp
S u p p l e m e n ta l m at e r i a l jgp Lee et al., http://www.jgp.org/cgi/content/full/jgp.201411219/dc1 T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y S u p p l e m e n ta l D I S C U S
More informationSUPPLEMENTARY INFORMATION
Figure S1. Secondary structure of CAP (in the camp 2 -bound state) 10. α-helices are shown as cylinders and β- strands as arrows. Labeling of secondary structure is indicated. CDB, DBD and the hinge are
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature17991 Supplementary Discussion Structural comparison with E. coli EmrE The DMT superfamily includes a wide variety of transporters with 4-10 TM segments 1. Since the subfamilies of the
More informationStructure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps
Cell Reports Supplemental Information Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps Chih-Chia Su, Jani Reddy Bolla, Nitin Kumar, Abhijith Radhakrishnan,
More informationThe structure of a nucleolytic ribozyme that employs a catalytic metal ion. Yijin Liu, Timothy J. Wilson and David M.J. Lilley
SUPPLEMENTARY INFORMATION The structure of a nucleolytic ribozyme that employs a catalytic metal ion Yijin Liu, Timothy J. Wilson and David M.J. Lilley Cancer Research UK Nucleic Acid Structure Research
More informationChapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR
The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR 103 Abstract The interaction of the Src SH2 domain with the catalytic domain of FAK, including the Y397 SH2 domain
More informationSUPPLEMENTARY INFORMATION
Data collection Supplementary Table 1 Statistics of data collection, phasing and refinement Native Se-MAD Space group P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 50.4, 94.2, 115.4 49.8, 94.2,
More informationTHE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina
More informationStructure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits AhpC and AhpF from Escherichia coli Phat Vinh Dip 1,#, Neelagandan Kamariah 2,#, Malathy Sony Subramanian Manimekalai
More informationSupporting online material
Supporting online material Materials and Methods Target proteins All predicted ORFs in the E. coli genome (1) were downloaded from the Colibri data base (2) (http://genolist.pasteur.fr/colibri/). 737 proteins
More informationSupplemental Information
Supplemental Information Combinatorial Readout of Unmodified H3R2 and Acetylated H3K14 by the Tandem PHD Finger of MOZ Reveals a Regulatory Mechanism for HOXA9 Transcription Yu Qiu 1, Lei Liu 1, Chen Zhao
More informationIntroduction to Comparative Protein Modeling. Chapter 4 Part I
Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/310/5751/1159/dc1 Supporting Online Material for Structure of the Quaternary Complex of Interleukin-2 with Its α, β, and γ c Receptors Xinquan Wang, Mathias Rickert,
More informationStructural basis of PROTAC cooperative recognition for selective protein degradation
SUPPLEMENTARY INFORMATION Structural basis of PROTAC cooperative recognition for selective protein degradation Morgan S. Gadd 1, Andrea Testa 1, Xavier Lucas 1, Kwok-Ho Chan, Wenzhang Chen, Douglas J.
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting
More informationHigh-resolution crystal structure of ERAP1 with bound phosphinic transition-state analogue inhibitor
High-resolution crystal structure of ERAP1 with bound phosphinic transition-state analogue inhibitor Petros Giastas 1, Margarete Neu 2, Paul Rowland 2, and Efstratios Stratikos 1 1 National Center for
More informationSupplementary information for:
SUPPLEMETARY IFRMATI Supplementary information for: Structure of a β 1 -adrenergic G protein-coupled receptor Tony Warne, Maria J. Serrano-Vega, Jillian G. Baker#, Rouslan Moukhametzianov, Patricia C.
More informationSUPPLEMENTARY INFORMATION
www.nature.com/nature 1 Figure S1 Sequence alignment. a Structure based alignment of the plgic of E. chrysanthemi (ELIC), the acetylcholine binding protein from the snail Lymnea stagnalis (AchBP, PDB code
More informationModeling for 3D structure prediction
Modeling for 3D structure prediction What is a predicted structure? A structure that is constructed using as the sole source of information data obtained from computer based data-mining. However, mixing
More informationActa Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural characterization of the virulence factor Nuclease A from Streptococcus agalactiae
More informationQuantifying the Affinities and Kinetics of Protein Interactions Using Silicon Nanowire Biosensors
SUPPLEMENTARY INFORMATION DOI: 10.1038/NNANO.2012.82 Quantifying the Affinities and Kinetics of Protein Interactions Using Silicon Nanowire Biosensors Xuexin Duan, Yue Li, Nitin K. Rajan, David A. Routenberg,
More informationBuilding a Homology Model of the Transmembrane Domain of the Human Glycine α-1 Receptor
Building a Homology Model of the Transmembrane Domain of the Human Glycine α-1 Receptor Presented by Stephanie Lee Research Mentor: Dr. Rob Coalson Glycine Alpha 1 Receptor (GlyRa1) Member of the superfamily
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11744 Supplementary Table 1. Crystallographic data collection and refinement statistics. Wild-type Se-Met-BcsA-B SmCl 3 -soaked EMTS-soaked Data collection Space
More informationUseful background reading
Overview of lecture * General comment on peptide bond * Discussion of backbone dihedral angles * Discussion of Ramachandran plots * Description of helix types. * Description of structures * NMR patterns
More informationBIRKBECK COLLEGE (University of London)
BIRKBECK COLLEGE (University of London) SCHOOL OF BIOLOGICAL SCIENCES M.Sc. EXAMINATION FOR INTERNAL STUDENTS ON: Postgraduate Certificate in Principles of Protein Structure MSc Structural Molecular Biology
More informationNMR in Structural Biology
NMR in Structural Biology Exercise session 2 1. a. List 3 NMR observables that report on structure. b. Also indicate whether the information they give is short/medium or long-range, or perhaps all three?
More informationSecondary and sidechain structures
Lecture 2 Secondary and sidechain structures James Chou BCMP201 Spring 2008 Images from Petsko & Ringe, Protein Structure and Function. Branden & Tooze, Introduction to Protein Structure. Richardson, J.
More informationSOCS3 binds specific receptor JAK complexes to control cytokine signaling by direct kinase inhibition SUPPLEMENTARY INFORMATION
SOCS3 binds specific receptor JAK complexes to control cytokine signaling by direct kinase inhibition Nadia J. Kershaw 1,2, James M. Murphy 1,2, Nicholas P.D. Liau 1,2, Leila N. Varghese 1,2, Artem Laktyushin
More informationStructural insights into WcbI, a novel polysaccharide-biosynthesis enzyme
Volume 1 (2014) Supporting information for article: Structural insights into WcbI, a novel polysaccharide-biosynthesis enzyme Mirella Vivoli, Emily Ayres, Edward Beaumont, Michail N. Isupov and Nicholas
More informationHomology Modeling (Comparative Structure Modeling) GBCB 5874: Problem Solving in GBCB
Homology Modeling (Comparative Structure Modeling) Aims of Structural Genomics High-throughput 3D structure determination and analysis To determine or predict the 3D structures of all the proteins encoded
More informationSupplemental Data. Structure of the Rb C-Terminal Domain. Bound to E2F1-DP1: A Mechanism. for Phosphorylation-Induced E2F Release
Supplemental Data Structure of the Rb C-Terminal Domain Bound to E2F1-DP1: A Mechanism for Phosphorylation-Induced E2F Release Seth M. Rubin, Anne-Laure Gall, Ning Zheng, and Nikola P. Pavletich Section
More informationSupplemental Data SUPPLEMENTAL FIGURES
Supplemental Data CRYSTAL STRUCTURE OF THE MG.ADP-INHIBITED STATE OF THE YEAST F 1 C 10 ATP SYNTHASE Alain Dautant*, Jean Velours and Marie-France Giraud* From Université Bordeaux 2, CNRS; Institut de
More informationChemical properties that affect binding of enzyme-inhibiting drugs to enzymes
Introduction Chemical properties that affect binding of enzyme-inhibiting drugs to enzymes The production of new drugs requires time for development and testing, and can result in large prohibitive costs
More informationSupplemental Information. The Mitochondrial Fission Receptor MiD51. Requires ADP as a Cofactor
Structure, Volume 22 Supplemental Information The Mitochondrial Fission Receptor MiD51 Requires ADP as a Cofactor Oliver C. Losón, Raymond Liu, Michael E. Rome, Shuxia Meng, Jens T. Kaiser, Shu-ou Shan,
More informationEnhancing Specificity in the Janus Kinases: A Study on the Thienopyridine. JAK2 Selective Mechanism Combined Molecular Dynamics Simulation
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Supporting Information Enhancing Specificity in the Janus Kinases: A Study on the Thienopyridine
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),
More informationSupplementary Information to
Supplementary Information to Wiesner et al.: A change in conformational dynamics underlies the activation of Eph receptor tyrosine kinases Supplementary Material and Methods Cloning and Mutagenesis Site-directed
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier
More informationschematic diagram; EGF binding, dimerization, phosphorylation, Grb2 binding, etc.
Lecture 1: Noncovalent Biomolecular Interactions Bioengineering and Modeling of biological processes -e.g. tissue engineering, cancer, autoimmune disease Example: RTK signaling, e.g. EGFR Growth responses
More informationSupplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a
Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a series of tmfret-pairs comprised of single cysteine mutants
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/5/243/ra68/dc1 Supplementary Materials for Superbinder SH2 Domains Act as Antagonists of Cell Signaling Tomonori Kaneko, Haiming Huang, Xuan Cao, Xing Li, Chengjun
More informationtype GroEL-GroES complex. Crystals were grown in buffer D (100 mm HEPES, ph 7.5,
Supplementary Material Supplementary Materials and Methods Structure Determination of SR1-GroES-ADP AlF x SR1-GroES-ADP AlF x was purified as described in Materials and Methods for the wild type GroEL-GroES
More informationSupplementary Figure 1 Preparation of PDA nanoparticles derived from self-assembly of PCDA. (a)
Supplementary Figure 1 Preparation of PDA nanoparticles derived from self-assembly of PCDA. (a) Computer simulation on the self-assembly of PCDAs. Two kinds of totally different initial conformations were
More informationSupplemental Information. Molecular Basis of Spectral Diversity. in Near-Infrared Phytochrome-Based. Fluorescent Proteins
Chemistry & Biology, Volume 22 Supplemental Information Molecular Basis of Spectral Diversity in Near-Infrared Phytochrome-Based Fluorescent Proteins Daria M. Shcherbakova, Mikhail Baloban, Sergei Pletnev,
More informationWe used the PSI-BLAST program (http://www.ncbi.nlm.nih.gov/blast/) to search the
SUPPLEMENTARY METHODS - in silico protein analysis We used the PSI-BLAST program (http://www.ncbi.nlm.nih.gov/blast/) to search the Protein Data Bank (PDB, http://www.rcsb.org/pdb/) and the NCBI non-redundant
More informationSupporting Information
Supporting Information Structural Analysis of the Binding of Type I, I 1/2, and II Inhibitors to Eph Tyrosine Kinases Jing Dong, *1 Hongtao Zhao, 1 Ting Zhou, 1 Dimitrios Spiliotopoulos, 1 Chitra Rajendran,
More informationAny protein that can be labelled by both procedures must be a transmembrane protein.
1. What kind of experimental evidence would indicate that a protein crosses from one side of the membrane to the other? Regions of polypeptide part exposed on the outside of the membrane can be probed
More informationSupplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached
Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached to HpUreI. Urea hydrolysis products 2NH 3 and 1CO 2
More informationProtein Structure. W. M. Grogan, Ph.D. OBJECTIVES
Protein Structure W. M. Grogan, Ph.D. OBJECTIVES 1. Describe the structure and characteristic properties of typical proteins. 2. List and describe the four levels of structure found in proteins. 3. Relate
More informationProtein Structure Determination from Pseudocontact Shifts Using ROSETTA
Supporting Information Protein Structure Determination from Pseudocontact Shifts Using ROSETTA Christophe Schmitz, Robert Vernon, Gottfried Otting, David Baker and Thomas Huber Table S0. Biological Magnetic
More information