SOCS3 binds specific receptor JAK complexes to control cytokine signaling by direct kinase inhibition SUPPLEMENTARY INFORMATION
|
|
- Franklin Hunt
- 5 years ago
- Views:
Transcription
1 SOCS3 binds specific receptor JAK complexes to control cytokine signaling by direct kinase inhibition Nadia J. Kershaw 1,2, James M. Murphy 1,2, Nicholas P.D. Liau 1,2, Leila N. Varghese 1,2, Artem Laktyushin 1, Eden L. Whitlock 1, Isabelle S. Lucet 3, Nicos A. Nicola 1,2 and Jeffrey J. Babon 1,2 1 Walter and Eliza Hall Institute, Parkville, Australia 2 The University of Melbourne, Parkville, Australia. 3 Monash University, Clayton, Australia. Correspondence should be addressed to J.J.B (babon@wehi.edu.au) or N.A.N (nicola@wehi.edu.au) SUPPLEMENTARY INFORMATION Running title: Inhibition of JAK/STAT signaling by SOCS3
2 Supplementary Figure 1 Crystallisation of SOCS/JAK2/gp130 (a) Schematic of the JAK2 and SOCS3 domain architectures. The regions boxed in red are those crystallised in this study. (b) F obs -F calc simulated annealing omit map calculated from model in which all 4 copies of gp130 were removed. Electron density for the gp130 fragment is shown in green mesh contoured at 3. (c) B-factor sharpened 2F obs -F calc electron density map showing the SOCS3/gp130 interface contoured at 1.2. Important residues are shown labeled
3
4 Supplementary Figure 2 SAXS analysis of SOCS JAK2 gp130 (a). The pairwise interatomic distance distributions (P(r)) were determined using GNOM (Svergun 1992) from the scattering profiles for apo Jak2 JH1 (green) and the Jak2 JH1:SOCS3 SH2:gp130 peptide complex (blue). The maximum particle dimension, Dmax, is elongated for the Jak2 JH1:SOCS3 SH2:gp130 peptide complex relative to apo Jak2 JH1. Using GNOM, the radius of gyration, Rg, was determined as 22.00±0.047 Å for apo Jak2 JH1 compared to that of the Jak2 JH1:SOCS3 SH2:gp130 peptide complex, 26.19±0.093 Å. (b). A Guinier plot of the Jak2 JH1:SOCS3 SH2:gp130 peptide complex scattering data is linear, illustrating that high molecular weight aggregates do not measurably contribute to scattering. (c,d) The experimental scattering curve measured for the Jak2 JH1:SOCS3 SH2:gp130 peptide complex (black) were overlaid with (c) the theoretical scattering curve calculated in CRYSOL from the X-ray crystal structure of the complex and (d) the fitted curve arising from DAMMIF ab initio bead modelling (both shown as red curves). The values for the fits shown in (c) and (d) are and 0.506, respectively, indicating an excellent correspondence between experimental data and models. (e) The other potential SOCS/JAK/gp130 trimer. There are two potential SOCS/JAK interfaces present in the asymmetric unit however only one of them is consistent with NMR data, mutagenesis and SAXS. The alternate model is shown in cartoon representation. SOCS3 as present in our final model is shown in semi-transparent surface representation for comparison (f) The experimental scattering curve measured for the Jak2 JH1:SOCS3 SH2:gp130 peptide complex (black) was overlaid with the theoretical scattering curve calculated in CRYSOL from the X-ray crystal structure of the other potential SOCS/JAK/gp130 trimer in the asymmetric unit. This fit is poor ( =2.7) compared to that shown in (c). (g) The molecular envelope of the JAK2/SOCS3/gp130 complex in solution calculated from SAXS data by performing 10 independent DAMMIF ab initio bead reconstructions (grey spheres) superimposed with the alternate complex crystal structure. Upper panel shown in the same orientation as panel e, left; lower panel, top view.
5 Supplementary Figure 3 Electron density of of the SOCS3/JAK2 interface (a) B-factor sharpened 2F obs -F calc electron density map showing the SOCS3/JAK2 interface contoured at 1.5. Important residues are shown labeled. (b) Comparison of the JAK2 structure in isolation (PDB: 2B7A 1 ) and in complex. (c) A comparison of JAK2 and JAK3 2 highlights the GQM motif and JAK insertion loop as the major conformational differences between the two molecules.
6 Supplementary Figure 4 Electron density of the kinase inhibitory region B-factor sharpened 2F obs -F calc electron density map showing the SOCS3/JAK2 interface (SOCS3 in foreground) contoured at 1.5. Important residues are shown labeled. The view shown is the same as Figure 3A.
7 Supplementary Figure 5. SOCS3 co-precipitates with activated and dephosphorylated JAK2JH1 with similar affinity. Dephosphorylated JAK2 JH1 was prepared by co-expressing it with the phosphatase PTP1B and then used in the co-precipitation experiment shown in Figure 4b. An aliquot of the gel samples shown in Figure 4b were run on a second SDS-PAGE gel and western blotted using an anti-jak2 antibody (left panel) and an anti-pjak2 (py1007/8) antibody (center panel). These blots were performed on the same membrane using 700nm and 800nm Infraredlabelled secondary antibodies and visualized using the odyssey system. An overlay of the 700 nm and 800 nm channels is shown on the right.
8 Supplementary Figure 6 SOCS3 inhibits JAK2 by blocking substrate binding. (a) Kinase inhibition assays performed with constructs of SOCS3 truncated at the N-terminal end of the KIR show that constructs lacking 1-3 residues only partially inhibit JAK2 activity. Left, the phosphorimage of kinase inhibition experiments using the standard STAT5b peptide (Y+8) as a substrate. Right, as for left but using a C-terminally truncated (Y+1) substrate. Inhibition of STAT5bY+1 by SOCS3 N22,23 is only 50% complete under saturating conditions. These results are quantified and plotted in Figure 5c. (b) Radioactive kinase assays show that constructs of SOCS3 with a tyrosine 1-3 residues upstream of the KIR are good substrates for JAK2. Reactions were performed for 1 minute (upper panels) and 2 minutes (lower panels) and then analyzed via SDS-PAGE (left) followed by autoradiography (right). Experiments performed in the absence of SOCS3 (-ve) are shown as a control. (c) As for (b) but SOCS3 F25A mutants are used as controls to show that tyrosines upstream of the KIR are only good substrates for JAK2 when forced into close proximity of the active site by the remainder of SOCS3. These results are the same as those shown in Figure 6a,b with the addition of the Coomassie stained gels from the same experiment to indicate loading.
9 Supplementary Figure 7. JAK2 can phosphorylate a Threonine residue incorporated upstream of the SOCS3 KIR. Three constructs of SOCS3, containing either a Threonine, Glycine or Tyrosine three residues upstream of the KIR were tested as substrates for JAK2 phosphorylation. Reactions were performed for 1 minute and 2 minutes and then analyzed via SDS-PAGE (upper) followed by autoradiography (lower). 1mM STAT5b peptide was included in the reaction to compare the relative efficiency of phosphorylation. SOCS3/elonginBC constructs were present at 10 M.
10 Supplementary Table 1: SAXS data analysis. SAXS data analysis. Data-collection parameters Instrument Australian Synchrotron SAXS/WAXS beamline Beam geometry Wavelength (Å) 120 micron point source, Å q range (Å-1)a to Å-1 Exposure time, Protein concentration, Temperature 2sec exposures, 5mg/mL protein via inline gel filtration chromatography, 27 C. Structural parameters I(0) (cm-1) [from P(r)] ± Rg (Å) [from P(r)] ± 0.09 Dmax (Å) 85 I(0) (cm-1) (from Guinier) ± Rg (Å) (from Guinier) ± 0.12 Theoretical envelope volume (Å- 71,300 3)b Experimentally determined 70,820 excluded volume (Å-3)c Software employed Primary data reduction SAXS15ID (Australian Synchrotron) Data processing PRIMUS, GNOM Ab initio analysis DAMMIF Validation and averaging DAMAVER Rigid-body modelling N/A Computation of model intensities CRYSOL Three-dimensional graphics Pymol representations a q is the magnitude of the scattering vector, which is related to the scattering angle (2θ) and the wavelength (λ) as follows: q = (4π/λ)sinθ b Envelope volume calculated from crystal structure using CRYSOL c Excluded volume calculated from 10 averaged DAMMIF ab initio bead models
11 Supplementary Note Crystal structure determination Initial building and refinement of the structure was performed using data cut at 4.5Å, using I/σI of 1.5 as the data cut-off criterion. The structure was refined to excellent R free and R work values of and respectively. The low R-factors are aided by the presence of 4-fold non-crystallographic symmetry and the fact that high resolution structures of SOCS3 (2.0Å) and JAK2 (2.4Å) made up the initial model. However, during the course of this work, Karplus and Diederichs published an alternative criterion for data cut-off 3. Using this method we extended the data cut-off to 3.9Å and were able to refine our model to even lower R free and R work values of and respectively with improvement in the electron density maps. R free and R work in the Å bin dropped by >3% when the additional data was included. The improvement in both resolution and refinement was likely due to the fact that the X-ray diffraction pattern was highly anisotropic and that, in some dimensions, diffraction could be observed out to 3.6Å. Refinement also required less stringent restraints when the additional data was included. As part of the refinement procedure, thermal factor sharpening (B-factor sharpening) was applied to 2F o -F c maps in order to gain more detailed information on atomic positions, especially those in amino acid side chains. The B-factor sharpening technique, which multiplies the structure factor of a particular electron density map by an exponential function of the negative Wilson B factor has been shown by Brunger and colleagues to be particularly effective during refinement of mid-low resolution datasets in the Å range where excellent phases already exist due to higher resolution initial models 4. As these conditions were met by our dataset we applied thermal factor sharpening cautiously during the final few stages of refinement and always compared the resulting maps with nonsharpened maps. This procedure aided us in obtaining excellent refinement statistics given our relatively low resolution dataset. For completeness, toward the end of refinement, we included the low twin fraction in our refinement. The twin law used, as determined by Xtriage, was h,-h-k,-l, and the twin fraction refined to There was no significant difference in maps generated with and without twinning. Final R free and R work values of and were obtained, as reported in Table 1. Supplementary References 1. Lucet, I.S. et al. The structural basis of Janus kinase 2 inhibition by a potent and specific pan-janus kinase inhibitor. Blood. 107, Epub 2005 Sep 20. (2006). 2. Boggon, T.J., Li, Y., Manley, P.W. & Eck, M.J. Crystal structure of the Jak3 kinase domain in complex with a staurosporine analog. Blood 106, (2005). 3. Karplus, P.A. & Diederichs, K. Linking crystallographic model and data quality. Science 336, (2012). 4. Brunger, A.T., DeLaBarre, B., Davies, J.M. & Weis, W.I. X-ray structure determination at low resolution. Acta Crystallogr D Biol Crystallogr 65, (2009).
SI Text S1 Solution Scattering Data Collection and Analysis. SI references
SI Text S1 Solution Scattering Data Collection and Analysis. The X-ray photon energy was set to 8 kev. The PILATUS hybrid pixel array detector (RIGAKU) was positioned at a distance of 606 mm from the sample.
More informationSupplemental Information. Structural and Mechanistic Paradigm. of Leptin Receptor Activation Revealed
Structure, Volume 22 Supplemental Information Structural and Mechanistic Paradigm of Leptin Receptor Activation Revealed by Complexes with Wild-Type and Antagonist Leptins Kedar Moharana, Lennart Zabeau,
More informationStructural characterization of NiV N 0 P in solution and in crystal.
Supplementary Figure 1 Structural characterization of NiV N 0 P in solution and in crystal. (a) SAXS analysis of the N 32-383 0 -P 50 complex. The Guinier plot for complex concentrations of 0.55, 1.1,
More informationSupplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine
Supplementary figure 1. Comparison of unbound and as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine GM-CSF (slate) with bound GM-CSF in the GIF:GM-CSF complex (GIF: green,
More informationID14-EH3. Adam Round
Bio-SAXS @ ID14-EH3 Adam Round Contents What can be obtained from Bio-SAXS Measurable parameters Modelling strategies How to collect data at Bio-SAXS Procedure Data collection tests Data Verification and
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),
More informationSupplementary Figure 1. Biochemical and sequence alignment analyses the
Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).
More informationSmall-Angle Scattering Atomic Structure Based Modeling
Small-Angle Scattering Atomic Structure Based Modeling Alejandro Panjkovich EMBL Hamburg 07.12.2017 A. Panjkovich (EMBL) BioSAS atomic modeling 07.12.2017 1 / 49 From the forest to the particle accelerator
More informationTable S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
More informationSUPPLEMENTARY INFORMATION
Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3
More informationSerine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition
Supplementary Information to Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition Nadine Czudnochowski 1,2, *, Christian A. Bösken 1, * & Matthias Geyer 1 1 Max-Planck-Institut
More informationBiological Small Angle X-ray Scattering (SAXS) Dec 2, 2013
Biological Small Angle X-ray Scattering (SAXS) Dec 2, 2013 Structural Biology Shape Dynamic Light Scattering Electron Microscopy Small Angle X-ray Scattering Cryo-Electron Microscopy Wide Angle X- ray
More informationThe Fic protein Doc uses an inverted substrate to phosphorylate and. inactivate EF-Tu
The Fic protein Doc uses an inverted substrate to phosphorylate and inactivate EF-Tu Daniel Castro-Roa 1, Abel Garcia-Pino 2,3 *, Steven De Gieter 2,3, Nico A.J. van Nuland 2,3, Remy Loris 2,3, Nikolay
More informationCks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved
Cks1 d CKS1 Supplementary Figure 1 The -Cks1 crystal lattice. (a) Schematic of the - Cks1 crystal lattice. -Cks1 crystallizes in a lattice that contains c 4 copies of the t - Cks1 dimer in the crystallographic
More informationModelling against small angle scattering data. Al Kikhney EMBL Hamburg, Germany
Modelling against small angle scattering data Al Kikhney EMBL Hamburg, Germany Validation of atomic models CRYSOL Rigid body modelling SASREF BUNCH CORAL Oligomeric mixtures OLIGOMER Flexible systems EOM
More informationIntroduction to Biological Small Angle Scattering
Introduction to Biological Small Angle Scattering Tom Grant, Ph.D. Staff Scientist BioXFEL Science and Technology Center Hauptman-Woodward Institute Buffalo, New York, USA tgrant@hwi.buffalo.edu SAXS Literature
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1737 Supplementary Table 1 variant Description FSEC - 2B12 a FSEC - 6A1 a K d (leucine) c Leucine uptake e K (wild-type like) K (Y18F) K (TS) K (TSY) K288A mutant, lipid facing side chain
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1: Amplitudes of three current levels. Level 0 (pa) Level 1 (pa) Level 2 (pa) TrkA- TrkH WT 200 K 0.01 ± 0.01 9.5 ± 0.01 18.7 ± 0.03 200 Na * 0.001 ± 0.01 3.9 ± 0.01 12.5 ± 0.03 200
More informationCharacterizing Biological Macromolecules by SAXS Detlef Beckers, Jörg Bolze, Bram Schierbeek, PANalytical B.V., Almelo, The Netherlands
Characterizing Biological Macromolecules by SAXS Detlef Beckers, Jörg Bolze, Bram Schierbeek, PANalytical B.V., Almelo, The Netherlands This document was presented at PPXRD - Pharmaceutical Powder X-ray
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Definition and assessment of ciap1 constructs.
Supplementary Figure 1 Definition and assessment of ciap1 constructs. (a) ciap1 constructs used in this study are shown as primary structure schematics with domains colored as in the main text. Mutations
More informationBM29 biosaxs data processing tutorial
HERCULES 2014 BM29 biosaxs data processing tutorial Page 2 OUTLINE Sample Changer Primary Data Processing Model Validation HPLC-SAXS Primary Data Processing Model Validation Ab Initio Model Software in
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting
More informationThe Effect of Linker DNA on the Structure and Interaction of Nucleosome Core Particles
Electronic Supplementary Material (ESI) for Soft Matter. This journal is The Royal Society of Chemistry 2018 SUPPLEMENTARY INFORMATION The Effect of Linker DNA on the Structure and Interaction of Nucleosome
More informationSmall Angle X-Ray Solution Scattering of Biological Macromolecules
Small Angle X-Ray Solution Scattering of Biological Macromolecules Emre Brookes UltraScan Workshop 15 June 2014 Overview Experimental method Sample preparation Experimental data analysis Experimental method
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/3/4/e1600663/dc1 Supplementary Materials for A dynamic hydrophobic core orchestrates allostery in protein kinases Jonggul Kim, Lalima G. Ahuja, Fa-An Chao, Youlin
More informationTHE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina
More informationSmall-Angle X-ray Scattering (SAXS) SPring-8/JASRI Naoto Yagi
Small-Angle X-ray Scattering (SAXS) SPring-8/JASRI Naoto Yagi 1 Wikipedia Small-angle X-ray scattering (SAXS) is a small-angle scattering (SAS) technique where the elastic scattering of X-rays (wavelength
More informationSupplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases
Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3
More informationSUPPLEMENTARY INFORMATION
Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase
More informationSupplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer
More informationRobust, high-throughput solution structural analyses by small angle X-ray scattering (SAXS)
nature methods Robust, high-throughput solution structural analyses by small angle X-ray scattering (SAXS) Greg L Hura, Angeli L Menon, Michal Hammel, Robert P Rambo, Farris L Poole II, Susan E Tsutakawa,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the
More informationImpact of the crystallization condition on importin-β conformation
Supporting information Volume 72 (2016) Supporting information for article: Impact of the crystallization condition on importin-β conformation Marcel J. Tauchert, Clément Hémonnot, Piotr Neumann, Sarah
More informationHow to judge data quality
SSRL Workshop: Small-Angle X-ray Scattering and Diffraction Studies, March 28-30, 2016 How to judge data quality Tsutomu Matsui SSRL Lab / Dept. of Chemistry Stanford University Subject of this session
More informationtype GroEL-GroES complex. Crystals were grown in buffer D (100 mm HEPES, ph 7.5,
Supplementary Material Supplementary Materials and Methods Structure Determination of SR1-GroES-ADP AlF x SR1-GroES-ADP AlF x was purified as described in Materials and Methods for the wild type GroEL-GroES
More informationSupplementary Figure 1 Schematic overview of ASTNs in neuronal migration. (a) Schematic of roles played by ASTNs 1 and 2. ASTN-1-mediated adhesions
Supplementary Figure 1 Schematic overview of ASTNs in neuronal migration. (a) Schematic of roles played by ASTNs 1 and 2. ASTN-1-mediated adhesions undergo endocytosis into clathrin-coated vesicles dependent
More informationNitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein
Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08
More informationThree-dimensional structure of a viral genome-delivery portal vertex
Three-dimensional structure of a viral genome-delivery portal vertex Adam S. Olia 1, Peter E. Prevelige Jr. 2, John E. Johnson 3 and Gino Cingolani 4 1 Department of Biological Sciences, Purdue University,
More informationX-ray Crystallography. Kalyan Das
X-ray Crystallography Kalyan Das Electromagnetic Spectrum NMR 10 um - 10 mm 700 to 10 4 nm 400 to 700 nm 10 to 400 nm 10-1 to 10 nm 10-4 to 10-1 nm X-ray radiation was discovered by Roentgen in 1895. X-rays
More informationSUPPLEMENTARY INFORMATION
SUPPLMTARY IFORMATIO a doi:10.108/nature10402 b 100 nm 100 nm c SAXS Model d ulers assigned to reference- Back-projected free class averages class averages Refinement against single particles Reconstructed
More informationSupporting Information
Supporting Information Structural Analysis of the Binding of Type I, I 1/2, and II Inhibitors to Eph Tyrosine Kinases Jing Dong, *1 Hongtao Zhao, 1 Ting Zhou, 1 Dimitrios Spiliotopoulos, 1 Chitra Rajendran,
More informationSupplementary materials. Crystal structure of the carboxyltransferase domain. of acetyl coenzyme A carboxylase. Department of Biological Sciences
Supplementary materials Crystal structure of the carboxyltransferase domain of acetyl coenzyme A carboxylase Hailong Zhang, Zhiru Yang, 1 Yang Shen, 1 Liang Tong Department of Biological Sciences Columbia
More informationElectronic Supplementary Information (ESI) for Chem. Commun. Unveiling the three- dimensional structure of the green pigment of nitrite- cured meat
Electronic Supplementary Information (ESI) for Chem. Commun. Unveiling the three- dimensional structure of the green pigment of nitrite- cured meat Jun Yi* and George B. Richter- Addo* Department of Chemistry
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1: The HpUreI crystal used for collection of native diffraction data. The crystal belongs to spacegroup P4 2 2 1 2 and has an approximate maximal dimension of 0.25 mm. Supplementary
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.
More informationdepends on the translocation assembly module nanomachine
ARTICLE NUMBER: 16064 DOI: 10.1038/NMICROBIOL.16.64 Effective assembly of fimbriae in Escherichia coli depends on the translocation assembly module nanomachine Christopher Stubenrauch 1, Matthew J. Belousoff
More informationCrystal and molecular structure of cis-dichlorobis(triphenylphosphite)
Molecules 2001, 6, 777-783 molecules ISSN 1420-3049 http://www.mdpi.org Crystal and molecular structure of cis-dichlorobis(triphenylphosphite) Platinum(II) Seyyed Javad Sabounchei * and Ali Naghipour Chemistry.
More informationSUPPLEMENTARY INFORMATION
Data collection Supplementary Table 1 Statistics of data collection, phasing and refinement Native Se-MAD Space group P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 50.4, 94.2, 115.4 49.8, 94.2,
More informationSupplementary Information to
Supplementary Information to Wiesner et al.: A change in conformational dynamics underlies the activation of Eph receptor tyrosine kinases Supplementary Material and Methods Cloning and Mutagenesis Site-directed
More informationDevelopment of Novel Small- Angle X-ray Scattering Data Analysis Methods for Study of Flexible Proteins. Michael Kachala EMBL-Hamburg, Germany
Development of Novel Small- Angle X-ray Scattering Data Analysis Methods for Study of Flexible Proteins Michael Kachala EMBL-Hamburg, Germany 60 mkl >1 mg/ml Monocromatic X-ray beam Sample Mono- or polydisperse
More informationSUPPLEMENTARY INFORMATION. doi: /nature07461
Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Sudhakaran Prabakaran, Robert A. Everley, Isabelle Landrieu, Jean-Michel Wieruszeski, Guy Lippens, Hanno Steen, Jeremy Gunawardena Department of Systems Biology, Harvard Medical
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationViewing and Analyzing Proteins, Ligands and their Complexes 2
2 Viewing and Analyzing Proteins, Ligands and their Complexes 2 Overview Viewing the accessible surface Analyzing the properties of proteins containing thousands of atoms is best accomplished by representing
More informationSUPPLEMENTARY INFORMATION
doi: 10.108/nature0608 a c pmol L-[ H]Leu / mg LeuT pmol L-[ H]Leu / min / mg LeuT 900 50 600 450 00 150 200 150 100 0 0.0 2.5 5.0.5 10.0.5 50 N Cl CMI IMI DMI H C CH N N H C CH N Time (min) 0 0 100 200
More informationActa Cryst. (2017). D73, doi: /s
Acta Cryst. (2017). D73, doi:10.1107/s2059798317010932 Supporting information Volume 73 (2017) Supporting information for article: Designing better diffracting crystals of biotin carboxyl carrier protein
More informationSupplementary Figures
1 Supplementary Figures Supplementary Figure 1 Type I FGFR1 inhibitors (a) Chemical structures of a pyrazolylaminopyrimidine inhibitor (henceforth referred to as PAPI; PDB-code of the FGFR1-PAPI complex:
More informationFull wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 8, 2018 10:24 pm GMT PDB ID : 1A30 Title : HIV-1 PROTEASE COMPLEXED WITH A TRIPEPTIDE INHIBITOR Authors : Louis, J.M.; Dyda, F.; Nashed, N.T.; Kimmel,
More informationCrystals, X-rays and Proteins
Crystals, X-rays and Proteins Comprehensive Protein Crystallography Dennis Sherwood MA (Hons), MPhil, PhD Jon Cooper BA (Hons), PhD OXFORD UNIVERSITY PRESS Contents List of symbols xiv PART I FUNDAMENTALS
More informationIgE binds asymmetrically to its B cell receptor CD23
Supplementary Information IgE binds asymmetrically to its B cell receptor CD23 Balvinder Dhaliwal 1*, Marie O. Y. Pang 2, Anthony H. Keeble 2,3, Louisa K. James 2,4, Hannah J. Gould 2, James M. McDonnell
More informationStructural insights into WcbI, a novel polysaccharide-biosynthesis enzyme
Volume 1 (2014) Supporting information for article: Structural insights into WcbI, a novel polysaccharide-biosynthesis enzyme Mirella Vivoli, Emily Ayres, Edward Beaumont, Michail N. Isupov and Nicholas
More informationSupplementary Information. Overlap between folding and functional energy landscapes for. adenylate kinase conformational change
Supplementary Information Overlap between folding and functional energy landscapes for adenylate kinase conformational change by Ulrika Olsson & Magnus Wolf-Watz Contents: 1. Supplementary Note 2. Supplementary
More informationActa Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural characterization of the virulence factor Nuclease A from Streptococcus agalactiae
More informationInterpreting and evaluating biological NMR in the literature. Worksheet 1
Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively
More informationSpin crossover in polymeric and heterometallic Fe II species containing polytopic dipyridylamino-substituted-triazine ligands.
Electronic Supplementary Information for Spin crossover in polymeric and heterometallic Fe II species containing polytopic dipyridylamino-substituted-triazine ligands Tamsyn M. Ross, [a] Boujemaa Moubaraki,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/5/243/ra68/dc1 Supplementary Materials for Superbinder SH2 Domains Act as Antagonists of Cell Signaling Tomonori Kaneko, Haiming Huang, Xuan Cao, Xing Li, Chengjun
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1: Data collection, phasing and refinement statistics ChbC/Ta 6 Br 12 Native ChbC Data collection Space group P4 3 2 1 2 P4 3 2 1 2 Cell dimensions a, c (Å) 132.75, 453.57 132.81, 452.95
More informationSupporting Information
Supporting Information Oxaliplatin binding to human copper chaperone Atox1 and protein dimerization Benny D. Belviso, 1 Angela Galliani, 2 Alessia Lasorsa, 2 Valentina Mirabelli, 1,3 Rocco Caliandro, 1
More informationExperimental Techniques in Protein Structure Determination
Experimental Techniques in Protein Structure Determination Homayoun Valafar Department of Computer Science and Engineering, USC Two Main Experimental Methods X-Ray crystallography Nuclear Magnetic Resonance
More informationSUPPLEMENTARY INFORMATION
In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 2 ARTICLE NUMBER: 17047 Structure of the mycobacterial ESX-5 type VII secretion system membrane complex by single particle
More informationSupplemental Data SUPPLEMENTAL FIGURES
Supplemental Data CRYSTAL STRUCTURE OF THE MG.ADP-INHIBITED STATE OF THE YEAST F 1 C 10 ATP SYNTHASE Alain Dautant*, Jean Velours and Marie-France Giraud* From Université Bordeaux 2, CNRS; Institut de
More informationSupplementary Materials for
www.advances.sciencemag.org/cgi/content/full/1/7/e1500263/dc1 Supplementary Materials for Newton s cradle proton relay with amide imidic acid tautomerization in inverting cellulase visualized by neutron
More informationCH 3 CH 2 OH +H 2 O CHO. 2e + 2H + + O 2 H 2 O +HCOOH
2 4 H CH 3 2e + 2H + + 2 H 2 2 H CH 2 H 2e + 2H + + 2 H 2 2 H +H 2 CH 2e + 2H + + 2 H 2 2 H +HCH Supplemental Figure S. The three-step 4DM reaction, each step requires two reducing equivalents from ADPH
More informationStructural basis for catalytically restrictive dynamics of a high-energy enzyme state
Supplementary Material Structural basis for catalytically restrictive dynamics of a high-energy enzyme state Michael Kovermann, Jörgen Ådén, Christin Grundström, A. Elisabeth Sauer-Eriksson, Uwe H. Sauer
More informationSupplementary Information. Viral immunoevasin targeting of a Natural Killer cell receptor family
Supplementary Information Viral immunoevasin targeting of a Natural Killer cell receptor family Richard Berry 1, Natasha Ng 1, Philippa M. Saunders 2, Julian P. Vivian 1, Jie Lin 2, Felix A. Deuss 1, Alexandra
More informationPymol Practial Guide
Pymol Practial Guide Pymol is a powerful visualizor very convenient to work with protein molecules. Its interface may seem complex at first, but you will see that with a little practice is simple and powerful
More informationExperimental and Computational Mutagenesis to Investigate the. Positioning of a General Base within an Enzyme Active Site
Experimental and Computational Mutagenesis to Investigate the Positioning of a General Base within an Enzyme Active Site Jason P. Schwans, Philip Hanoian, Benjamin J. Lengerich, Fanny Sunden, Ana Gonzalez
More informationSupplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a
Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a series of tmfret-pairs comprised of single cysteine mutants
More informationOverview - Macromolecular Crystallography
Overview - Macromolecular Crystallography 1. Overexpression and crystallization 2. Crystal characterization and data collection 3. The diffraction experiment 4. Phase problem 1. MIR (Multiple Isomorphous
More informationFull wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 14, 2018 02:00 pm GMT PDB ID : 3RRQ Title : Crystal structure of the extracellular domain of human PD-1 Authors : Lazar-Molnar, E.; Ramagopal, U.A.; Nathenson,
More informationStructure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex
Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin
More informationFull wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 13, 2018 04:03 pm GMT PDB ID : 5NMJ Title : Chicken GRIFIN (crystallisation ph: 6.5) Authors : Ruiz, F.M.; Romero, A. Deposited on : 2017-04-06 Resolution
More informationFull-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),
Supplementary Methods Protein expression and purification Full-length GlpG sequence was generated by PCR from E. coli genomic DNA (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),
More informationData reduction and processing tutorial
Data reduction and processing tutorial Petr V. Konarev European Molecular Biology Laboratory, Hamburg Outstation BioSAXS group EMBL BioSAXS beamline X33, 2012 Optics Vacuum cell Completely redesigned 2005-2012
More informationFull wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 8, 2018 08:34 pm GMT PDB ID : 1RUT Title : Complex of LMO4 LIM domains 1 and 2 with the ldb1 LID domain Authors : Deane, J.E.; Ryan, D.P.; Maher, M.J.;
More informationExpanded View Figures
The EMBO Journal Structure of a Dm peptide bound to the OT module Tobias Raisch et al Expanded View Figures A Hs Dm 262 297 685 8 HEAT HEAT MIF4G 9BD 1SHD 761 91 193 169 1152 1317 16 1376 1467 HEAT HEAT
More informationTable S1 Crystallographic data and structure refinement for complexes 1 and 2. Complex H 2 O
Electronic Supplementary Information: Ternary oxovanadium(iv) complexes of ONO-donor Schiff base and polypyridyl derivatives as protein tyrosine phosphatase inhibitors: synthesis, characterization and
More informationDilute-solution properties of biomacromolecules as indicators of macromolecular structure and interactions
Dilute-solution properties of biomacromolecules as indicators of macromolecular structure and interactions José García de la Torre, Departament of Physical Chemistry University of Murcia, Spain jgt@um.es
More informationSupplemental Information
Supplemental Information Combinatorial Readout of Unmodified H3R2 and Acetylated H3K14 by the Tandem PHD Finger of MOZ Reveals a Regulatory Mechanism for HOXA9 Transcription Yu Qiu 1, Lei Liu 1, Chen Zhao
More informationAccording to the manufacture s direction (Pierce), RNA and DNA
Supplementary method Electrophoretic Mobility-shift assay (EMSA) According to the manufacture s direction (Pierce), RNA and DNA oligonuleotides were firstly labeled by biotin. TAVb (1pM) was incubated
More informationIntroduction to Comparative Protein Modeling. Chapter 4 Part I
Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature
More informationFull wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Jan 28, 2019 11:10 AM EST PDB ID : 6A5H Title : The structure of [4+2] and [6+4] cyclase in the biosynthetic pathway of unidentified natural product Authors
More informationDynamics connect substrate recognition to catalysis in protein kinase A
Supplementary Information for Dynamics connect substrate recognition to catalysis in protein kinase A Larry R. Masterson 1,2, Cecilia Cheng 3, Tao Yu 2, Lei Shi 2, Marco Tonelli 3, Yi Wang 2, Susan S.
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier
More informationSupplemental Information. Molecular Basis of Spectral Diversity. in Near-Infrared Phytochrome-Based. Fluorescent Proteins
Chemistry & Biology, Volume 22 Supplemental Information Molecular Basis of Spectral Diversity in Near-Infrared Phytochrome-Based Fluorescent Proteins Daria M. Shcherbakova, Mikhail Baloban, Sergei Pletnev,
More informationSupplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).
Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted
More information