Supplementary Information. Viral immunoevasin targeting of a Natural Killer cell receptor family

Supplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine

Supplementary figure 1. Comparison of unbound and as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine GM-CSF (slate) with bound GM-CSF in the GIF:GM-CSF complex (GIF: green,

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved

Supplementary Figure 3 a. Structural comparison between the two determined structures for the IL 23:MA12 complex. The overall RMSD between the two

Supplementary Figure 1. Biopanningg and clone enrichment of Alphabody binders against human IL 23. Positive clones in i phage ELISA with optical density (OD) 3 times higher than background are shown for

Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein

Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08

SUPPLEMENTARY INFORMATION

Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,

SUPPLEMENTARY INFORMATION

doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the

FW 1 CDR 1 FW 2 CDR 2

Supplementary Figure 1 Supplementary Figure 1: Interface of the E9:Fas structure. The two interfaces formed by V H and V L of E9 with Fas are shown in stereo. The Fas receptor is represented as a surface

IgE binds asymmetrically to its B cell receptor CD23

Supplementary Information IgE binds asymmetrically to its B cell receptor CD23 Balvinder Dhaliwal 1*, Marie O. Y. Pang 2, Anthony H. Keeble 2,3, Louisa K. James 2,4, Hannah J. Gould 2, James M. McDonnell

ml. ph 7.5 ph 6.5 ph 5.5 ph 4.5. β 2 AR-Gs complex + GDP β 2 AR-Gs complex + GTPγS

a UV28 absorption (mau) 9 8 7 5 3 β 2 AR-Gs complex β 2 AR-Gs complex + GDP β 2 AR-Gs complex + GTPγS β 2 AR-Gs complex dissociated complex excess nucleotides b 9 8 7 5 3 β 2 AR-Gs complex β 2 AR-Gs complex

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting

Supplementary Figures

1 Supplementary Figures Supplementary Figure 1 Type I FGFR1 inhibitors (a) Chemical structures of a pyrazolylaminopyrimidine inhibitor (henceforth referred to as PAPI; PDB-code of the FGFR1-PAPI complex:

Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2

Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell

Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27

Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase

SUPPLEMENTARY INFORMATION

doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2

Supporting Information

Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,

SUPPLEMENTARY INFORMATION

Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3

Bacterial protease uses distinct thermodynamic signatures for substrate recognition

Bacterial protease uses distinct thermodynamic signatures for substrate recognition Gustavo Arruda Bezerra, Yuko Ohara-Nemoto, Irina Cornaciu, Sofiya Fedosyuk, Guillaume Hoffmann, Adam Round, José A. Márquez,

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-

Three-dimensional structure of a viral genome-delivery portal vertex

Three-dimensional structure of a viral genome-delivery portal vertex Adam S. Olia 1, Peter E. Prevelige Jr. 2, John E. Johnson 3 and Gino Cingolani 4 1 Department of Biological Sciences, Purdue University,

Physiochemical Properties of Residues

Physiochemical Properties of Residues Various Sources C N Cα R Slide 1 Conformational Propensities Conformational Propensity is the frequency in which a residue adopts a given conformation (in a polypeptide)

SUPPLEMENTARY INFORMATION

doi:1.138/nature1737 Supplementary Table 1 variant Description FSEC - 2B12 a FSEC - 6A1 a K d (leucine) c Leucine uptake e K (wild-type like) K (Y18F) K (TS) K (TSY) K288A mutant, lipid facing side chain

Supplementary information for:

SUPPLEMETARY IFRMATI Supplementary information for: Structure of a β 1 -adrenergic G protein-coupled receptor Tony Warne, Maria J. Serrano-Vega, Jillian G. Baker#, Rouslan Moukhametzianov, Patricia C.

THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN

THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina

Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases

Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Experimental and Computational Mutagenesis to Investigate the. Positioning of a General Base within an Enzyme Active Site

Experimental and Computational Mutagenesis to Investigate the Positioning of a General Base within an Enzyme Active Site Jason P. Schwans, Philip Hanoian, Benjamin J. Lengerich, Fanny Sunden, Ana Gonzalez

Electronic Supplementary Information. A biologically relevant fluorescent probe to assess the binding of ceramide to the CERT transfer protein

This journal is The Royal Society of Chemistry 20 Electronic Supplementary Information A biologically relevant fluorescent probe to assess the binding of ceramide to the CERT transfer protein Stéphanie

Supplement information

Electronic Supplementary Material (ESI) for Physil Chemistry Chemil Physics. This journal is the Owner Societies 216 Supplement information Fullerenol C 6 (OH) 16 prevents amyloid fibrillization of Aβ

SUPPLEMENTARY INFORMATION

5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.

Supplementary information

Supplementary information The structural basis of modularity in ECF-type ABC transporters Guus B. Erkens 1,2, Ronnie P-A. Berntsson 1,2, Faizah Fulyani 1,2, Maria Majsnerowska 1,2, Andreja Vujičić-Žagar

Ramachandran Plot. 4ysz Phi (degrees) Plot statistics

B Ramachandran Plot ~b b 135 b ~b ~l l Psi (degrees) 5-5 a A ~a L - -135 SER HIS (F) 59 (G) SER (B) ~b b LYS ASP ASP 315 13 13 (A) (F) (B) LYS ALA ALA 315 173 (E) 173 (E)(A) ~p p ~b - -135 - -5 5 135 (degrees)

Full wwpdb X-ray Structure Validation Report i

Full wwpdb X-ray Structure Validation Report i Mar 14, 2018 02:00 pm GMT PDB ID : 3RRQ Title : Crystal structure of the extracellular domain of human PD-1 Authors : Lazar-Molnar, E.; Ramagopal, U.A.; Nathenson,

Supplementary Information. Broad Spectrum Anti-Influenza Agents by Inhibiting Self- Association of Matrix Protein 1

Supplementary Information Broad Spectrum Anti-Influenza Agents by Inhibiting Self- Association of Matrix Protein 1 Philip D. Mosier 1, Meng-Jung Chiang 2, Zhengshi Lin 2, Yamei Gao 2, Bashayer Althufairi

Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)

Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer

SUPPLEMENTARY INFORMATION

Fig. 1 Influences of crystal lattice contacts on Pol η structures. a. The dominant lattice contact between two hpol η molecules (silver and gold) in the type 1 crystals. b. A close-up view of the hydrophobic

What makes a good graphene-binding peptide? Adsorption of amino acids and peptides at aqueous graphene interfaces: Electronic Supplementary

Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 21 What makes a good graphene-binding peptide? Adsorption of amino acids and

SUPPLEMENTARY INFORMATION

Supplementary Table S1 Kinetic Analyses of the AMSH-LP mutants AMSH-LP K M (μm) k cat x 10-3 (s -1 ) WT 71.8 ± 6.3 860 ± 65.4 T353A 76.8 ± 11.7 46.3 ± 3.7 F355A 58.9 ± 10.4 5.33 ± 0.30 proximal S358A 75.1

Full wwpdb X-ray Structure Validation Report i

Full wwpdb X-ray Structure Validation Report i Feb 17, 2018 01:16 am GMT PDB ID : 1IFT Title : RICIN A-CHAIN (RECOMBINANT) Authors : Weston, S.A.; Tucker, A.D.; Thatcher, D.R.; Derbyshire, D.J.; Pauptit,

Supplementary Information

Supplementary Information Resveratrol Serves as a Protein-Substrate Interaction Stabilizer in Human SIRT1 Activation Xuben Hou,, David Rooklin, Hao Fang *,,, Yingkai Zhang Department of Medicinal Chemistry

NMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease

University of Wollongong Research Online Faculty of Science - Papers (Archive) Faculty of Science, Medicine and Health 2009 NMR study of complexes between low molecular mass inhibitors and the West Nile

Secondary Structure. Bioch/BIMS 503 Lecture 2. Structure and Function of Proteins. Further Reading. Φ, Ψ angles alone determine protein structure

Bioch/BIMS 503 Lecture 2 Structure and Function of Proteins August 28, 2008 Robert Nakamoto rkn3c@virginia.edu 2-0279 Secondary Structure Φ Ψ angles determine protein structure Φ Ψ angles are restricted

Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets

Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas

Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate

SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,

Structural insights into energy regulation of light-harvesting complex from spinach CP29

SUPPLEMENTARY INFORMATION Structural insights into energy regulation of light-harvesting complex from spinach CP29 Xiaowei Pan 1, Mei Li 1, Tao Wan 1,2, Longfei Wang 1,2, Chenjun Jia 1,2, Zhiqiang Hou

Stabilizing the CH2 domain of an Antibody by Engineering in an Enhanced Aromatic Sequon

Stabilizing the CH2 domain of an Antibody by Engineering in an Enhanced Aromatic Sequon Wentao Chen,, Leopold Kong, Stephen Connelly, Julia M. Dendle,, Yu Liu,, Ian A. Wilson,#, Evan T. Powers, *, Jeffery

Ranjit P. Bahadur Assistant Professor Department of Biotechnology Indian Institute of Technology Kharagpur, India. 1 st November, 2013

Hydration of protein-rna recognition sites Ranjit P. Bahadur Assistant Professor Department of Biotechnology Indian Institute of Technology Kharagpur, India 1 st November, 2013 Central Dogma of life DNA

Supporting Online Material for

www.sciencemag.org/cgi/content/full/310/5751/1159/dc1 Supporting Online Material for Structure of the Quaternary Complex of Interleukin-2 with Its α, β, and γ c Receptors Xinquan Wang, Mathias Rickert,

SUPPLEMENTARY INFORMATION

Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase

Oxygen Binding in Hemocyanin

Supporting Information for Quantum Mechanics/Molecular Mechanics Study of Oxygen Binding in Hemocyanin Toru Saito and Walter Thiel* Max-Planck-Institut für Kohlenforschung, Kaiser-Wilhelm-Platz 1, D-45470

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),

Supplemental Information. Molecular Basis of Spectral Diversity. in Near-Infrared Phytochrome-Based. Fluorescent Proteins

Chemistry & Biology, Volume 22 Supplemental Information Molecular Basis of Spectral Diversity in Near-Infrared Phytochrome-Based Fluorescent Proteins Daria M. Shcherbakova, Mikhail Baloban, Sergei Pletnev,

Full wwpdb X-ray Structure Validation Report i

Full wwpdb X-ray Structure Validation Report i Mar 8, 2018 06:13 pm GMT PDB ID : 5G5C Title : Structure of the Pyrococcus furiosus Esterase Pf2001 with space group C2221 Authors : Varejao, N.; Reverter,

Structural characterization of NiV N 0 P in solution and in crystal.

Supplementary Figure 1 Structural characterization of NiV N 0 P in solution and in crystal. (a) SAXS analysis of the N 32-383 0 -P 50 complex. The Guinier plot for complex concentrations of 0.55, 1.1,

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.

Packing of Secondary Structures

7.88 Lecture Notes - 4 7.24/7.88J/5.48J The Protein Folding and Human Disease Professor Gossard Retrieving, Viewing Protein Structures from the Protein Data Base Helix helix packing Packing of Secondary

Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).

Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted

3. Results Results Crystal structure of the N-terminal domain of human SHBG in complex with DHT

3. Results 33 3. Results 3.1. Crystal structure of the N-terminal domain of human SHBG in complex with DHT 3.1.1. Crystallization For crystallization experiments the amino-terminal laminin G-like domain

Introduction to Comparative Protein Modeling. Chapter 4 Part I

Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature

Supplementary Information

Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supplementary Information Anion clamp allows flexible protein to impose coordination geometry on

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/5/243/ra68/dc1 Supplementary Materials for Superbinder SH2 Domains Act as Antagonists of Cell Signaling Tomonori Kaneko, Haiming Huang, Xuan Cao, Xing Li, Chengjun

Supplementary Figure 1. Biochemical and sequence alignment analyses the

Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).

B O C 4 H 2 O O. NOTE: The reaction proceeds with a carbonium ion stabilized on the C 1 of sugar A.

hbcse 33 rd International Page 101 hemistry lympiad Preparatory 05/02/01 Problems d. In the hydrolysis of the glycosidic bond, the glycosidic bridge oxygen goes with 4 of the sugar B. n cleavage, 18 from

SUPPLEMENTARY INFORMATION

doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group

Nature Structural & Molecular Biology doi: /nsmb Supplementary Figure 1. CRBN binding assay with thalidomide enantiomers.

Supplementary Figure 1 CRBN binding assay with thalidomide enantiomers. (a) Competitive elution assay using thalidomide-immobilized beads coupled with racemic thalidomide. Beads were washed three times

Viewing and Analyzing Proteins, Ligands and their Complexes 2

2 Viewing and Analyzing Proteins, Ligands and their Complexes 2 Overview Viewing the accessible surface Analyzing the properties of proteins containing thousands of atoms is best accomplished by representing

ENZYME MECHANISMS, PROTEASES, STRUCTURAL BIOLOGY

Supplementary Information SUBJECT AREAS: ENZYME MECHANISMS, PROTEASES, STRUCTURAL BIOLOGY Correspondence and requests for materials should be addressed to N.T. (ntanaka@pharm.showa-u.ac.jp) or W.O. (owataru@vos.nagaokaut.ac.jp)

Figure 1. Molecules geometries of 5021 and Each neutral group in CHARMM topology was grouped in dash circle.

Project I Chemistry 8021, Spring 2005/2/23 This document was turned in by a student as a homework paper. 1. Methods First, the cartesian coordinates of 5021 and 8021 molecules (Fig. 1) are generated, in

Full wwpdb X-ray Structure Validation Report i

Full wwpdb X-ray Structure Validation Report i Jan 14, 2019 11:10 AM EST PDB ID : 6GYW Title : Crystal structure of DacA from Staphylococcus aureus Authors : Tosi, T.; Freemont, P.S.; Grundling, A. Deposited

Supplementary Information Intrinsic Localized Modes in Proteins

Supplementary Information Intrinsic Localized Modes in Proteins Adrien Nicolaï 1,, Patrice Delarue and Patrick Senet, 1 Department of Physics, Applied Physics and Astronomy, Rensselaer Polytechnic Institute,

Full wwpdb X-ray Structure Validation Report i

Full wwpdb X-ray Structure Validation Report i Jan 28, 2019 11:10 AM EST PDB ID : 6A5H Title : The structure of [4+2] and [6+4] cyclase in the biosynthetic pathway of unidentified natural product Authors

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11744 Supplementary Table 1. Crystallographic data collection and refinement statistics. Wild-type Se-Met-BcsA-B SmCl 3 -soaked EMTS-soaked Data collection Space

7.012 Problem Set 1. i) What are two main differences between prokaryotic cells and eukaryotic cells?

ame 7.01 Problem Set 1 Section Question 1 a) What are the four major types of biological molecules discussed in lecture? Give one important function of each type of biological molecule in the cell? b)

Supporting information

Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2015 Supporting information Influence

Supporting Information

Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)

A prevalent intraresidue hydrogen bond stabilizes proteins

Supplementary Information A prevalent intraresidue hydrogen bond stabilizes proteins Robert W. Newberry 1 & Ronald T. Raines 1,2 * 1 Department of Chemistry and 2 Department of Biochemistry, University

Protein Structure Bioinformatics Introduction

1 Swiss Institute of Bioinformatics Protein Structure Bioinformatics Introduction Basel, 27. September 2004 Torsten Schwede Biozentrum - Universität Basel Swiss Institute of Bioinformatics Klingelbergstr

SUPPLEMENTARY INFORMATION

Supplementary Table 1: Data collection, phasing and refinement statistics ChbC/Ta 6 Br 12 Native ChbC Data collection Space group P4 3 2 1 2 P4 3 2 1 2 Cell dimensions a, c (Å) 132.75, 453.57 132.81, 452.95

Structural insights into Aspergillus fumigatus lectin specificity - AFL binding sites are functionally non-equivalent

Acta Cryst. (2015). D71, doi:10.1107/s1399004714026595 Supporting information Volume 71 (2015) Supporting information for article: Structural insights into Aspergillus fumigatus lectin specificity - AFL

Full wwpdb X-ray Structure Validation Report i

Full wwpdb X-ray Structure Validation Report i Mar 8, 2018 08:34 pm GMT PDB ID : 1RUT Title : Complex of LMO4 LIM domains 1 and 2 with the ldb1 LID domain Authors : Deane, J.E.; Ryan, D.P.; Maher, M.J.;

Exam I Answer Key: Summer 2006, Semester C

1. Which of the following tripeptides would migrate most rapidly towards the negative electrode if electrophoresis is carried out at ph 3.0? a. gly-gly-gly b. glu-glu-asp c. lys-glu-lys d. val-asn-lys

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.

SUPPLEMENTARY INFORMATION. doi: /nature07461

Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of

Nature Structural and Molecular Biology: doi: /nsmb.2938

Supplementary Figure 1 Characterization of designed leucine-rich-repeat proteins. (a) Water-mediate hydrogen-bond network is frequently visible in the convex region of LRR crystal structures. Examples

Cryo-EM data collection, refinement and validation statistics

1 Table S1 Cryo-EM data collection, refinement and validation statistics Data collection and processing CPSF-160 WDR33 (EMDB-7114) (PDB 6BM0) CPSF-160 WDR33 (EMDB-7113) (PDB 6BLY) CPSF-160 WDR33 CPSF-30

SUPPLEMENTARY INFORMATION

Supplementary Table 1: Amplitudes of three current levels. Level 0 (pa) Level 1 (pa) Level 2 (pa) TrkA- TrkH WT 200 K 0.01 ± 0.01 9.5 ± 0.01 18.7 ± 0.03 200 Na * 0.001 ± 0.01 3.9 ± 0.01 12.5 ± 0.03 200

Rotamers in the CHARMM19 Force Field

Appendix A Rotamers in the CHARMM19 Force Field The people may be made to follow a path of action, but they may not be made to understand it. Confucius (551 BC - 479 BC) ( ) V r 1 (j),r 2 (j),r 3 (j),...,r

Halogenation of glycopeptide antibiotics occurs at the amino acid level during non-ribosomal peptide synthesis

Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 Halogenation of glycopeptide antibiotics occurs at the amino acid level during non-ribosomal

Full-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),

Supplementary Methods Protein expression and purification Full-length GlpG sequence was generated by PCR from E. coli genomic DNA (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),

Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions. Implicated in Dimerization and Autoinhibition

JBC Papers in Press. Published on November 1, 2000 as Manuscript M006502200 Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions Implicated in Dimerization and Autoinhibition 1 Copyright

Structure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex

Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin

Helpful resources for all X ray lectures Crystallization http://www.hamptonresearch.com under tech support: crystal growth 101 literature Spacegroup tables http://img.chem.ucl.ac.uk/sgp/mainmenu.htm Crystallography

Supplementary Figure S1 Domain organization of ASIC1. Side view of the trimeric sodium channel ASIC1 910 in ribbon representation showing the domains

Supplementary Figure S1 Domain organization of ASIC1. Side view of the trimeric sodium channel ASIC1 910 in ribbon representation showing the domains according to the nomenclature of Jasti et al. 2007

Supporting information to: Time-resolved observation of protein allosteric communication. Sebastian Buchenberg, Florian Sittel and Gerhard Stock 1

Supporting information to: Time-resolved observation of protein allosteric communication Sebastian Buchenberg, Florian Sittel and Gerhard Stock Biomolecular Dynamics, Institute of Physics, Albert Ludwigs

Lipid Regulated Intramolecular Conformational Dynamics of SNARE-Protein Ykt6

Supplementary Information for: Lipid Regulated Intramolecular Conformational Dynamics of SNARE-Protein Ykt6 Yawei Dai 1, 2, Markus Seeger 3, Jingwei Weng 4, Song Song 1, 2, Wenning Wang 4, Yan-Wen 1, 2,

Advanced Certificate in Principles in Protein Structure. You will be given a start time with your exam instructions

BIRKBECK COLLEGE (University of London) Advanced Certificate in Principles in Protein Structure MSc Structural Molecular Biology Date: Thursday, 1st September 2011 Time: 3 hours You will be given a start

LS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor

LS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor Note: Adequate space is given for each answer. Questions that require a brief explanation should

Programme Last week s quiz results + Summary Fold recognition Break Exercise: Modelling remote homologues

Programme 8.00-8.20 Last week s quiz results + Summary 8.20-9.00 Fold recognition 9.00-9.15 Break 9.15-11.20 Exercise: Modelling remote homologues 11.20-11.40 Summary & discussion 11.40-12.00 Quiz 1 Feedback

Automated identification of functional dynamic contact networks from X-ray crystallography

1 Automated identification of functional dynamic contact networks from X-ray crystallography Henry van den Bedem, Gira Bhabha, Kun Yang, Peter E. Wright and James S. Fraser Supplementary Figure 1 Supplementary

SOCS3 binds specific receptor JAK complexes to control cytokine signaling by direct kinase inhibition SUPPLEMENTARY INFORMATION

SOCS3 binds specific receptor JAK complexes to control cytokine signaling by direct kinase inhibition Nadia J. Kershaw 1,2, James M. Murphy 1,2, Nicholas P.D. Liau 1,2, Leila N. Varghese 1,2, Artem Laktyushin

Bahnson Biochemistry Cume, April 8, 2006 The Structural Biology of Signal Transduction

Name page 1 of 6 Bahnson Biochemistry Cume, April 8, 2006 The Structural Biology of Signal Transduction Part I. The ion Ca 2+ can function as a 2 nd messenger. Pick a specific signal transduction pathway